Incidental Mutation 'Z1176:Arhgap33'
ID 621889
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene Name Rho GTPase activating protein 33
Synonyms Snx26, NOMA-GAP, Tcgap
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # Z1176 ()
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30522226-30535060 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 30522717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1263 (R1263S)
Ref Sequence ENSEMBL: ENSMUSP00000038412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208522] [ENSMUST00000208538]
AlphaFold Q80YF9
Predicted Effect probably benign
Transcript: ENSMUST00000044338
AA Change: R1263S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: R1263S

low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207858
AA Change: R1239S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000207860
AA Change: R1263S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect probably benign
Transcript: ENSMUST00000208538
AA Change: R1263S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 3316 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C A 2: 32,381,764 (GRCm38) G3C possibly damaging Het
1110032A03Rik C A 9: 50,768,219 (GRCm38) probably benign Het
1520401A03Rik G C 17: 23,715,763 (GRCm38) A96G possibly damaging Het
1600015I10Rik A C 6: 48,932,468 (GRCm38) K549T probably benign Het
1700001C19Rik T G 17: 47,413,734 (GRCm38) N154T probably benign Het
1700003E16Rik A C 6: 83,161,115 (GRCm38) K74N probably damaging Het
1700013G24Rik C A 4: 137,454,992 (GRCm38) P153T probably damaging Het
1700016C15Rik A T 1: 177,741,017 (GRCm38) R27W possibly damaging Het
1700017N19Rik T G 10: 100,612,429 (GRCm38) M274R probably damaging Het
1700019N19Rik T G 19: 58,787,706 (GRCm38) K105T probably damaging Het
1700030J22Rik G T 8: 116,973,597 (GRCm38) T22K probably benign Het
1700123K08Rik G T 5: 138,563,553 (GRCm38) Q124K probably damaging Het
1810046K07Rik G T 9: 51,291,564 (GRCm38) P97T probably benign Het
2310035C23Rik G T 1: 105,719,615 (GRCm38) R734M probably benign Het
2310050C09Rik T C 3: 92,869,274 (GRCm38) Q34R probably benign Het
2610021A01Rik G C 7: 41,625,342 (GRCm38) L156F probably benign Het
2610028H24Rik C A 10: 76,452,863 (GRCm38) P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 (GRCm38) E10G probably damaging Het
2700081O15Rik C G 19: 7,422,747 (GRCm38) P193A unknown Het
2900011O08Rik C A 16: 14,049,481 (GRCm38) R68S probably damaging Het
3100002H09Rik T A 4: 124,610,705 (GRCm38) D18V unknown Het
3110018I06Rik C G 12: 107,488,855 (GRCm38) R67G unknown Het
3110082J24Rik G C 5: 30,105,067 (GRCm38) A98G unknown Het
4833420G17Rik C A 13: 119,477,808 (GRCm38) T484K not run Het
4833423E24Rik C T 2: 85,518,462 (GRCm38) R102Q probably benign Het
4921501E09Rik C A 17: 33,065,657 (GRCm38) D724Y possibly damaging Het
4921507P07Rik G T 6: 50,574,021 (GRCm38) L483I possibly damaging Het
4921511C20Rik A G X: 127,394,842 (GRCm38) K135E probably damaging Het
4930415L06Rik A C X: 89,930,241 (GRCm38) N783K unknown Het
4930447C04Rik G C 12: 72,916,726 (GRCm38) F18L probably benign Het
4930503B20Rik C T 3: 146,650,956 (GRCm38) D66N probably damaging Het
4930516K23Rik A T 7: 104,059,288 (GRCm38) F105I probably damaging Het
4930562C15Rik G A 16: 4,866,248 (GRCm38) V236M possibly damaging Het
4930595M18Rik C T X: 81,420,272 (GRCm38) G610R probably damaging Het
4932415D10Rik A C 10: 82,289,896 (GRCm38) L2427V possibly damaging Het
4932415D10Rik A G 10: 82,293,228 (GRCm38) I1316T probably benign Het
4932415D10Rik G T 10: 82,282,537 (GRCm38) L4880I unknown Het
4933402D24Rik T A 1: 63,756,335 (GRCm38) K90* probably null Het
4933402J07Rik G T 8: 87,568,574 (GRCm38) M113I probably benign Het
4933403O08Rik C A X: 112,241,313 (GRCm38) R213S probably benign Het
4933425L06Rik G A 13: 105,111,144 (GRCm38) G324D probably damaging Het
4933427D14Rik C T 11: 72,159,000 (GRCm38) V852I probably benign Het
4933427I04Rik T C 4: 123,860,875 (GRCm38) L194P probably damaging Het
5330417C22Rik C A 3: 108,471,978 (GRCm38) G345C probably damaging Het
5330417C22Rik C A 3: 108,471,435 (GRCm38) W349L probably damaging Het
5730559C18Rik C A 1: 136,219,783 (GRCm38) R399L possibly damaging Het
6430571L13Rik G T 9: 107,342,527 (GRCm38) G60C probably damaging Het
9430015G10Rik G C 4: 156,122,011 (GRCm38) G76A probably benign Het
9530053A07Rik G A 7: 28,154,762 (GRCm38) G1717D probably benign Het
9530053A07Rik G A 7: 28,142,386 (GRCm38) S582N probably benign Het
A1cf A C 19: 31,918,017 (GRCm38) I167L probably benign Het
A2ml1 A G 6: 128,571,977 (GRCm38) F281L probably benign Het
A430005L14Rik CG C 4: 153,960,665 (GRCm38) probably null Het
A730049H05Rik C A 6: 92,828,066 (GRCm38) S69* probably null Het
A830018L16Rik C G 1: 11,518,625 (GRCm38) Q89E probably damaging Het
AA986860 A C 1: 130,742,991 (GRCm38) S317R probably benign Het
Aasdh C G 5: 76,891,796 (GRCm38) probably null Het
Aass T C 6: 23,078,857 (GRCm38) T719A probably damaging Het
Aatf C T 11: 84,442,585 (GRCm38) A500T probably benign Het
Abca12 A C 1: 71,284,070 (GRCm38) Y1618D probably damaging Het
Abca13 G T 11: 9,251,376 (GRCm38) G153C possibly damaging Het
Abca13 C A 11: 9,267,461 (GRCm38) P301H probably damaging Het
Abca13 C A 11: 9,335,182 (GRCm38) A3272E probably damaging Het
Abca13 G T 11: 9,335,181 (GRCm38) A3272S probably damaging Het
Abca13 G T 11: 9,294,342 (GRCm38) W2068C probably benign Het
Abca14 G T 7: 120,246,923 (GRCm38) G599V probably damaging Het
Abca15 G T 7: 120,382,505 (GRCm38) G1061W probably damaging Het
Abca15 T G 7: 120,346,026 (GRCm38) F442V probably benign Het
Abca2 G T 2: 25,444,110 (GRCm38) V1800L probably benign Het
Abca4 G T 3: 122,103,488 (GRCm38) W605C probably damaging Het
Abca4 C A 3: 122,156,443 (GRCm38) S1805R probably damaging Het
Abca7 T C 10: 80,006,559 (GRCm38) L1109P probably damaging Het
Abca7 C T 10: 79,999,432 (GRCm38) R208* probably null Het
Abca8b A T 11: 109,961,908 (GRCm38) C761S possibly damaging Het
Abca8b G A 11: 109,974,644 (GRCm38) T329I possibly damaging Het
Abca9 G A 11: 110,135,375 (GRCm38) A953V probably benign Het
Abcb10 C A 8: 123,982,663 (GRCm38) G51C possibly damaging Het
Abcb11 C A 2: 69,291,981 (GRCm38) G386V probably damaging Het
Abcb1b A G 5: 8,827,441 (GRCm38) Y667C probably benign Het
Abcb4 C A 5: 8,959,005 (GRCm38) R1221S probably damaging Het
Abcb5 C A 12: 118,918,272 (GRCm38) G574V probably damaging Het
Abcb8 A T 5: 24,400,995 (GRCm38) D226V probably damaging Het
Abcc10 C T 17: 46,324,262 (GRCm38) A272T probably benign Het
Abcc10 G A 17: 46,313,700 (GRCm38) H784Y probably damaging Het
Abcc12 T G 8: 86,550,601 (GRCm38) K389T probably damaging Het
Abcc3 C G 11: 94,361,275 (GRCm38) Q827H probably benign Het
Abcc6 A T 7: 45,992,306 (GRCm38) probably null Het
Abcc6 C T 7: 45,979,734 (GRCm38) D1363N probably damaging Het
Abcc8 T C 7: 46,106,965 (GRCm38) S1439G possibly damaging Het
Abhd12b G A 12: 70,163,451 (GRCm38) D134N probably damaging Het
Abhd13 A C 8: 9,987,413 (GRCm38) K3N probably damaging Het
Abl1 A C 2: 31,689,827 (GRCm38) K7N probably damaging Het
Ablim2 C T 5: 35,848,858 (GRCm38) P409L possibly damaging Het
Abo C G 2: 26,848,258 (GRCm38) V45L probably benign Het
Abtb2 G T 2: 103,708,172 (GRCm38) E649* probably null Het
Acaca G C 11: 84,260,720 (GRCm38) A815P probably damaging Het
Acacb G T 5: 114,248,948 (GRCm38) R2386L probably benign Het
Acan A C 7: 79,111,354 (GRCm38) H1938P probably benign Het
Acap3 C G 4: 155,905,179 (GRCm38) N693K probably damaging Het
Acmsd G T 1: 127,745,802 (GRCm38) V76F probably damaging Het
Actc1 C A 2: 114,051,997 (GRCm38) C12F probably benign Het
Actl11 T G 9: 107,931,700 (GRCm38) V1074G probably benign Het
Actl6a A C 3: 32,726,543 (GRCm38) I411L probably benign Het
Actl9 C A 17: 33,433,101 (GRCm38) P45Q possibly damaging Het
Actr10 C A 12: 70,962,029 (GRCm38) A412E probably damaging Het
Actr1b T A 1: 36,701,208 (GRCm38) H284L probably benign Het
Actrt2 G T 4: 154,666,832 (GRCm38) N282K probably benign Het
Acvr1 C A 2: 58,479,868 (GRCm38) G43V probably benign Het
Acy3 G T 19: 3,987,107 (GRCm38) R13L probably damaging Het
Adam17 T G 12: 21,361,737 (GRCm38) Q51P possibly damaging Het
Adam21 T G 12: 81,559,743 (GRCm38) N415T probably damaging Het
Adam30 A G 3: 98,162,360 (GRCm38) Y503C possibly damaging Het
Adam32 C A 8: 24,948,750 (GRCm38) E16* probably null Het
Adam6a A G 12: 113,545,321 (GRCm38) K438R possibly damaging Het
Adam7 A T 14: 68,527,701 (GRCm38) S82R probably benign Het
Adamts10 G T 17: 33,528,788 (GRCm38) R66L probably damaging Het
Adamts10 C T 17: 33,528,787 (GRCm38) R66W probably damaging Het
Adamts12 G T 15: 11,336,383 (GRCm38) C1518F not run Het
Adamts15 G C 9: 30,910,700 (GRCm38) C480W probably damaging Het
Adamts16 C T 13: 70,761,773 (GRCm38) R887K probably benign Het
Adamts18 A T 8: 113,743,168 (GRCm38) I634N possibly damaging Het
Adamts2 G T 11: 50,792,708 (GRCm38) R939L probably damaging Het
Adamts3 C T 5: 89,775,351 (GRCm38) V199I not run Het
Adamts4 C G 1: 171,258,784 (GRCm38) A715G probably benign Het
Adamts4 G A 1: 171,258,783 (GRCm38) A715T probably benign Het
Adamtsl1 C T 4: 86,342,177 (GRCm38) P883L probably damaging Het
Adamtsl1 T G 4: 86,342,693 (GRCm38) M1055R probably benign Het
Adamtsl2 C A 2: 27,081,720 (GRCm38) Q6K probably benign Het
Adcy1 G T 11: 7,150,858 (GRCm38) R802S possibly damaging Het
Adcy1 C A 11: 7,149,536 (GRCm38) T672N probably damaging Het
Adcy1 G A 11: 7,109,098 (GRCm38) D335N probably damaging Het
Adcy1 G A 11: 7,150,857 (GRCm38) R802K probably damaging Het
Adcy5 C G 16: 35,290,185 (GRCm38) F907L probably benign Het
Adcy5 G T 16: 35,156,321 (GRCm38) G75C unknown Het
Adcy5 G A 16: 35,291,544 (GRCm38) V924M not run Het
Adcy8 T C 15: 64,725,518 (GRCm38) T895A probably benign Het
Adcy9 G T 16: 4,307,232 (GRCm38) P745Q probably damaging Het
Add2 G T 6: 86,098,590 (GRCm38) K240N probably damaging Het
Adgb G T 10: 10,378,742 (GRCm38) T1159N probably benign Het
Adgrb2 G T 4: 130,017,563 (GRCm38) C1126F probably damaging Het
Adgrb3 C T 1: 25,093,914 (GRCm38) D1364N probably benign Het
Adgre1 T G 17: 57,361,729 (GRCm38) L30R possibly damaging Het
Adgrg4 C A X: 56,914,259 (GRCm38) P601H probably benign Het
Adgrg4 G T X: 56,894,702 (GRCm38) V174L probably benign Het
Adgrg5 G C 8: 94,935,151 (GRCm38) W173C Het
Adgrv1 C A 13: 81,559,634 (GRCm38) A1218S possibly damaging Het
Adh7 G A 3: 138,223,731 (GRCm38) G87D probably benign Het
Adora2a C A 10: 75,333,328 (GRCm38) Q209K probably benign Het
Adprhl1 C G 8: 13,225,613 (GRCm38) A382P probably benign Het
Adprhl2 C G 4: 126,321,661 (GRCm38) A4P unknown Het
Adprhl2 C G 4: 126,321,567 (GRCm38) G35A probably damaging Het
Adra1a C A 14: 66,727,628 (GRCm38) L356M probably benign Het
Adra2b C A 2: 127,364,038 (GRCm38) D158E probably benign Het
Adra2c G C 5: 35,280,904 (GRCm38) R340P probably damaging Het
Adss C A 1: 177,796,498 (GRCm38) probably benign Het
Adss C A 1: 177,776,493 (GRCm38) C182F probably damaging Het
Aff3 T A 1: 38,329,872 (GRCm38) K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,478,353 (GRCm38) probably null Het
Afg3l2 C A 18: 67,431,707 (GRCm38) L232F probably benign Het
Afmid G A 11: 117,834,966 (GRCm38) D129N probably benign Het
Agap2 G C 10: 127,080,225 (GRCm38) G202R unknown Het
Agbl1 T G 7: 76,418,685 (GRCm38) L333R Het
Agbl4 T A 4: 110,660,839 (GRCm38) L109Q probably damaging Het
Agbl4 G T 4: 111,526,643 (GRCm38) G232W probably damaging Het
Ago4 C A 4: 126,520,190 (GRCm38) probably null Het
Ahnak G T 19: 9,008,856 (GRCm38) M2501I probably damaging Het
AI593442 C A 9: 52,677,945 (GRCm38) G111C probably damaging Het
AI597479 A G 1: 43,113,190 (GRCm38) H216R probably benign Het
Aipl1 G T 11: 72,030,533 (GRCm38) P179T possibly damaging Het
Ak9 G C 10: 41,348,251 (GRCm38) G524R Het
Ak9 G T 10: 41,423,023 (GRCm38) W1573C unknown Het
Akap1 G T 11: 88,837,167 (GRCm38) T663N probably benign Het
Akap13 G T 7: 75,730,552 (GRCm38) R491L probably damaging Het
Akap14 G T X: 37,163,245 (GRCm38) P279H unknown Het
Akap4 G T X: 7,078,360 (GRCm38) E831* probably null Het
Akap6 C G 12: 53,140,444 (GRCm38) T1547R possibly damaging Het
Akap8 C A 17: 32,306,549 (GRCm38) V519L probably damaging Het
Akap9 G T 5: 3,962,251 (GRCm38) G985W probably damaging Het
Akirin1 C T 4: 123,750,067 (GRCm38) G33D probably damaging Het
Akr1cl C A 1: 65,016,687 (GRCm38) G219C probably damaging Het
Alas1 G A 9: 106,238,769 (GRCm38) R349C probably benign Het
Alas1 C A 9: 106,243,367 (GRCm38) Q76H probably benign Het
Aldh1l1 G T 6: 90,583,173 (GRCm38) V601L probably benign Het
Aldh1l1 GAA GA 6: 90,557,284 (GRCm38) probably null Het
Aldh3a2 T G 11: 61,264,283 (GRCm38) K145T probably benign Het
Aldoart1 C A 4: 72,852,004 (GRCm38) R189L probably benign Het
Alg8 T G 7: 97,383,761 (GRCm38) F285V probably benign Het
Alkbh8 G C 9: 3,345,820 (GRCm38) G180A probably damaging Het
Alms1 C G 6: 85,678,418 (GRCm38) N2846K probably benign Het
Alox12b T A 11: 69,157,323 (GRCm38) I26N possibly damaging Het
Alox12b G C 11: 69,157,325 (GRCm38) V27L possibly damaging Het
Aloxe3 C A 11: 69,133,079 (GRCm38) L279M probably damaging Het
Alpi T C 1: 87,099,072 (GRCm38) N428S probably benign Het
Alpk1 T A 3: 127,673,438 (GRCm38) H1064L probably damaging Het
Alpk2 G C 18: 65,305,611 (GRCm38) L904V probably damaging Het
Alpk3 G T 7: 81,078,626 (GRCm38) L501F probably benign Het
Alpl G C 4: 137,754,010 (GRCm38) S110R probably damaging Het
Alppl2 G T 1: 87,087,704 (GRCm38) H378Q probably damaging Het
Alppl2 G A 1: 87,087,666 (GRCm38) S391F probably damaging Het
Amer3 G T 1: 34,589,013 (GRCm38) V778L probably benign Het
Ampd2 C A 3: 108,080,064 (GRCm38) G151V probably damaging Het
Amz1 G T 5: 140,744,073 (GRCm38) E121* probably null Het
Ang4 G T 14: 51,764,148 (GRCm38) C114* probably null Het
Ank3 T G 10: 69,932,474 (GRCm38) L941R possibly damaging Het
Ank3 G C 10: 69,991,215 (GRCm38) E1905Q Het
Ank3 C T 10: 69,951,010 (GRCm38) A968V possibly damaging Het
Ankar G T 1: 72,689,961 (GRCm38) L342I possibly damaging Het
Ankib1 G A 5: 3,692,763 (GRCm38) S1084L probably benign Het
Ankk1 T G 9: 49,421,911 (GRCm38) K91T probably damaging Het
Ankk1 T A 9: 49,416,643 (GRCm38) Q412L probably benign Het
Ankle2 G C 5: 110,234,499 (GRCm38) E114Q possibly damaging Het
Ankmy1 C T 1: 92,878,437 (GRCm38) G780E probably damaging Het
Ankmy2 T G 12: 36,186,859 (GRCm38) M222R probably damaging Het
Ankrd11 C T 8: 122,895,803 (GRCm38) V437M possibly damaging Het
Ankrd12 C A 17: 65,970,338 (GRCm38) probably null Het
Ankrd36 T A 11: 5,615,538 (GRCm38) F457L probably benign Het
Ankrd39 C G 1: 36,542,005 (GRCm38) A88P probably damaging Het
Ankrd45 C T 1: 161,163,283 (GRCm38) A202V possibly damaging Het
Ankrd49 C G 9: 14,781,428 (GRCm38) A147P probably damaging Het
Ankrd6 G T 4: 32,806,326 (GRCm38) S642R probably benign Het
Ankrd6 C T 4: 32,806,229 (GRCm38) E675K possibly damaging Het
Ankrd6 G C 4: 32,824,486 (GRCm38) N142K probably damaging Het
Anks3 T G 16: 4,950,714 (GRCm38) Q255P probably benign Het
Ano2 T G 6: 125,863,453 (GRCm38) Y362* probably null Het
Ano2 G T 6: 125,710,707 (GRCm38) Q58H probably benign Het
Ano4 A T 10: 89,112,945 (GRCm38) V101E probably benign Het
Ano5 T A 7: 51,574,703 (GRCm38) V469E probably damaging Het
Ano6 C A 15: 95,913,460 (GRCm38) P147Q probably damaging Het
Ano7 C A 1: 93,394,465 (GRCm38) D398E probably benign Het
Anpep G C 7: 79,827,639 (GRCm38) P727A possibly damaging Het
Anxa10 T G 8: 62,063,070 (GRCm38) probably null Het
Aoc2 G T 11: 101,326,420 (GRCm38) G443V probably benign Het
Aox4 G C 1: 58,246,351 (GRCm38) E665Q possibly damaging Het
Ap1m2 G A 9: 21,298,256 (GRCm38) R375* probably null Het
Ap1s1 G A 5: 137,037,470 (GRCm38) T126I probably damaging Het
Apba1 C A 19: 23,944,115 (GRCm38) S767R probably damaging Het
Apex2 C A X: 150,572,099 (GRCm38) G414V probably benign Het
Apoa4 C A 9: 46,242,589 (GRCm38) R163S possibly damaging Het
Apob G T 12: 8,004,978 (GRCm38) V1326L probably benign Het
Apob G C 12: 7,998,011 (GRCm38) G997R probably damaging Het
Apobr A T 7: 126,587,264 (GRCm38) E649V probably damaging Het
Apoh G T 11: 108,343,459 (GRCm38) probably benign Het
Apol11b A C 15: 77,638,007 (GRCm38) I30R probably benign Het
App A G 16: 85,024,917 (GRCm38) L390P probably damaging Het
Aqr C A 2: 114,108,122 (GRCm38) R1283M probably damaging Het
Aqr C G 2: 114,109,991 (GRCm38) A1225P probably benign Het
Ar G T X: 98,151,009 (GRCm38) G410W probably damaging Het
Arfgef2 G A 2: 166,894,712 (GRCm38) R1768Q probably damaging Het
Arfgef3 T A 10: 18,634,852 (GRCm38) H787L probably benign Het
Arfgef3 T A 10: 18,591,437 (GRCm38) K2005M probably damaging Het
Arfgef3 C A 10: 18,608,358 (GRCm38) C1383F probably damaging Het
Arhgap1 C T 2: 91,650,214 (GRCm38) A27V possibly damaging Het
Arhgap10 C A 8: 77,277,175 (GRCm38) G667V probably benign Het
Arhgap10 T G 8: 77,432,805 (GRCm38) S107R probably damaging Het
Arhgap11a C G 2: 113,833,758 (GRCm38) A727P probably benign Het
Arhgap22 A T 14: 33,362,522 (GRCm38) R253W probably damaging Het
Arhgap24 G T 5: 102,875,759 (GRCm38) V220F probably damaging Het
Arhgap24 G A 5: 102,880,807 (GRCm38) A283T probably benign Het
Arhgap25 G T 6: 87,476,186 (GRCm38) L211M probably damaging Het
Arhgap31 G C 16: 38,623,893 (GRCm38) Q201E possibly damaging Het
Arhgap40 C A 2: 158,534,885 (GRCm38) P317T probably benign Het
Arhgap45 C G 10: 80,029,052 (GRCm38) R950G probably damaging Het
Arhgap45 C A 10: 80,025,536 (GRCm38) T511N probably damaging Het
Arhgap5 G A 12: 52,518,463 (GRCm38) R739H possibly damaging Het
Arhgap9 C A 10: 127,327,689 (GRCm38) T452N probably damaging Het
Arhgef11 C T 3: 87,735,462 (GRCm38) P1434L not run Het
Arhgef12 T A 9: 42,971,072 (GRCm38) Q1492L probably benign Het
Arhgef18 G T 8: 3,453,224 (GRCm38) V877L probably damaging Het
Arhgef4 G T 1: 34,723,729 (GRCm38) D689Y unknown Het
Arhgef4 G T 1: 34,804,926 (GRCm38) G1358C probably damaging Het
Arid1a C A 4: 133,720,550 (GRCm38) Q217H probably null Het
Arid4a A C 12: 71,039,920 (GRCm38) K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,319,355 (GRCm38) probably null Het
Arl10 C G 13: 54,580,724 (GRCm38) L188V probably benign Het
Arl14 C A 3: 69,222,648 (GRCm38) P43T probably damaging Het
Arl4c T C 1: 88,701,450 (GRCm38) Q72R possibly damaging Het
Arl6ip5 C A 6: 97,229,555 (GRCm38) N65K probably benign Het
Armc2 C A 10: 41,927,044 (GRCm38) Q544H probably damaging Het
Armc2 C G 10: 41,963,656 (GRCm38) G438R probably damaging Het
Armc4 G C 18: 7,129,487 (GRCm38) A897G probably damaging Het
Armc4 C A 18: 7,216,973 (GRCm38) E680* probably null Het
Armcx4 C A X: 134,693,042 (GRCm38) A1233D not run Het
Armcx4 G A X: 134,694,091 (GRCm38) E1583K possibly damaging Het
Arnt2 G A 7: 84,263,196 (GRCm38) P579S probably benign Het
Arpc3 C T 5: 122,404,230 (GRCm38) P120L probably damaging Het
Arrdc5 C G 17: 56,300,189 (GRCm38) A19P probably damaging Het
Arsi C A 18: 60,916,780 (GRCm38) P245H probably damaging Het
Art2b T A 7: 101,578,882 (GRCm38) Q283L not run Het
Arx G T X: 93,289,184 (GRCm38) A280S probably damaging Het
Asap3 C A 4: 136,241,503 (GRCm38) P753Q probably damaging Het
Asap3 TGGG TGG 4: 136,240,201 (GRCm38) probably benign Het
Asb15 G T 6: 24,566,331 (GRCm38) D428Y probably damaging Het
Ascc1 G T 10: 60,007,793 (GRCm38) R59L possibly damaging Het
Ascc2 G T 11: 4,646,653 (GRCm38) R58L probably benign Het
Ascc2 G C 11: 4,672,487 (GRCm38) G518R probably benign Het
Ash1l G A 3: 89,043,217 (GRCm38) R2139Q probably damaging Het
Asic2 A T 11: 80,889,832 (GRCm38) L417Q possibly damaging Het
Asic2 T G 11: 81,967,670 (GRCm38) K172T probably benign Het
Aspg C G 12: 112,113,081 (GRCm38) Q98E possibly damaging Het
Asphd1 A T 7: 126,948,636 (GRCm38) L165Q probably damaging Het
Astl C T 2: 127,356,545 (GRCm38) A360V probably benign Het
Asxl3 G T 18: 22,522,220 (GRCm38) G1096C probably damaging Het
Atad5 A C 11: 80,094,896 (GRCm38) S270R probably damaging Het
Ate1 C A 7: 130,504,714 (GRCm38) D306Y probably benign Het
Atg7 G T 6: 114,673,050 (GRCm38) V63F possibly damaging Het
Atg9a A T 1: 75,186,559 (GRCm38) L299Q probably damaging Het
Atl1 C G 12: 69,937,075 (GRCm38) L192V possibly damaging Het
Atl3 T G 19: 7,510,037 (GRCm38) F106V probably damaging Het
Atp10a G T 7: 58,788,447 (GRCm38) probably null Het
Atp12a G C 14: 56,372,706 (GRCm38) G221A probably damaging Het
Atp13a2 A T 4: 141,005,117 (GRCm38) S898C probably benign Het
Atp13a4 C A 16: 29,422,587 (GRCm38) Q754H probably null Het
Atp1a2 A T 1: 172,279,754 (GRCm38) I733N possibly damaging Het
Atp1a3 C A 7: 24,998,688 (GRCm38) A198S probably benign Het
Atp1a4 C G 1: 172,231,954 (GRCm38) R857P probably benign Het
Atp1b2 G T 11: 69,601,315 (GRCm38) A269D possibly damaging Het
Atp2a3 G T 11: 72,980,622 (GRCm38) G650C possibly damaging Het
Atp2a3 C A 11: 72,989,540 (GRCm38) H1016N probably benign Het
Atp2b3 G A X: 73,535,424 (GRCm38) E343K possibly damaging Het
Atp6v0a4 G A 6: 38,049,036 (GRCm38) S819F possibly damaging Het
Atp6v1e1 T C 6: 120,804,119 (GRCm38) E97G probably benign Het
Atp6v1e1 T A 6: 120,822,449 (GRCm38) probably benign Het
Atp6v1h G C 1: 5,095,628 (GRCm38) R107P probably damaging Het
Atp7b G T 8: 22,028,714 (GRCm38) P36H probably benign Het
Atp8b4 C A 2: 126,414,429 (GRCm38) E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 (GRCm38) R650W probably benign Het
Atp9b T A 18: 80,765,865 (GRCm38) Q613L Het
Atpaf2 C A 11: 60,416,775 (GRCm38) A46S probably benign Het
Atrn G T 2: 130,946,193 (GRCm38) G305V probably benign Het
Atxn2 A T 5: 121,777,990 (GRCm38) S420C probably damaging Het
Atxn7l1 G T 12: 33,367,645 (GRCm38) A602S probably benign Het
Atxn7l1 G C 12: 33,368,017 (GRCm38) A726P probably benign Het
Atxn7l2 A C 3: 108,205,666 (GRCm38) S309A probably benign Het
AU022751 T G X: 6,082,321 (GRCm38) E213D unknown Het
AU022751 G T X: 6,082,314 (GRCm38) P216T unknown Het
Aup1 G T 6: 83,056,633 (GRCm38) R306L probably benign Het
Aurkaip1 G T 4: 155,832,763 (GRCm38) R156L probably damaging Het
Aurkc TGG TG 7: 6,995,514 (GRCm38) probably null Het
Avl9 G C 6: 56,736,764 (GRCm38) D336H probably damaging Het
Avpr1b C A 1: 131,609,573 (GRCm38) S365Y probably damaging Het
Axdnd1 A T 1: 156,349,063 (GRCm38) L714Q probably damaging Het
Azin2 C A 4: 128,934,659 (GRCm38) D347Y possibly damaging Het
B3gnt5 A T 16: 19,769,810 (GRCm38) R260* probably null Het
B3gnt6 C G 7: 98,193,889 (GRCm38) R288P probably benign Het
Bag6 G T 17: 35,139,310 (GRCm38) probably null Het
Bahcc1 G T 11: 120,276,609 (GRCm38) G1279W possibly damaging Het
Bahcc1 G T 11: 120,284,394 (GRCm38) V1765L probably benign Het
Bahd1 G A 2: 118,922,403 (GRCm38) R717H probably damaging Het
Baiap3 C A 17: 25,244,768 (GRCm38) R934S probably benign Het
Bbs10 G T 10: 111,299,657 (GRCm38) L210F probably benign Het
Bbs10 G T 10: 111,301,124 (GRCm38) R699S probably damaging Het
Bbs10 G C 10: 111,298,908 (GRCm38) probably null Het
BC005561 T C 5: 104,520,192 (GRCm38) V860A possibly damaging Het
BC024063 G T 10: 82,109,050 (GRCm38) G168V probably damaging Het
BC080695 T C 4: 143,572,252 (GRCm38) I255T probably benign Het
Bcan C A 3: 87,990,750 (GRCm38) G635W probably damaging Het
Bcan T G 3: 87,990,755 (GRCm38) N633T probably damaging Het
Bcan C T 3: 87,995,650 (GRCm38) D274N probably benign Het
Bckdha T C 7: 25,631,143 (GRCm38) S343G probably damaging Het
Bcl10 T G 3: 145,930,513 (GRCm38) I55M probably damaging Het
Bcl11a G T 11: 24,165,010 (GRCm38) K784N probably damaging Het
Bcl6 C G 16: 23,969,958 (GRCm38) Q553H probably damaging Het
Bcorl1 T G X: 48,367,842 (GRCm38) L84R unknown Het
Bcorl1 GAAAA GAAA X: 48,375,090 (GRCm38) probably null Het
Bend6 C A 1: 33,864,523 (GRCm38) Q173H probably null Het
Best3 T G 10: 117,024,622 (GRCm38) L596V probably benign Het
Bmp4 A C 14: 46,384,628 (GRCm38) V153G possibly damaging Het
Bmpr1b C A 3: 141,842,954 (GRCm38) E438D probably benign Het
Bmpr2 G A 1: 59,847,167 (GRCm38) R321Q not run Het
Bnc1 T G 7: 81,974,542 (GRCm38) E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,694,045 (GRCm38) probably benign Het
Borcs5 A T 6: 134,710,123 (GRCm38) Q147L probably benign Het
Borcs8 C G 8: 70,141,971 (GRCm38) H49D probably damaging Het
Bpi G T 2: 158,272,102 (GRCm38) G307W possibly damaging Het
Bpifa3 A T 2: 154,130,471 (GRCm38) probably benign Het
Bpifb4 A C 2: 153,942,832 (GRCm38) E153D probably benign Het
Bpifc C A 10: 85,965,228 (GRCm38) A419S probably benign Het
Bptf C A 11: 107,058,684 (GRCm38) G2270W probably damaging Het
Braf C A 6: 39,643,182 (GRCm38) W487C probably damaging Het
Brap A G 5: 121,675,377 (GRCm38) T298A possibly damaging Het
Brd2 C A 17: 34,113,688 (GRCm38) G573W possibly damaging Het
Brd9 G C 13: 73,944,751 (GRCm38) A287P probably damaging Het
Brdt G T 5: 107,359,898 (GRCm38) S664I possibly damaging Het
Brinp1 C A 4: 68,798,751 (GRCm38) E287* probably null Het
Brinp2 A T 1: 158,247,171 (GRCm38) L460* probably null Het
Brinp2 C G 1: 158,247,039 (GRCm38) G504A probably damaging Het
Brinp3 C T 1: 146,902,076 (GRCm38) P754S probably damaging Het
Btg4 G A 9: 51,119,175 (GRCm38) D192N probably benign Het
Btla G T 16: 45,239,358 (GRCm38) V142L probably damaging Het
Bub1 C A 2: 127,829,565 (GRCm38) W33L probably damaging Het
C130026I21Rik G T 1: 85,113,523 (GRCm38) D71E probably damaging Het
C1qb C G 4: 136,882,145 (GRCm38) G55R probably damaging Het
C1ql2 C G 1: 120,341,624 (GRCm38) H169Q possibly damaging Het
C2cd4a C G 9: 67,831,413 (GRCm38) G116A probably damaging Het
C2cd4c G A 10: 79,612,465 (GRCm38) P283S possibly damaging Het
C4b A T 17: 34,731,147 (GRCm38) L1383Q probably damaging Het
C530008M17Rik C A 5: 76,857,246 (GRCm38) P485T unknown Het
C77080 G T 4: 129,223,704 (GRCm38) S434Y probably damaging Het
C87977 A G 4: 144,207,461 (GRCm38) F359L probably benign Het
C8a C A 4: 104,862,686 (GRCm38) G76C probably damaging Het
Cabp7 T G 11: 4,746,669 (GRCm38) N20T probably benign Het
Cacna1a G T 8: 84,415,676 (GRCm38) R11L unknown Het
Cacna1b A T 2: 24,626,884 (GRCm38) L54* probably null Het
Cacna1c T G 6: 118,697,737 (GRCm38) K547T Het
Cacna1d C T 14: 30,111,116 (GRCm38) A923T probably benign Het
Cacna1d A G 14: 30,179,188 (GRCm38) F325S probably benign Het
Cacna1e T A 1: 154,635,850 (GRCm38) T176S probably damaging Het
Cacna1g A T 11: 94,438,111 (GRCm38) L1020M probably benign Het
Cacna1h G C 17: 25,391,250 (GRCm38) P761A probably benign Het
Cacna1s G T 1: 136,107,084 (GRCm38) E1322* probably null Het
Cacna2d2 G C 9: 107,517,293 (GRCm38) A585P probably damaging Het
Cacna2d2 C A 9: 107,526,102 (GRCm38) L921M probably benign Het
Cacna2d4 G T 6: 119,312,450 (GRCm38) R815M probably benign Het
Cacnb1 C A 11: 98,022,555 (GRCm38) probably benign Het
Cacnb4 C A 2: 52,675,812 (GRCm38) probably null Het
Cacng5 C G 11: 107,884,346 (GRCm38) G66R probably null Het
Cacng5 G T 11: 107,877,546 (GRCm38) P212T probably damaging Het
Cadps2 A C 6: 23,321,801 (GRCm38) L1031V probably benign Het
Calcoco2 C A 11: 96,103,520 (GRCm38) W69L probably damaging Het
Calr C A 8: 84,844,064 (GRCm38) probably null Het
Camk1g C A 1: 193,362,100 (GRCm38) G2V probably damaging Het
Camk2b G C 11: 5,977,940 (GRCm38) S447C possibly damaging Het
Camk2g C A 14: 20,764,912 (GRCm38) W215C probably damaging Het
Camsap1 G C 2: 25,940,881 (GRCm38) P461A probably benign Het
Camsap1 C T 2: 25,936,639 (GRCm38) A1260T probably damaging Het
Camta1 G T 4: 151,144,385 (GRCm38) H663Q probably benign Het
Cand1 A C 10: 119,239,194 (GRCm38) I16S probably benign Het
Capg G T 6: 72,555,476 (GRCm38) probably null Het
Capn1 C G 19: 6,014,278 (GRCm38) V64L probably benign Het
Capn13 G T 17: 73,341,110 (GRCm38) S298R probably benign Het
Capn6 C G X: 143,810,907 (GRCm38) G79R probably damaging Het
Car5b G T X: 164,000,310 (GRCm38) A90D probably benign Het
Car7 G T 8: 104,548,959 (GRCm38) C180F possibly damaging Het
Card9 T A 2: 26,357,796 (GRCm38) E181V probably damaging Het
Carnmt1 C G 19: 18,679,213 (GRCm38) A170G possibly damaging Het
Carnmt1 G C 19: 18,704,090 (GRCm38) C391S probably benign Het
Cartpt C A 13: 99,899,983 (GRCm38) E86* probably null Het
Casc1 C A 6: 145,205,293 (GRCm38) E18* probably null Het
Cask C T X: 13,533,489 (GRCm38) V785I probably benign Het
Caskin1 C A 17: 24,505,038 (GRCm38) N933K probably damaging Het
Caskin2 C G 11: 115,802,103 (GRCm38) A619P probably damaging Het
Caskin2 A G 11: 115,802,096 (GRCm38) L621P probably damaging Het
Caskin2 C A 11: 115,803,620 (GRCm38) G385V probably benign Het
Casq1 G T 1: 172,215,914 (GRCm38) S191* probably null Het
Casz1 T C 4: 148,944,359 (GRCm38) L1087P probably benign Het
Catip A C 1: 74,367,789 (GRCm38) H240P probably damaging Het
Catsper2 C A 2: 121,407,385 (GRCm38) W171C probably damaging Het
Cav2 G T 6: 17,281,433 (GRCm38) V25F probably benign Het
Cavin2 G T 1: 51,301,156 (GRCm38) G331C probably damaging Het
Cbfa2t3 G C 8: 122,698,895 (GRCm38) probably benign Het
Cbx8 G A 11: 119,039,119 (GRCm38) A216V possibly damaging Het
Ccdc113 G T 8: 95,538,219 (GRCm38) R119L probably damaging Het
Ccdc121 C T 1: 181,510,875 (GRCm38) E171K possibly damaging Het
Ccdc14 G T 16: 34,706,498 (GRCm38) G306C probably damaging Het
Ccdc144b T C 3: 36,018,888 (GRCm38) Q415R possibly damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,420,813 (GRCm38) probably null Het
Ccdc151 C A 9: 21,990,424 (GRCm38) V547F possibly damaging Het
Ccdc155 C G 7: 45,184,254 (GRCm38) probably null Het
Ccdc158 T C 5: 92,608,491 (GRCm38) M1086V probably damaging Het
Ccdc162 C T 10: 41,605,108 (GRCm38) D1318N possibly damaging Het
Ccdc162 G A 10: 41,654,997 (GRCm38) T571I possibly damaging Het
Ccdc162 T G 10: 41,690,092 (GRCm38) K85T probably benign Het
Ccdc162 C T 10: 41,553,131 (GRCm38) R645H probably benign Het
Ccdc171 G A 4: 83,795,230 (GRCm38) A1169T probably damaging Het
Ccdc175 C A 12: 72,112,308 (GRCm38) R619L possibly damaging Het
Ccdc180 A C 4: 45,920,910 (GRCm38) K952T probably damaging Het
Ccdc180 A C 4: 45,916,406 (GRCm38) K869T probably damaging Het
Ccdc187 G T 2: 26,281,507 (GRCm38) Q320K probably benign Het
Ccdc28b C A 4: 129,621,104 (GRCm38) G71C probably damaging Het
Ccdc33 G A 9: 58,117,416 (GRCm38) P176S probably benign Het
Ccdc40 G A 11: 119,252,008 (GRCm38) R864H probably damaging Het
Ccdc51 G C 9: 109,092,226 (GRCm38) A394P probably damaging Het
Ccdc51 G T 9: 109,092,148 (GRCm38) E368* probably null Het
Ccdc57 C G 11: 120,860,488 (GRCm38) A919P possibly damaging Het
Ccdc57 C A 11: 120,861,138 (GRCm38) Q872H probably null Het
Ccdc7a G T 8: 129,026,663 (GRCm38) R196S probably benign Het
Ccdc80 T C 16: 45,116,344 (GRCm38) F711L probably damaging Het
Ccdc80 G A 16: 45,096,207 (GRCm38) S442N probably benign Het
Ccdc80 G T 16: 45,095,786 (GRCm38) G302* probably null Het
Ccdc87 G A 19: 4,841,923 (GRCm38) W814* probably null Het
Ccdc88b C A 19: 6,849,740 (GRCm38) A1020S possibly damaging Het
Ccdc88c T C 12: 100,945,770 (GRCm38) K602E possibly damaging Het
Ccdc94 T C 17: 55,960,732 (GRCm38) F15S probably damaging Het
Ccdc96 C G 5: 36,485,594 (GRCm38) R315G probably benign Het
Ccin A T 4: 43,985,018 (GRCm38) Q475L probably damaging Het
Ccnb1ip1 C A 14: 50,792,104 (GRCm38) R167L probably benign Het
Ccnb3 T C X: 7,009,375 (GRCm38) T322A possibly damaging Het
Ccr10 CG C 11: 101,174,340 (GRCm38) probably null Het
Ccr10 C G 11: 101,174,323 (GRCm38) G127A probably damaging Het
Ccr7 G T 11: 99,144,980 (GRCm38) T372N probably damaging Het
Cct6b C A 11: 82,764,065 (GRCm38) probably benign Het
Cct6b C T 11: 82,723,939 (GRCm38) V408I probably damaging Het
Cd163l1 A T 7: 140,224,857 (GRCm38) H591L probably benign Het
Cd164 G T 10: 41,519,565 (GRCm38) A11S probably damaging Het
Cd177 G T 7: 24,746,171 (GRCm38) Q616K probably benign Het
Cd180 C T 13: 102,705,766 (GRCm38) P440L probably damaging Het
Cd200r1 A T 16: 44,792,759 (GRCm38) I243F probably damaging Het
Cd209e C T 8: 3,849,196 (GRCm38) G172E probably benign Het
Cd22 G T 7: 30,869,530 (GRCm38) P693H probably damaging Het
Cd22 T G 7: 30,867,963 (GRCm38) K732T probably benign Het
Cd3d A G 9: 44,985,628 (GRCm38) D100G probably damaging Het
Cd59a C A 2: 104,104,198 (GRCm38) Q4K probably benign Het
Cd69 G T 6: 129,268,342 (GRCm38) C173* probably null Het
Cdc123 T G 2: 5,804,985 (GRCm38) Q205P probably damaging Het
Cdc14b C G 13: 64,274,669 (GRCm38) V28L possibly damaging Het
Cdc42bpa A G 1: 180,065,093 (GRCm38) E274G probably damaging Het
Cdc42ep2 A G 19: 5,918,492 (GRCm38) F62L probably benign Het
Cdc42ep5 A T 7: 4,151,726 (GRCm38) L21H probably damaging Het
Cdh15 G C 8: 122,864,259 (GRCm38) D416H probably damaging Het
Cdh16 G C 8: 104,615,185 (GRCm38) P783A probably damaging Het
Cdh19 C G 1: 110,932,214 (GRCm38) G179A probably damaging Het
Cdh19 T G 1: 110,893,306 (GRCm38) Q567H probably benign Het
Cdh19 A T 1: 110,895,387 (GRCm38) N522K probably damaging Het
Cdh22 G T 2: 165,116,184 (GRCm38) P621H probably damaging Het
Cdh23 T A 10: 60,310,770 (GRCm38) N2877Y probably damaging Het
Cdh23 T C 10: 60,428,321 (GRCm38) N683D probably benign Het
Cdh7 G T 1: 110,108,736 (GRCm38) G549C probably damaging Het
Cdh8 C A 8: 99,190,205 (GRCm38) R426M probably null Het
Cdh8 G A 8: 99,171,323 (GRCm38) P453S probably benign Het
Cdhr3 C A 12: 33,080,324 (GRCm38) G171W probably benign Het
Cdhr3 G T 12: 33,060,322 (GRCm38) P321H probably damaging Het
Cdk12 G T 11: 98,203,941 (GRCm38) G192* probably null Het
Cdk14 G T 5: 5,135,322 (GRCm38) Y212* probably null Het
Cdk5r2 C G 1: 74,855,350 (GRCm38) P85A probably damaging Het
Cdk5rap2 C T 4: 70,266,743 (GRCm38) G1157R probably damaging Het
Cdk6 T A 5: 3,390,694 (GRCm38) C83S possibly damaging Het
Cdsn T A 17: 35,556,071 (GRCm38) L499Q probably damaging Het
Cdsn T G 17: 35,555,825 (GRCm38) V417G possibly damaging Het
Cdyl C T 13: 35,815,966 (GRCm38) R77W probably damaging Het
Ceacam15 G T 7: 16,675,583 (GRCm38) P9H possibly damaging Het
Cela2a G T 4: 141,821,391 (GRCm38) P145T probably damaging Het
Celsr1 A C 15: 85,963,100 (GRCm38) F1479V probably damaging Het
Celsr2 C A 3: 108,393,131 (GRCm38) R2871L probably benign Het
Celsr2 G T 3: 108,412,341 (GRCm38) H1052N probably benign Het
Cenpf G A 1: 189,659,472 (GRCm38) T704I probably damaging Het
Cenpv A C 11: 62,527,525 (GRCm38) F201V probably damaging Het
Cep112 G A 11: 108,425,310 (GRCm38) G36D probably damaging Het
Cep152 C A 2: 125,583,971 (GRCm38) G825C probably benign Het
Cep170b G T 12: 112,741,012 (GRCm38) probably null Het
Cep192 A T 18: 67,881,288 (GRCm38) K2451M probably damaging Het
Cep290 AGG AG 10: 100,549,374 (GRCm38) probably benign Het
Cep295 G T 9: 15,357,697 (GRCm38) P16Q probably damaging Het
Cep295nl T G 11: 118,333,873 (GRCm38) Q48H probably damaging Het
Cep295nl T C 11: 118,333,019 (GRCm38) E333G possibly damaging Het
Cep44 C G 8: 56,544,128 (GRCm38) G125A possibly damaging Het
Cep97 C A 16: 55,927,735 (GRCm38) G111C probably damaging Het
Cerkl C A 2: 79,368,765 (GRCm38) Q160H probably benign Het
Cers1 C G 8: 70,318,318 (GRCm38) P126R probably benign Het
Ces1a C A 8: 93,036,085 (GRCm38) R186L probably benign Het
Ces1g G T 8: 93,325,811 (GRCm38) H283Q probably benign Het
Ces2a A T 8: 104,734,850 (GRCm38) E77V probably damaging Het
Ces2a C A 8: 104,734,006 (GRCm38) probably benign Het
Ces3a A C 8: 105,053,602 (GRCm38) K327T possibly damaging Het
Ces4a A G 8: 105,131,977 (GRCm38) K9R probably benign Het
Cetn2 T G X: 72,914,889 (GRCm38) K127T probably damaging Het
Cfap100 G C 6: 90,406,150 (GRCm38) A347G unknown Het
Cfap20 C T 8: 95,434,525 (GRCm38) S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 (GRCm38) P251R possibly damaging Het
Cfap221 G T 1: 119,995,141 (GRCm38) L24I probably benign Het
Cfap45 G T 1: 172,545,284 (GRCm38) E515D probably benign Het
Cfap46 A C 7: 139,639,548 (GRCm38) L1334V Het
Cfap65 G A 1: 74,910,747 (GRCm38) R1200C probably damaging Het
Cfap74 C G 4: 155,426,118 (GRCm38) R387G Het
Cflar C G 1: 58,731,229 (GRCm38) C160W Het
Cflar G T 1: 58,740,313 (GRCm38) probably null Het
Cgn G T 3: 94,776,178 (GRCm38) A389D probably benign Het
Cgn T C 3: 94,774,346 (GRCm38) R480G probably damaging Het
Cgn A T 3: 94,774,273 (GRCm38) V504E possibly damaging Het
Chd1 G T 17: 15,766,347 (GRCm38) V1482L probably damaging Het
Chd1 G T 17: 15,768,733 (GRCm38) G1583C probably damaging Het
Chd4 G T 6: 125,100,860 (GRCm38) R95L possibly damaging Het
Chd4 G T 6: 125,101,598 (GRCm38) A228S probably benign Het
Chd5 G A 4: 152,378,479 (GRCm38) R1363K probably damaging Het
Chd7 C G 4: 8,844,313 (GRCm38) A1502G probably damaging Het
Cherp C T 8: 72,470,953 (GRCm38) G101D Het
Chfr C G 5: 110,144,895 (GRCm38) S176* probably null Het
Chil1 C G 1: 134,189,230 (GRCm38) R319G probably damaging Het
Chil1 G T 1: 134,182,779 (GRCm38) probably null Het
Chml C A 1: 175,687,762 (GRCm38) G198C possibly damaging Het
Chmp3 A C 6: 71,560,964 (GRCm38) E58D probably benign Het
Chmp3 G C 6: 71,579,775 (GRCm38) A220P probably damaging Het
Chpf C G 1: 75,475,458 (GRCm38) A613P probably benign Het
Chpf G C 1: 75,475,470 (GRCm38) L609V probably damaging Het
Chrna2 C A 14: 66,149,304 (GRCm38) L300M probably damaging Het
Chrna5 G T 9: 55,004,482 (GRCm38) G189C probably damaging Het
Chrna7 A T 7: 63,212,184 (GRCm38) L40Q probably damaging Het
Chst3 T A 10: 60,185,676 (GRCm38) R450W possibly damaging Het
Chst4 A C 8: 110,030,092 (GRCm38) F380V probably damaging Het
Chsy1 C G 7: 66,172,226 (GRCm38) S736R probably damaging Het
Cic A C 7: 25,271,019 (GRCm38) E58D possibly damaging Het
Cidea A G 18: 67,358,853 (GRCm38) K61R probably null Het
Ciita C A 16: 10,508,700 (GRCm38) P252T probably damaging Het
Cilp TGGG TGG 9: 65,280,130 (GRCm38) probably null Het
Cipc G T 12: 86,960,337 (GRCm38) G103C probably damaging Het
Cit G C 5: 115,986,603 (GRCm38) G1526R probably damaging Het
Cited4 C A 4: 120,666,814 (GRCm38) H4Q probably damaging Het
Ckap2 G A 8: 22,169,794 (GRCm38) P557L probably damaging Het
Ckap2l C A 2: 129,285,362 (GRCm38) D299Y probably damaging Het
Clca1 G T 3: 145,013,921 (GRCm38) S429R probably damaging Het
Clcn1 T C 6: 42,307,567 (GRCm38) V613A probably damaging Het
Cldn11 T A 3: 31,150,306 (GRCm38) W53R probably damaging Het
Cldn18 T A 9: 99,698,847 (GRCm38) K116M possibly damaging Het
Cldn23 A T 8: 35,826,277 (GRCm38) L19Q probably damaging Het
Cldn34b1 T G X: 154,887,708 (GRCm38) K5T probably benign Het
Clec4d T G 6: 123,274,686 (GRCm38) F176V probably benign Het
Clic1 G T 17: 35,052,459 (GRCm38) G22W probably damaging Het
Clic6 G A 16: 92,498,895 (GRCm38) D148N probably benign Het
Clip3 A C 7: 30,298,838 (GRCm38) E236D probably benign Het
Clk1 C A 1: 58,417,372 (GRCm38) R186L probably benign Het
Clstn3 C T 6: 124,459,200 (GRCm38) V234M probably damaging Het
Cltc A G 11: 86,702,632 (GRCm38) V1525A probably benign Het
Cmklr1 T A 5: 113,613,891 (GRCm38) S350C probably damaging Het
Cmya5 C G 13: 93,063,579 (GRCm38) A3414P probably benign Het
Cmya5 C G 13: 93,096,790 (GRCm38) D597H unknown Het
Cnksr1 A T 4: 134,232,135 (GRCm38) L396Q probably damaging Het
Cnksr3 C T 10: 7,134,544 (GRCm38) R308Q probably damaging Het
Cnnm4 G T 1: 36,505,751 (GRCm38) R697L possibly damaging Het
Cnot1 C G 8: 95,748,277 (GRCm38) Q1103H possibly damaging Het
Cnot8 C G 11: 58,113,090 (GRCm38) A117G probably benign Het
Cnppd1 C A 1: 75,140,951 (GRCm38) G42V probably damaging Het
Cntn2 C A 1: 132,527,788 (GRCm38) R237L probably damaging Het
Cntn3 T G 6: 102,437,931 (GRCm38) probably null Het
Cntn4 T G 6: 106,509,464 (GRCm38) N284K probably benign Het
Cntn4 T G 6: 106,523,563 (GRCm38) F334V probably benign Het
Cntnap1 C A 11: 101,182,898 (GRCm38) T625K probably damaging Het
Cntnap2 A C 6: 47,271,148 (GRCm38) K1163Q probably benign Het
Cntnap3 AC A 13: 64,740,872 (GRCm38) probably null Het
Cntnap3 T G 13: 64,792,388 (GRCm38) N332H probably damaging Het
Cntnap4 A T 8: 112,858,189 (GRCm38) K1086M possibly damaging Het
Cntnap5a T A 1: 116,428,516 (GRCm38) V759E probably damaging Het
Cntnap5b C G 1: 100,446,840 (GRCm38) Q734E probably benign Het
Cntnap5b C A 1: 100,164,228 (GRCm38) S231R possibly damaging Het
Cntnap5b C A 1: 99,967,270 (GRCm38) T89K probably damaging Het
Cobl G T 11: 12,253,433 (GRCm38) Q1090K probably benign Het
Cobl G A 11: 12,375,827 (GRCm38) A223V probably damaging Het
Cobl C A 11: 12,369,645 (GRCm38) E244D probably damaging Het
Cog1 C A 11: 113,651,982 (GRCm38) H151Q probably damaging Het
Coil C A 11: 88,981,976 (GRCm38) P388T probably damaging Het
Col10a1 C A 10: 34,395,178 (GRCm38) P382H probably damaging Het
Col11a2 G T 17: 34,056,402 (GRCm38) G420C unknown Het
Col16a1 G C 4: 130,072,878 (GRCm38) G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,649,429 (GRCm38) probably benign Het
Col18a1 G C 10: 77,055,709 (GRCm38) A1097G possibly damaging Het
Col18a1 C A 10: 77,112,851 (GRCm38) A276S unknown Het
Col1a2 A C 6: 4,532,750 (GRCm38) T792P unknown Het
Col23a1 G T 11: 51,549,708 (GRCm38) D142Y unknown Het
Col24a1 G A 3: 145,342,498 (GRCm38) G619S probably damaging Het
Col25a1 AC A 3: 130,182,795 (GRCm38) probably null Het
Col27a1 C G 4: 63,225,788 (GRCm38) S571C probably damaging Het
Col5a1 G A 2: 28,002,517 (GRCm38) R1014H unknown Het
Col5a2 C A 1: 45,383,680 (GRCm38) G1126C probably damaging Het
Col5a2 C A 1: 45,376,146 (GRCm38) V1478L possibly damaging Het
Col5a2 C G 1: 45,396,484 (GRCm38) G697A probably benign Het
Col6a4 G C 9: 106,000,870 (GRCm38) C1969W probably damaging Het
Col6a4 T C 9: 106,000,797 (GRCm38) S1994G probably benign Het
Col6a6 G C 9: 105,780,952 (GRCm38) A687G probably damaging Het
Col9a1 C A 1: 24,214,588 (GRCm38) P464H probably damaging Het
Col9a2 C G 4: 121,053,797 (GRCm38) A543G probably damaging Het
Colec11 C A 12: 28,595,284 (GRCm38) Q129H probably damaging Het
Commd10 G T 18: 46,990,566 (GRCm38) G163* probably null Het
Commd2 C A 3: 57,646,857 (GRCm38) R141L probably damaging Het
Copb2 A C 9: 98,586,146 (GRCm38) K737T probably benign Het
Coq3 C A 4: 21,899,102 (GRCm38) P145H probably damaging Het
Coq4 G T 2: 29,795,449 (GRCm38) Q158H probably null Het
Coq6 G C 12: 84,370,963 (GRCm38) A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,467,865 (GRCm38) probably null Het
Cox6a1 C T 5: 115,345,908 (GRCm38) G92S probably damaging Het
Cox6b2 C A 7: 4,752,147 (GRCm38) V43L probably benign Het
Cpeb1 C A 7: 81,359,728 (GRCm38) probably null Het
Cpeb2 G T 5: 43,234,717 (GRCm38) G419C Het
Cpne1 C A 2: 156,077,644 (GRCm38) D302Y probably damaging Het
Cpq A C 15: 33,381,391 (GRCm38) D300A probably damaging Het
Cps1 CTT CT 1: 67,148,719 (GRCm38) probably null Het
Cps1 G T 1: 67,123,268 (GRCm38) G35V possibly damaging Het
Cpsf4 A T 5: 145,167,415 (GRCm38) E20V possibly damaging Het
Cr2 G T 1: 195,154,153 (GRCm38) Q901K probably benign Het
Crb1 CG C 1: 139,237,086 (GRCm38) probably null Het
Crb2 C T 2: 37,776,371 (GRCm38) P11S probably benign Het
Crebl2 G T 6: 134,849,289 (GRCm38) E68* probably null Het
Crem T A 18: 3,267,730 (GRCm38) E258V probably damaging Het
Crispld1 C A 1: 17,728,613 (GRCm38) probably benign Het
Crispld1 G T 1: 17,752,851 (GRCm38) A381S possibly damaging Het
Crtac1 T G 19: 42,287,926 (GRCm38) E521A probably benign Het
Cry1 C A 10: 85,144,197 (GRCm38) V416L probably benign Het
Crybg2 C A 4: 134,082,660 (GRCm38) P1241H probably damaging Het
Cryz A T 3: 154,621,769 (GRCm38) T277S probably benign Het
Csmd1 T C 8: 15,998,814 (GRCm38) D2296G probably damaging Het
Csmd1 T A 8: 16,037,198 (GRCm38) T1946S probably damaging Het
Cspg5 G T 9: 110,251,050 (GRCm38) A429S probably damaging Het
Ctbp2 C A 7: 133,015,290 (GRCm38) probably benign Het
Ctf2 T A 7: 127,719,456 (GRCm38) I124F possibly damaging Het
Ctps G C 4: 120,542,743 (GRCm38) D472E probably benign Het
Ctsf C A 19: 4,856,306 (GRCm38) Q155K probably benign Het
Ctsj C T 13: 61,004,115 (GRCm38) E43K probably damaging Het
Ctsq C A 13: 61,037,123 (GRCm38) V250L probably benign Het
Cttnbp2 C A 6: 18,501,960 (GRCm38) E60* probably null Het
Cttnbp2 C A 6: 18,408,709 (GRCm38) S971I probably benign Het
Cttnbp2 C A 6: 18,408,725 (GRCm38) G966C possibly damaging Het
Cttnbp2 G T 6: 18,420,836 (GRCm38) A892E possibly damaging Het
Cubn T A 2: 13,381,825 (GRCm38) E1543V probably damaging Het
Cul9 C A 17: 46,520,585 (GRCm38) G1568* probably null Het
Cul9 C A 17: 46,520,576 (GRCm38) G1571* probably null Het
Cutal G T 2: 34,882,425 (GRCm38) R67I probably damaging Het
Cux2 C A 5: 121,873,813 (GRCm38) G520* probably null Het
Cux2 G T 5: 121,885,934 (GRCm38) T92K probably benign Het
Cxcr1 A T 1: 74,192,392 (GRCm38) L157* probably null Het
Cyb561d2 G C 9: 107,540,296 (GRCm38) C85W probably damaging Het
Cybb G A X: 9,440,001 (GRCm38) H494Y probably damaging Het
Cybb T C X: 9,438,240 (GRCm38) I564V probably damaging Het
Cyfip2 G A 11: 46,222,615 (GRCm38) S968F not run Het
Cylc1 G A X: 111,123,146 (GRCm38) V399I unknown Het
Cyp11b1 T A 15: 74,839,355 (GRCm38) K158I probably damaging Het
Cyp19a1 T A 9: 54,176,599 (GRCm38) K169* probably null Het
Cyp1a1 C A 9: 57,700,594 (GRCm38) S168R probably benign Het
Cyp26b1 T C 6: 84,577,114 (GRCm38) S174G probably benign Het
Cyp2a4 C T 7: 26,310,841 (GRCm38) P264S probably damaging Het
Cyp2a4 G T 7: 26,307,323 (GRCm38) G36* probably null Het
Cyp2a5 A C 7: 26,835,497 (GRCm38) N45T probably damaging Het
Cyp2a5 G A 7: 26,836,774 (GRCm38) R148H probably damaging Het
Cyp2c29 G A 19: 39,324,997 (GRCm38) M351I probably benign Het
Cyp2c54 G A 19: 40,046,215 (GRCm38) P337L probably damaging Het
Cyp2c55 C T 19: 39,035,513 (GRCm38) R344C probably benign Het
Cyp2j11 T G 4: 96,307,303 (GRCm38) E385D probably damaging Het
Cyp2j11 G T 4: 96,307,436 (GRCm38) S341Y probably damaging Het
Cyp2j5 G T 4: 96,629,506 (GRCm38) P490T probably damaging Het
Cyp2j6 C A 4: 96,536,068 (GRCm38) G151* probably null Het
Cyp39a1 A C 17: 43,725,577 (GRCm38) I333L probably benign Het
Cyp39a1 A C 17: 43,731,048 (GRCm38) E382A probably damaging Het
Cyp3a44 T C 5: 145,791,664 (GRCm38) K250R probably benign Het
Cyp4a10 G T 4: 115,518,326 (GRCm38) S2I probably damaging Het
Cyp4a12a G T 4: 115,329,003 (GRCm38) probably null Het
Cyp4a14 G C 4: 115,490,017 (GRCm38) A408G probably benign Het
Cyp4a30b G T 4: 115,470,959 (GRCm38) R475L possibly damaging Het
Cypt14 T C X: 39,863,555 (GRCm38) K10R possibly damaging Het
Cypt15 A C X: 39,346,384 (GRCm38) K33T possibly damaging Het
Cypt2 G T X: 105,499,799 (GRCm38) R3L probably benign Het
Cyth2 C A 7: 45,813,105 (GRCm38) R24L possibly damaging Het
Cytip C A 2: 58,134,037 (GRCm38) S257I probably damaging Het
Cytl1 G T 5: 37,735,695 (GRCm38) A50S probably benign Het
D430041D05Rik C A 2: 104,154,935 (GRCm38) L1262F probably damaging Het
D430041D05Rik C A 2: 104,256,856 (GRCm38) A592S probably benign Het
D5Ertd579e C G 5: 36,615,762 (GRCm38) E430Q probably benign Het
D930020B18Rik C A 10: 121,667,616 (GRCm38) A232D probably benign Het
Dab1 G C 4: 104,728,078 (GRCm38) V472L probably benign Het
Dab2ip G T 2: 35,708,868 (GRCm38) D191Y probably damaging Het
Dapk1 AC A 13: 60,760,804 (GRCm38) probably null Het
Dars C A 1: 128,372,207 (GRCm38) E347* probably null Het
Daw1 C A 1: 83,183,300 (GRCm38) T121K probably damaging Het
Daw1 A C 1: 83,209,255 (GRCm38) K262T probably damaging Het
Daw1 C G 1: 83,180,391 (GRCm38) L54V probably damaging Het
Dbh T A 2: 27,177,727 (GRCm38) L454Q probably damaging Het
Dcaf12l1 G A X: 44,789,897 (GRCm38) T8M probably benign Het
Dcaf8 G T 1: 172,172,929 (GRCm38) R218L probably benign Het
Dcdc2c G T 12: 28,524,707 (GRCm38) P139T probably benign Het
Dcxr GA G 11: 120,727,208 (GRCm38) probably null Het
Ddhd2 C T 8: 25,735,829 (GRCm38) M500I possibly damaging Het
Ddo C A 10: 40,647,933 (GRCm38) H306Q probably damaging Het
Ddr2 T G 1: 169,998,084 (GRCm38) T316P probably benign Het
Ddr2 G T 1: 169,998,083 (GRCm38) T316N probably benign Het
Ddr2 T C 1: 169,984,955 (GRCm38) Y656C probably damaging Het
Ddx51 G T 5: 110,654,558 (GRCm38) E176* probably null Het
Deaf1 C T 7: 141,301,474 (GRCm38) W573* probably null Het
Dedd2 C A 7: 25,203,598 (GRCm38) R312L probably damaging Het
Def8 G T 8: 123,459,966 (GRCm38) E428D possibly damaging Het
Defa21 T G 8: 21,025,723 (GRCm38) F46V probably benign Het
Defa27 C A 8: 21,315,597 (GRCm38) Q18K probably damaging Het
Defa27 A G 8: 21,315,598 (GRCm38) Q18R probably damaging Het
Defb14 G T 8: 19,195,120 (GRCm38) G38C probably damaging Het
Defb21 C A 2: 152,573,833 (GRCm38) P22H unknown Het
Defb26 C T 2: 152,508,301 (GRCm38) probably null Het
Dennd4b T G 3: 90,279,495 (GRCm38) L1425R probably damaging Het
Depdc5 A T 5: 32,943,282 (GRCm38) M846L possibly damaging Het
Dffb G T 4: 153,972,843 (GRCm38) L126M probably damaging Het
Dgat2l6 C A X: 100,524,950 (GRCm38) Q10K probably benign Het
Dgcr14 C T 16: 17,902,310 (GRCm38) G393S possibly damaging Het
Dgcr8 C T 16: 18,278,318 (GRCm38) probably null Het
Dgkb C A 12: 38,136,613 (GRCm38) L254M probably damaging Het
Dgkb A G 12: 37,981,996 (GRCm38) Q19R possibly damaging Het
Dgkd A C 1: 87,927,810 (GRCm38) S725R probably benign Het
Dgkg C A 16: 22,588,398 (GRCm38) A146S probably benign Het
Dglucy A C 12: 100,853,304 (GRCm38) K425T probably benign Het
Dhx30 C A 9: 110,086,965 (GRCm38) G722C probably damaging Het
Dhx34 G A 7: 16,218,644 (GRCm38) R19* probably null Het
Dhx57 T G 17: 80,245,805 (GRCm38) K1231T probably damaging Het
Diaph3 C A 14: 86,656,432 (GRCm38) C1136F probably benign Het
Dicer1 C G 12: 104,731,020 (GRCm38) A93P probably null Het
Dip2a T A 10: 76,266,323 (GRCm38) S1446C possibly damaging Het
Dip2a T G 10: 76,280,820 (GRCm38) T890P probably damaging Het
Disp3 G T 4: 148,250,957 (GRCm38) P908T probably damaging Het
Dlc1 C A 8: 36,584,211 (GRCm38) G338C probably damaging Het
Dlec1 C A 9: 119,138,786 (GRCm38) P1218T probably benign Het
Dlg4 G A 11: 70,041,920 (GRCm38) G512E probably benign Het
Dlgap1 C T 17: 70,815,209 (GRCm38) P878S probably damaging Het
Dll4 G T 2: 119,326,052 (GRCm38) probably benign Het
Dmbt1 T G 7: 131,088,812 (GRCm38) I925S unknown Het
Dmd A T X: 83,878,484 (GRCm38) L1453F possibly damaging Het
Dmd A G X: 83,627,286 (GRCm38) K225R probably damaging Het
Dmkn G T 7: 30,776,497 (GRCm38) W25L possibly damaging Het
Dmrt1 C T 19: 25,559,970 (GRCm38) T307I possibly damaging Het
Dmrt2 T C 19: 25,678,000 (GRCm38) L321P probably damaging Het
Dmrtb1 T A 4: 107,680,830 (GRCm38) D47V probably damaging Het
Dnaaf1 A C 8: 119,575,441 (GRCm38) D27A possibly damaging Het
Dnaaf2 G C 12: 69,197,850 (GRCm38) H146D probably damaging Het
Dnah10 G T 5: 124,775,355 (GRCm38) A1883S probably benign Het
Dnah11 A C 12: 118,127,119 (GRCm38) I1030S probably benign Het
Dnah11 A T 12: 118,130,799 (GRCm38) L845M probably damaging Het
Dnah11 C T 12: 117,931,177 (GRCm38) R3645H possibly damaging Het
Dnah14 G C 1: 181,757,351 (GRCm38) E3216Q possibly damaging Het
Dnah17 G T 11: 118,127,166 (GRCm38) L168M probably benign Het
Dnah2 G A 11: 69,421,821 (GRCm38) A4306V possibly damaging Het
Dnah2 G T 11: 69,451,120 (GRCm38) Q2986K probably benign Het
Dnah2 C G 11: 69,516,523 (GRCm38) G478A probably damaging Het
Dnah2 G C 11: 69,487,054 (GRCm38) N1317K possibly damaging Het
Dnah2 T G 11: 69,516,481 (GRCm38) Y492S probably damaging Het
Dnah2 G A 11: 69,498,667 (GRCm38) H800Y probably benign Het
Dnah3 A G 7: 119,967,803 (GRCm38) V13A Het
Dnah6 G T 6: 73,133,559 (GRCm38) T1681K probably benign Het
Dnah6 T A 6: 73,087,783 (GRCm38) E2605D possibly damaging Het
Dnah7a A C 1: 53,419,699 (GRCm38) L3760R probably damaging Het
Dnah7a T G 1: 53,483,463 (GRCm38) K2872T probably damaging Het
Dnah7c A T 1: 46,646,992 (GRCm38) probably null Het
Dnah7c T A 1: 46,467,302 (GRCm38) L180M probably benign Het
Dnah7c T C 1: 46,760,316 (GRCm38) F3379L possibly damaging Het
Dnah7c G C 1: 46,639,665 (GRCm38) V1790L probably benign Het
Dnah7c G T 1: 46,615,281 (GRCm38) G107V probably damaging Het
Dnah8 A G 17: 30,648,540 (GRCm38) K322R probably benign Het
Dnah9 T A 11: 66,037,474 (GRCm38) Q2123L probably damaging Het
Dnah9 T A 11: 65,895,972 (GRCm38) I3612F probably damaging Het
Dnah9 A T 11: 65,970,084 (GRCm38) L2820Q probably damaging Het
Dnah9 C A 11: 66,072,835 (GRCm38) G1764V probably damaging Het
Dnah9 G T 11: 65,927,853 (GRCm38) L3220M probably damaging Het
Dnaic1 G T 4: 41,614,323 (GRCm38) R333L probably benign Het
Dnajb6 G A 5: 29,752,445 (GRCm38) G75D possibly damaging Het
Dnajb8 A T 6: 88,222,910 (GRCm38) M143L possibly damaging Het
Dnajc1 C T 2: 18,293,987 (GRCm38) A259T possibly damaging Het
Dnajc11 G A 4: 151,933,783 (GRCm38) D11N probably benign Het
Dnajc28 G A 16: 91,617,033 (GRCm38) H108Y probably benign Het
Dner C A 1: 84,383,980 (GRCm38) R636L possibly damaging Het
Dnhd1 A T 7: 105,668,547 (GRCm38) K483M probably damaging Het
Dnhd1 A T 7: 105,703,036 (GRCm38) probably null Het
Dnhd1 G T 7: 105,678,299 (GRCm38) K50N probably benign Het
Dnhd1 GT GTT 7: 105,703,580 (GRCm38) probably null Het
Dnmbp T A 19: 43,889,367 (GRCm38) T422S probably benign Het
Dnmbp T A 19: 43,866,688 (GRCm38) K265N probably damaging Het
Dnmt1 C A 9: 20,926,554 (GRCm38) V381L probably benign Het
Dnmt1 T G 9: 20,915,863 (GRCm38) K979T probably damaging Het
Dnmt3a G T 12: 3,904,201 (GRCm38) W791L probably damaging Het
Doc2b A T 11: 75,777,072 (GRCm38) L284Q probably benign Het
Dock10 A C 1: 80,560,954 (GRCm38) L959V probably benign Het
Dock11 G T X: 35,984,848 (GRCm38) A699S possibly damaging Het
Dock2 A C 11: 34,718,924 (GRCm38) F230V probably benign Het
Dock4 A T 12: 40,631,614 (GRCm38) Y104F probably benign Het
Dock4 G C 12: 40,631,616 (GRCm38) V105L probably benign Het
Dock7 C A 4: 98,945,225 (GRCm38) G1945V unknown Het
Dock9 C A 14: 121,651,782 (GRCm38) G308C probably benign Het
Dopey2 G T 16: 93,803,546 (GRCm38) S2037I probably damaging Het
Dopey2 G A 16: 93,807,868 (GRCm38) G2132E possibly damaging Het
Dopey2 T A 16: 93,769,581 (GRCm38) S1083R probably benign Het
Dpagt1 G T 9: 44,329,125 (GRCm38) V213L probably benign Het
Dpp10 C A 1: 123,353,440 (GRCm38) E627* probably null Het
Dpp3 T G 19: 4,922,341 (GRCm38) Q185P probably damaging Het
Dpp6 C A 5: 27,398,998 (GRCm38) A142E probably damaging Het
Dpysl5 G T 5: 30,778,120 (GRCm38) R189L probably benign Het
Drd2 G T 9: 49,395,655 (GRCm38) E14* probably null Het
Dsc1 C A 18: 20,114,538 (GRCm38) A7S probably benign Het
Dsc2 A T 18: 20,035,299 (GRCm38) L701Q probably damaging Het
Dsg1c G T 18: 20,283,573 (GRCm38) G844C probably damaging Het
Dsg2 C A 18: 20,580,621 (GRCm38) F216L probably damaging Het
Dsp C G 13: 38,197,190 (GRCm38) T2637R possibly damaging Het
Dst G C 1: 34,244,445 (GRCm38) E3330D probably benign Het
Dst A G 1: 34,275,208 (GRCm38) K4397E probably damaging Het
Dst G T 1: 34,188,467 (GRCm38) E1714* probably null Het
Dst C G 1: 34,165,143 (GRCm38) A806G probably benign Het
Dtx1 T C 5: 120,683,295 (GRCm38) S396G probably benign Het
Dtx3l G C 16: 35,933,183 (GRCm38) S351C probably damaging Het
Dtx3l C G 16: 35,932,457 (GRCm38) C593S probably damaging Het
Dtx4 C G 19: 12,491,909 (GRCm38) A285P probably benign Het
Duox1 G T 2: 122,333,038 (GRCm38) G784W probably damaging Het
Duox2 T C 2: 122,296,507 (GRCm38) T176A probably damaging Het
Dusp8 C G 7: 142,090,077 (GRCm38) R33P probably damaging Het
Dusp8 C A 7: 142,081,943 (GRCm38) G637W unknown Het
Dvl1 G T 4: 155,855,611 (GRCm38) G400V probably benign Het
Dvl3 G C 16: 20,530,881 (GRCm38) A535P probably damaging Het
Dydc2 C A 14: 41,061,983 (GRCm38) R61L probably benign Het
Dync1i2 G T 2: 71,247,884 (GRCm38) V306L probably benign Het
Dync2h1 G T 9: 7,142,361 (GRCm38) P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 (GRCm38) probably null Het
Dyrk1a A T 16: 94,691,762 (GRCm38) H618L probably benign Het
Dyrk4 T G 6: 126,892,128 (GRCm38) K240N probably damaging Het
Dysf T A 6: 84,072,685 (GRCm38) L372H probably damaging Het
Dzip1l G T 9: 99,641,761 (GRCm38) G205V possibly damaging Het
E030025P04Rik C A 11: 109,143,971 (GRCm38) Q30H unknown Het
E130114P18Rik G T 4: 97,569,200 (GRCm38) P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 (GRCm38) C615F probably damaging Het
E230025N22Rik T A 18: 36,695,824 (GRCm38) probably benign Het
E2f6 A C 12: 16,820,273 (GRCm38) K142T possibly damaging Het
E4f1 G A 17: 24,446,145 (GRCm38) S355L probably benign Het
Ears2 C G 7: 122,055,710 (GRCm38) A112P possibly damaging Het
Ears2 C G 7: 122,044,581 (GRCm38) G385R probably damaging Het
Ebna1bp2 A C 4: 118,621,146 (GRCm38) K44T probably damaging Het
Ece1 T G 4: 137,921,027 (GRCm38) F32V probably benign Het
Ecm1 T C 3: 95,734,876 (GRCm38) I466V probably benign Het
Edil3 G C 13: 88,944,870 (GRCm38) G40R probably benign Het
Eef2 G T 10: 81,181,158 (GRCm38) probably null Het
Efcab3 C A 11: 105,100,046 (GRCm38) A93D probably damaging Het
Efcab3 T G 11: 105,108,772 (GRCm38) Y162* probably null Het
Efcab5 C G 11: 77,132,139 (GRCm38) D583H probably damaging Het
Efcc1 G T 6: 87,732,796 (GRCm38) E257D probably benign Het
Efs C A 14: 54,920,336 (GRCm38) V173L probably benign Het
Egf C A 3: 129,697,717 (GRCm38) probably null Het
Ehbp1 G C 11: 22,095,590 (GRCm38) P720A probably benign Het
Ehbp1l1 T A 19: 5,717,889 (GRCm38) M1129L probably benign Het
Ehd3 C A 17: 73,805,285 (GRCm38) P15T probably benign Het
Ehf C A 2: 103,279,518 (GRCm38) G115C probably null Het
Eif2a G T 3: 58,548,884 (GRCm38) V435L probably benign Het
Eif2d A T 1: 131,164,465 (GRCm38) K324N probably damaging Het
Eif2d C G 1: 131,164,502 (GRCm38) P337A probably damaging Het
Eif3i C A 4: 129,600,575 (GRCm38) probably benign Het
Eif4e2 G A 1: 87,225,939 (GRCm38) M155I probably benign Het
Eif4g1 G T 16: 20,673,408 (GRCm38) probably benign Het
Eipr1 G T 12: 28,859,287 (GRCm38) Q184H probably benign Het
Ell A C 8: 70,578,927 (GRCm38) S92R probably damaging Het
Ell2 A T 13: 75,770,689 (GRCm38) N605Y probably damaging Het
Ell2 A C 13: 75,756,452 (GRCm38) K220T probably damaging Het
Elmod1 T G 9: 53,946,860 (GRCm38) K2T probably benign Het
Elmsan1 G T 12: 84,173,501 (GRCm38) H226Q probably damaging Het
Elmsan1 T A 12: 84,173,499 (GRCm38) Q227L probably damaging Het
Elovl5 G C 9: 77,976,755 (GRCm38) R111P possibly damaging Het
Eme1 A C 11: 94,650,696 (GRCm38) I100S possibly damaging Het
Eml4 G C 17: 83,445,965 (GRCm38) R355T probably damaging Het
Enam C A 5: 88,492,971 (GRCm38) P164H probably damaging Het
Eng C G 2: 32,671,422 (GRCm38) I148M possibly damaging Het
Eng G T 2: 32,673,424 (GRCm38) G331C probably null Het
Eng G C 2: 32,681,452 (GRCm38) R618P probably damaging Het
Enpp3 T G 10: 24,787,793 (GRCm38) T557P probably benign Het
Entpd1 G T 19: 40,738,964 (GRCm38) A519S probably benign Het
Entpd7 G C 19: 43,725,358 (GRCm38) L385F probably benign Het
Ep400 A C 5: 110,756,635 (GRCm38) L33V unknown Het
Epas1 C T 17: 86,827,946 (GRCm38) S669L possibly damaging Het
Epb41l2 G T 10: 25,441,720 (GRCm38) G45V probably benign Het
Epb41l2 A T 10: 25,499,902 (GRCm38) R80* probably null Het
Epc2 G T 2: 49,535,300 (GRCm38) G396C probably damaging Het
Epha10 G C 4: 124,885,775 (GRCm38) G138A probably damaging Het
Epha10 T C 4: 124,883,942 (GRCm38) W50R probably damaging Het
Epha3 G T 16: 63,585,012 (GRCm38) P695Q probably damaging Het
Epha4 T G 1: 77,383,011 (GRCm38) K735T probably damaging Het
Epha4 T C 1: 77,373,733 (GRCm38) *987W probably null Het
Epha5 C T 5: 84,071,120 (GRCm38) D765N possibly damaging Het
Epha8 C A 4: 136,938,696 (GRCm38) R383L probably benign Het
Ephb1 G A 9: 102,223,398 (GRCm38) P38L probably damaging Het
Ephb3 G T 16: 21,218,036 (GRCm38) G337V possibly damaging Het
Ephx3 T G 17: 32,185,237 (GRCm38) N343T probably damaging Het
Epop C A 11: 97,628,410 (GRCm38) R291L probably damaging Het
Eral1 T G 11: 78,075,620 (GRCm38) K244T probably damaging Het
Erap1 T A 13: 74,657,638 (GRCm38) L166H probably damaging Het
Erbb4 CA CAA 1: 68,298,402 (GRCm38) probably null Het
Erbb4 G T 1: 68,328,259 (GRCm38) S433* probably null Het
Ercc2 A C 7: 19,385,668 (GRCm38) S136R probably benign Het
Ercc6 A T 14: 32,526,487 (GRCm38) S332C probably benign Het
Ereg G T 5: 91,090,120 (GRCm38) G155V possibly damaging Het
Erg T G 16: 95,409,750 (GRCm38) Q81P possibly damaging Het
Erg T G 16: 95,361,317 (GRCm38) Q317P probably damaging Het
Erh C A 12: 80,642,804 (GRCm38) L15F probably benign Het
Erich2 C A 2: 70,509,114 (GRCm38) D4E possibly damaging Het
Erich3 T G 3: 154,698,701 (GRCm38) I65S Het
Erich3 G T 3: 154,762,430 (GRCm38) V840L Het
Ero1l G A 14: 45,299,890 (GRCm38) P193L probably damaging Het
Esp18 C T 17: 39,408,166 (GRCm38) L19F probably damaging Het
Esrp1 C T 4: 11,384,396 (GRCm38) G96R probably damaging Het
Esrp1 A T 4: 11,385,765 (GRCm38) L34Q possibly damaging Het
Etv4 C T 11: 101,770,590 (GRCm38) V412M probably damaging Het
Exoc3l G T 8: 105,290,794 (GRCm38) S546Y possibly damaging Het
Exoc3l2 C A 7: 19,480,061 (GRCm38) L471M probably null Het
Exoc3l4 G T 12: 111,423,720 (GRCm38) W243L probably damaging Het
Exoc8 C T 8: 124,896,666 (GRCm38) V321I possibly damaging Het
Eya1 G C 1: 14,252,430 (GRCm38) A270G probably benign Het
Eya1 G T 1: 14,302,868 (GRCm38) P9Q probably damaging Het
F5 C G 1: 164,184,516 (GRCm38) F434L probably damaging Het
F830045P16Rik G T 2: 129,536,530 (GRCm38) probably benign Het
Fabp1 A T 6: 71,199,955 (GRCm38) Q10L possibly damaging Het
Fads1 T A 19: 10,193,704 (GRCm38) L299M probably damaging Het
Fads3 A T 19: 10,041,807 (GRCm38) I26F probably benign Het
Faf1 A G 4: 109,840,356 (GRCm38) D293G probably damaging Het
Fam109a G C 5: 121,852,907 (GRCm38) A111P probably damaging Het
Fam124a T C 14: 62,606,408 (GRCm38) M455T probably benign Het
Fam124b A C 1: 80,213,403 (GRCm38) F88V possibly damaging Het
Fam149a C A 8: 45,342,458 (GRCm38) R672L possibly damaging Het
Fam160a1 G T 3: 85,673,201 (GRCm38) L566I probably benign Het
Fam160b2 G T 14: 70,586,204 (GRCm38) S575R not run Het
Fam161b G T 12: 84,356,053 (GRCm38) Q268K probably benign Het
Fam166b G T 4: 43,427,171 (GRCm38) S87Y Het
Fam166b A G 4: 43,427,172 (GRCm38) S87P Het
Fam170a C A 18: 50,281,584 (GRCm38) A99D possibly damaging Het
Fam170b A C 14: 32,835,804 (GRCm38) N199H probably damaging Het
Fam171a2 C G 11: 102,447,446 (GRCm38) A24P unknown Het
Fam196a G T 7: 134,918,706 (GRCm38) L32I probably damaging Het
Fam208a G A 14: 27,429,208 (GRCm38) G47D probably damaging Het
Fam208a T G 14: 27,477,148 (GRCm38) L1341R probably damaging Het
Fam208b C A 13: 3,588,429 (GRCm38) R434M probably damaging Het
Fam208b C A 13: 3,576,636 (GRCm38) V1105L probably benign Het
Fam213b A C 4: 154,898,989 (GRCm38) L6R probably damaging Het
Fam240a T G 9: 110,916,509 (GRCm38) K29T probably damaging Het
Fam3b C A 16: 97,481,844 (GRCm38) R77L probably damaging Het
Fam46b G T 4: 133,486,682 (GRCm38) R288L probably damaging Het
Fam47e G T 5: 92,579,668 (GRCm38) R145L possibly damaging Het
Fam71a C T 1: 191,163,745 (GRCm38) V234I probably benign Het
Fam83g C A 11: 61,707,470 (GRCm38) P728T probably benign Het
Fance T G 17: 28,318,064 (GRCm38) L14R probably damaging Het
Fancm A C 12: 65,094,926 (GRCm38) E440D probably benign Het
Fap C A 2: 62,528,774 (GRCm38) S428I possibly damaging Het
Farp2 G C 1: 93,580,461 (GRCm38) G627A probably benign Het
Farp2 G T 1: 93,580,467 (GRCm38) G629V probably benign Het
Farp2 T C 1: 93,580,136 (GRCm38) F519L probably benign Het
Fat1 A C 8: 45,023,596 (GRCm38) H1893P possibly damaging Het
Fat1 G A 8: 44,950,598 (GRCm38) D129N probably benign Het
Fat1 G T 8: 45,036,838 (GRCm38) D3596Y probably damaging Het
Fat2 A G 11: 55,282,795 (GRCm38) L2364P probably damaging Het
Fat2 T G 11: 55,303,700 (GRCm38) K1171T probably damaging Het
Fat2 T G 11: 55,310,121 (GRCm38) H709P probably damaging Het
Fat2 G T 11: 55,284,991 (GRCm38) A1632E probably damaging Het
Fat3 G T 9: 15,947,526 (GRCm38) P3798Q probably damaging Het
Fat3 T G 9: 16,375,617 (GRCm38) H870P probably benign Het
Fat3 G T 9: 16,375,429 (GRCm38) P933T probably damaging Het
Fat4 G T 3: 38,983,359 (GRCm38) G3720V probably benign Het
Fat4 C G 3: 38,983,815 (GRCm38) P3872R probably damaging Het
Fblim1 C T 4: 141,595,371 (GRCm38) A34T possibly damaging Het
Fbn1 C T 2: 125,387,350 (GRCm38) G504S possibly damaging Het
Fbxl16 G C 17: 25,817,011 (GRCm38) G194A possibly damaging Het
Fbxl18 T G 5: 142,886,424 (GRCm38) K352T possibly damaging Het
Fbxl19 CT C 7: 127,761,275 (GRCm38) probably null Het
Fbxl21 C A 13: 56,527,003 (GRCm38) L56I probably benign Het
Fbxl22 G T 9: 66,511,888 (GRCm38) R156S probably benign Het
Fbxl4 T C 4: 22,427,280 (GRCm38) L507P probably damaging Het
Fbxo17 G C 7: 28,732,777 (GRCm38) G93A unknown Het
Fbxo24 T G 5: 137,621,403 (GRCm38) K187T probably damaging Het
Fbxo28 T A 1: 182,317,870 (GRCm38) I218F probably damaging Het
Fbxo30 A T 10: 11,295,320 (GRCm38) E714V probably damaging Het
Fbxo32 C A 15: 58,205,242 (GRCm38) D115Y probably damaging Het
Fbxo40 T A 16: 36,969,599 (GRCm38) D383V probably damaging Het
Fbxo42 T G 4: 141,180,534 (GRCm38) probably null Het
Fbxw19 T C 9: 109,481,582 (GRCm38) K424R probably benign Het
Fbxw21 T C 9: 109,145,537 (GRCm38) H305R probably benign Het
Fbxw25 C A 9: 109,651,738 (GRCm38) W291C Het
Fdx1l C A 9: 21,073,492 (GRCm38) M5I probably benign Het
Fer1l5 C A 1: 36,390,563 (GRCm38) Y465* probably null Het
Fermt1 G T 2: 132,936,018 (GRCm38) P177Q probably benign Het
Fermt1 G T 2: 132,941,943 (GRCm38) Q49K probably benign Het
Fermt1 C G 2: 132,906,756 (GRCm38) G649A probably damaging Het
Ffar3 A T 7: 30,855,193 (GRCm38) F234Y probably damaging Het
Fgd3 C A 13: 49,281,826 (GRCm38) D319Y probably damaging Het
Fgd5 A C 6: 91,988,889 (GRCm38) K701T probably damaging Het
Fgr C A 4: 133,000,170 (GRCm38) H461N probably benign Het
Fibcd1 G A 2: 31,838,539 (GRCm38) T102I probably benign Het
Flg A C 3: 93,279,962 (GRCm38) R240S probably benign Het
Flii C A 11: 60,722,313 (GRCm38) G221C possibly damaging Het
Flnb T G 14: 7,942,066 (GRCm38) I2348S probably benign Het
Flot1 A C 17: 35,825,823 (GRCm38) K219T probably damaging Het
Flrt2 G T 12: 95,778,912 (GRCm38) W8L possibly damaging Het
Flrt2 G T 12: 95,779,559 (GRCm38) G224C probably damaging Het
Flywch1 A C 17: 23,761,009 (GRCm38) W264G probably benign Het
Fmn2 G T 1: 174,608,394 (GRCm38) V644L unknown Het
Fmo2 G T 1: 162,887,598 (GRCm38) Q152K probably benign Het
Fmo2 C A 1: 162,898,274 (GRCm38) G11V probably damaging Het
Fmo6 G C 1: 162,926,132 (GRCm38) S147* probably null Het
Fmod T G 1: 134,040,919 (GRCm38) Y232* probably null Het
Fn1 C G 1: 71,597,411 (GRCm38) G2194A probably benign Het
Fndc1 C A 17: 7,773,593 (GRCm38) G424* probably null Het
Fndc1 T G 17: 7,804,877 (GRCm38) K82T possibly damaging Het
Fndc3a C A 14: 72,567,373 (GRCm38) K489N probably damaging Het
Fndc3c1 G T X: 106,434,329 (GRCm38) P767T not run Het
Foxd1 G C 13: 98,355,938 (GRCm38) G440A unknown Het
Foxd3 C A 4: 99,657,066 (GRCm38) P148T probably damaging Het
Foxf1 G T 8: 121,084,529 (GRCm38) R44L probably damaging Het
Foxi1 G T 11: 34,207,488 (GRCm38) P179H probably damaging Het
Foxi3 G A 6: 70,956,798 (GRCm38) A90T probably benign Het
Foxj2 A T 6: 122,832,936 (GRCm38) probably null Het
Foxj2 G T 6: 122,833,711 (GRCm38) A217S probably benign Het
Foxo3 T TG 10: 42,275,265 (GRCm38) probably null Het
Fpgs C T 2: 32,692,660 (GRCm38) R67H probably benign Het
Fpr3 C A 17: 17,970,993 (GRCm38) H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,113,393 (GRCm38) W278C probably benign Het
Fras1 T C 5: 96,758,142 (GRCm38) L3135P probably benign Het
Frem1 C A 4: 82,999,983 (GRCm38) G574V probably damaging Het
Frem3 C A 8: 80,611,503 (GRCm38) R142S probably damaging Het
Frem3 T C 8: 80,615,431 (GRCm38) L1451P probably benign Het
Frg1 T A 8: 41,399,638 (GRCm38) R186* probably null Het
Frmd4a A G 2: 4,498,021 (GRCm38) D107G probably damaging Het
Frmpd3 G T X: 140,433,010 (GRCm38) E1575* probably null Het
Fryl T C 5: 73,072,837 (GRCm38) D1659G probably benign Het
Fscb T G 12: 64,472,930 (GRCm38) E587D unknown Het
Fsd2 T C 7: 81,553,192 (GRCm38) E213G probably damaging Het
Fshr C G 17: 89,046,667 (GRCm38) A88P probably benign Het
Fsip1 G T 2: 118,136,483 (GRCm38) L454I possibly damaging Het
Fsip2 G T 2: 82,989,665 (GRCm38) M5247I probably benign Het
Fstl3 G C 10: 79,781,198 (GRCm38) V192L probably benign Het
Fstl5 A T 3: 76,707,982 (GRCm38) K783N probably damaging Het
Fubp1 G A 3: 152,222,087 (GRCm38) G391D probably damaging Het
Fxn C G 19: 24,262,042 (GRCm38) R162P probably damaging Het
Fyb2 G C 4: 104,913,660 (GRCm38) Q57H probably damaging Het
Gabpb2 G T 3: 95,190,693 (GRCm38) T223N probably benign Het
Gabra3 C T X: 72,445,353 (GRCm38) S322N probably damaging Het
Gabra4 G T 5: 71,623,895 (GRCm38) A391D probably benign Het
Gabrp T C 11: 33,552,673 (GRCm38) E397G probably benign Het
Gabrr3 C A 16: 59,407,482 (GRCm38) S34* probably null Het
Gadd45a C A 6: 67,036,736 (GRCm38) G109V probably benign Het
Gal3st2b T G 1: 93,938,685 (GRCm38) L36R probably damaging Het
Galm C G 17: 80,183,233 (GRCm38) T273S possibly damaging Het
Galnt9 CG C 5: 110,596,146 (GRCm38) probably null Het
Galntl5 C A 5: 25,203,189 (GRCm38) P220T probably damaging Het
Galntl6 A C 8: 57,857,558 (GRCm38) Y370D probably damaging Het
Garem1 G A 18: 21,148,325 (GRCm38) H325Y probably damaging Het
Garem1 T G 18: 21,129,792 (GRCm38) K655T probably damaging Het
Gatad2a T A 8: 69,936,038 (GRCm38) probably null Het
Gba A T 3: 89,204,005 (GRCm38) K26* probably null Het
Gbp3 G A 3: 142,561,863 (GRCm38) V34M probably damaging Het
Gck C A 11: 5,906,526 (GRCm38) M210I probably damaging Het
Gckr G T 5: 31,300,831 (GRCm38) R172I probably damaging Het
Gdap1l1 G T 2: 163,447,670 (GRCm38) R185L probably damaging Het
Gdf10 C T 14: 33,932,532 (GRCm38) T332M possibly damaging Het
Gdf15 T C 8: 70,629,890 (GRCm38) S189G probably benign Het
Gdf7 C T 12: 8,298,409 (GRCm38) R304H unknown Het
Gdf7 G T 12: 8,298,578 (GRCm38) P240T unknown Het
Gdf9 C A 11: 53,437,525 (GRCm38) T436K probably damaging Het
Gemin4 G T 11: 76,217,579 (GRCm38) probably benign Het
Gga3 T G 11: 115,587,603 (GRCm38) Q454H probably benign Het
Ggt5 A G 10: 75,602,618 (GRCm38) probably null Het
Ggt7 T A 2: 155,491,078 (GRCm38) R622W probably damaging Het
Ggt7 T A 2: 155,499,063 (GRCm38) N394I probably damaging Het
Gh G C 11: 106,301,184 (GRCm38) R67G probably damaging Het
Ghdc A G 11: 100,769,417 (GRCm38) L168P probably benign Het
Ghr A G 15: 3,347,485 (GRCm38) Y85H probably benign Het
Gimap1 T G 6: 48,743,356 (GRCm38) *301E probably null Het
Gimap1 A C 6: 48,743,249 (GRCm38) K265T probably damaging Het
Gimap7 C A 6: 48,724,153 (GRCm38) D224E probably benign Het
Gins3 G T 8: 95,633,520 (GRCm38) probably benign Het
Gjc1 C A 11: 102,800,008 (GRCm38) G390W unknown Het
Glcci1 A T 6: 8,582,674 (GRCm38) Q345L possibly damaging Het
Glipr1 G T 10: 111,988,837 (GRCm38) P155T probably benign Het
Glis3 G C 19: 28,283,768 (GRCm38) P791R possibly damaging Het
Glra3 G T 8: 56,062,500 (GRCm38) M203I probably benign Het
Gls C G 1: 52,214,488 (GRCm38) D274H probably damaging Het
Gm10300 C G 4: 132,074,809 (GRCm38) P38R unknown Het
Gm10324 T A 13: 66,122,673 (GRCm38) F551Y probably benign Het
Gm10324 G A 13: 66,122,469 (GRCm38) R483K probably benign Het
Gm10324 A G 13: 66,122,394 (GRCm38) K458R probably damaging Het
Gm10340 A G 14: 3,134,911 (GRCm38) R60G possibly damaging Het
Gm10803 G C 2: 93,564,136 (GRCm38) Q84H unknown Het
Gm11565 C T 11: 99,914,851 (GRCm38) S23F possibly damaging Het
Gm11567 G A 11: 99,879,332 (GRCm38) S32N unknown Het
Gm11567 C A 11: 99,879,625 (GRCm38) Q130K unknown Het
Gm11567 C A 11: 99,879,421 (GRCm38) Q62K unknown Het
Gm11639 G C 11: 105,001,967 (GRCm38) G4247R probably benign Het
Gm11983 T C 11: 6,837,047 (GRCm38) K27E unknown Het
Gm11983 T G 11: 6,836,861 (GRCm38) K89Q unknown Het
Gm12185 T G 11: 48,908,086 (GRCm38) I527L probably benign Het
Gm12888 G T 4: 121,324,808 (GRCm38) P29H probably damaging Het
Gm13089 G C 4: 143,696,945 (GRCm38) H425D probably benign Het
Gm13103 A G 4: 143,853,110 (GRCm38) S422G probably benign Het
Gm13178 C A 4: 144,703,325 (GRCm38) G365W probably damaging Het
Gm13212 G C 4: 145,622,968 (GRCm38) S325T possibly damaging Het
Gm15130 A G 2: 111,144,587 (GRCm38) probably null Het
Gm16503 A C 4: 147,541,156 (GRCm38) T36P unknown Het
Gm17019 C T 5: 15,032,997 (GRCm38) probably benign Het
Gm17124 A G 14: 42,597,223 (GRCm38) probably null Het
Gm19410 G T 8: 35,792,611 (GRCm38) W800L possibly damaging Het
Gm21083 T G 5: 15,577,458 (GRCm38) V41G probably benign Het
Gm21149 G C 5: 15,476,412 (GRCm38) R18G not run Het
Gm21149 G T 5: 15,472,148 (GRCm38) A236D probably damaging Het
Gm21190 G A 5: 15,524,894 (GRCm38) P242L probably benign Het
Gm21190 A C 5: 15,524,974 (GRCm38) D215E not run Het
Gm21190 G T 5: 15,526,580 (GRCm38) T136N probably benign Het
Gm21680 C T 5: 25,971,419 (GRCm38) S60N probably benign Het
Gm21886 G C 18: 80,089,387 (GRCm38) Y185* probably null Het
Gm21886 G T 18: 80,089,923 (GRCm38) L14M probably damaging Het
Gm28729 C T 9: 96,492,088 (GRCm38) R401H unknown Het
Gm29609 A T 5: 31,154,242 (GRCm38) W852R probably benign Het
Gm29797 G C 2: 181,659,095 (GRCm38) A128P probably damaging Het
Gm30302 A C 13: 49,787,848 (GRCm38) L39V probably damaging Het
Gm30302 T C 13: 49,785,384 (GRCm38) D950G possibly damaging Het
Gm30302 T C 13: 49,786,462 (GRCm38) R591G possibly damaging Het
Gm3238 G T 10: 77,771,024 (GRCm38) P101Q unknown Het
Gm32742 G A 9: 51,159,165 (GRCm38) Q76* probably null Het
Gm3285 G A 10: 77,862,434 (GRCm38) C139Y unknown Het
Gm3543 T G 14: 41,981,007 (GRCm38) N60T probably damaging Het
Gm364 T A X: 57,417,721 (GRCm38) N140K probably benign Het
Gm364 T C X: 57,463,184 (GRCm38) F487L probably benign Het
Gm3776 T A 9: 78,258,763 (GRCm38) C18S probably benign Het
Gm4450 G T 3: 98,456,455 (GRCm38) Q25K probably benign Het
Gm45618 T C 7: 142,120,218 (GRCm38) K171R unknown Het
Gm45861 G A 8: 27,584,869 (GRCm38) G1416S unknown Het
Gm4737 T C 16: 46,154,229 (GRCm38) M262V probably benign Het
Gm4779 G T X: 101,792,186 (GRCm38) P504H unknown Het
Gm4788 G C 1: 139,733,448 (GRCm38) C554W probably damaging Het
Gm4788 G T 1: 139,698,256 (GRCm38) R827S probably benign Het
Gm47985 T C 1: 151,183,141 (GRCm38) S178P possibly damaging Het
Gm4858 G T 3: 93,074,055 (GRCm38) G53W probably damaging Het
Gm49336 C A 14: 60,239,502 (GRCm38) C240F probably null Het
Gm5111 C A 6: 48,590,309 (GRCm38) L153M unknown Het
Gm5538 C A 3: 59,747,194 (GRCm38) Q150K probably benign Het
Gm5592 G A 7: 41,286,319 (GRCm38) E82K possibly damaging Het
Gm5592 C G 7: 41,286,317 (GRCm38) T81R probably damaging Het
Gm5592 C A 7: 41,288,681 (GRCm38) D462E probably benign Het
Gm5862 TGGG TGG 5: 26,018,487 (GRCm38) probably null Het
Gm5936 T G X: 74,842,035 (GRCm38) V347G probably benign Het
Gm6377 T G X: 109,198,293 (GRCm38) L160R probably damaging Het
Gm6588 T C 5: 112,449,875 (GRCm38) V96A probably benign Het
Gm6614 A G 6: 141,990,348 (GRCm38) F357S probably benign Het
Gm6871 C A 7: 41,546,413 (GRCm38) G300V probably damaging Het
Gm7138 C G 10: 77,776,853 (GRCm38) C31S unknown Het
Gm7145 A C 1: 117,986,351 (GRCm38) K321T probably benign Het
Gm7298 A C 6: 121,764,870 (GRCm38) E417A probably benign Het
Gm7298 G T 6: 121,764,875 (GRCm38) D419Y possibly damaging Het
Gm732 A C X: 107,945,825 (GRCm38) I494S possibly damaging Het
Gm7534 A G 4: 134,202,677 (GRCm38) S106P probably benign Het
Gm7534 C G 4: 134,200,338 (GRCm38) R368P possibly damaging Het
Gm7579 G T 7: 142,211,941 (GRCm38) G28V unknown Het
Gm8369 G C 19: 11,511,624 (GRCm38) A92P probably damaging Het
Gm853 T A 4: 130,221,704 (GRCm38) H17L probably benign Het
Gm8693 T C 7: 22,691,842 (GRCm38) K159R probably benign Het
Gm884 C T 11: 103,613,681 (GRCm38) G2487D probably benign Het
Gm8879 C G 5: 11,130,351 (GRCm38) N75K probably benign Het
Gm8994 G C 6: 136,329,023 (GRCm38) A161P possibly damaging Het
Gm9112 G A X: 102,707,027 (GRCm38) T72M probably benign Het
Gm9513 A C 9: 36,476,511 (GRCm38) N31T probably damaging Het
Gm9573 G T 17: 35,621,245 (GRCm38) S683Y unknown Het
Gm960 G T 19: 4,625,903 (GRCm38) R734S unknown Het
Gm973 T G 1: 59,524,602 (GRCm38) probably benign Het
Gm9758 C G 5: 14,913,539 (GRCm38) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9887 C A 12: 69,371,941 (GRCm38) W173L not run Het
Gm9964 T C 11: 79,296,400 (GRCm38) R74G unknown Het
Gm9992 C A 17: 7,376,530 (GRCm38) G127W probably damaging Het
Gmip C T 8: 69,816,292 (GRCm38) R496W probably damaging Het
Gmpr2 T G 14: 55,672,743 (GRCm38) L10R probably benign Het
Gna12 C A 5: 140,762,607 (GRCm38) D185Y probably damaging Het
Gna12 T A 5: 140,760,553 (GRCm38) Q379L probably damaging Het
Gnas C A 2: 174,298,606 (GRCm38) P249T unknown Het
Gnptab G T 10: 88,431,368 (GRCm38) E440D probably damaging Het
Gpa33 C A 1: 166,164,671 (GRCm38) C261* probably null Het
Gpat2 C A 2: 127,430,882 (GRCm38) F171L probably benign Het
Gpat2 G C 2: 127,433,808 (GRCm38) G502A probably damaging Het
Gpat4 C G 8: 23,179,798 (GRCm38) S313T probably benign Het
Gpatch1 C A 7: 35,310,485 (GRCm38) G55C probably damaging Het
Gpc5 T A 14: 115,369,964 (GRCm38) L326Q probably damaging Het
Gpd1l C A 9: 114,904,780 (GRCm38) G283W probably damaging Het
Gpnmb C A 6: 49,051,832 (GRCm38) A428D possibly damaging Het
Gpr101 T G X: 57,501,274 (GRCm38) H172P probably benign Het
Gpr158 G T 2: 21,810,690 (GRCm38) probably null Het
Gpr179 G C 11: 97,336,648 (GRCm38) S1560R probably benign Het
Gpr26 C A 7: 131,967,048 (GRCm38) P41T probably damaging Het
Gpr26 C G 7: 131,967,225 (GRCm38) L100V probably damaging Het
Gpr39 G T 1: 125,872,843 (GRCm38) G444W probably damaging Het
Gprasp2 G T X: 135,842,893 (GRCm38) G334W probably damaging Het
Gprin1 C A 13: 54,740,397 (GRCm38) Q21H probably benign Het
Gpsm1 G T 2: 26,327,345 (GRCm38) Q408H possibly damaging Het
Grb10 C A 11: 11,944,845 (GRCm38) A359S possibly damaging Het
Grb7 G C 11: 98,454,484 (GRCm38) G456R probably damaging Het
Grb7 G T 11: 98,453,971 (GRCm38) probably null Het
Greb1 C A 12: 16,696,756 (GRCm38) C1171F probably benign Het
Greb1l G C 18: 10,515,305 (GRCm38) G699A probably damaging Het
Gria3 C A X: 41,478,647 (GRCm38) A113D probably benign Het
Grid2 A G 6: 64,663,228 (GRCm38) Q810R probably benign Het
Grid2 G A 6: 63,908,879 (GRCm38) M86I possibly damaging Het
Grik5 T A 7: 25,013,804 (GRCm38) D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,297,907 (GRCm38) probably null Het
Grin3a A G 4: 49,770,622 (GRCm38) S717P probably damaging Het
Grip1 C A 10: 119,819,483 (GRCm38) probably benign Het
Grip2 G C 6: 91,763,510 (GRCm38) P1023A possibly damaging Het
Grk2 C G 19: 4,287,645 (GRCm38) M568I probably benign Het
Grk3 C A 5: 112,957,314 (GRCm38) probably null Het
Grm5 G T 7: 87,602,715 (GRCm38) G58W probably damaging Het
Grm6 C A 11: 50,859,537 (GRCm38) P509H probably benign Het
Grm7 A G 6: 111,358,149 (GRCm38) E507G probably benign Het
Grm7 G T 6: 111,358,490 (GRCm38) V621F probably damaging Het
Grm8 G C 6: 28,126,027 (GRCm38) S33R probably benign Het
Grpr A G X: 163,515,034 (GRCm38) L338P probably damaging Het
Grtp1 T G 8: 13,200,199 (GRCm38) I17L probably benign Het
Gsdma C A 11: 98,669,759 (GRCm38) P179H probably damaging Het
Gsk3b A T 16: 38,208,070 (GRCm38) K297* probably null Het
Gspt2 GC G X: 94,637,468 (GRCm38) probably null Het
Gtf2h3 G T 5: 124,579,175 (GRCm38) probably benign Het
Gtf2i C A 5: 134,263,645 (GRCm38) G415V probably null Het
Gtf2ird1 T G 5: 134,409,312 (GRCm38) probably null Het
Gtf3a G A 5: 146,951,204 (GRCm38) C105Y probably damaging Het
Gtf3c1 T A 7: 125,703,964 (GRCm38) I100F probably damaging Het
Gtse1 A G 15: 85,868,746 (GRCm38) K354R possibly damaging Het
Guca1a T C 17: 47,400,410 (GRCm38) I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 (GRCm38) K400T probably damaging Het
Gulp1 C A 1: 44,788,479 (GRCm38) D260E probably damaging Het
Gxylt2 T G 6: 100,783,191 (GRCm38) L229R probably damaging Het
Gykl1 A G 18: 52,694,547 (GRCm38) K276E probably damaging Het
H2-Eb2 A C 17: 34,334,309 (GRCm38) E156D possibly damaging Het
H2-M11 A C 17: 36,548,770 (GRCm38) R218S possibly damaging Het
H2-Q2 A C 17: 35,345,675 (GRCm38) Q351P probably damaging Het
H2-T3 C G 17: 36,186,580 (GRCm38) L382F possibly damaging Het
H2-T3 A T 17: 36,186,582 (GRCm38) L382M possibly damaging Het
Habp2 T C 19: 56,317,760 (GRCm38) V426A probably damaging Het
Hacd1 C A 2: 14,035,795 (GRCm38) M216I probably damaging Het
Hacd2 G T 16: 35,106,325 (GRCm38) Q231H probably damaging Het
Hace1 A T 10: 45,686,662 (GRCm38) N758Y probably damaging Het
Hal G A 10: 93,489,893 (GRCm38) M89I probably benign Het
Hbb-bt A G 7: 103,813,892 (GRCm38) probably benign Het
Hc T A 2: 35,006,273 (GRCm38) probably null Het
Hcar1 T A 5: 123,879,741 (GRCm38) probably benign Het
Hcfc2 G C 10: 82,699,172 (GRCm38) R10T probably damaging Het
Hcls1 G T 16: 36,961,492 (GRCm38) R321M possibly damaging Het
Hcn4 G T 9: 58,858,148 (GRCm38) G638C unknown Het
Hdac1 T A 4: 129,542,616 (GRCm38) Q5L probably benign Het
Hdac9 G T 12: 34,373,987 (GRCm38) T536K probably benign Het
Hdgfl2 G T 17: 56,079,825 (GRCm38) R24L possibly damaging Het
Hdgfl2 G T 17: 56,097,016 (GRCm38) A281S probably null Het
Heatr1 T G 13: 12,399,008 (GRCm38) N155K possibly damaging Het
Hecw1 G A 13: 14,300,333 (GRCm38) A540V possibly damaging Het
Hells G T 19: 38,965,407 (GRCm38) R765S possibly damaging Het
Helq C A 5: 100,766,766 (GRCm38) L953F possibly damaging Het
Helz2 G C 2: 181,237,564 (GRCm38) P754A probably benign Het
Heph G C X: 96,554,922 (GRCm38) E919Q probably damaging Het
Herc1 A C 9: 66,434,576 (GRCm38) E1882D probably benign Het
Herc2 G T 7: 56,132,498 (GRCm38) G1311V probably damaging Het
Herc2 G A 7: 56,097,533 (GRCm38) V473I possibly damaging Het
Herc2 G A 7: 56,131,292 (GRCm38) G1235D probably benign Het
Herc3 G T 6: 58,843,858 (GRCm38) E76* probably null Het
Herc4 T G 10: 63,307,749 (GRCm38) I686S probably benign Het
Herc6 G T 6: 57,600,031 (GRCm38) G243V probably damaging Het
Herpud2 C G 9: 25,130,622 (GRCm38) V85L not run Het
Hexdc C A 11: 121,215,237 (GRCm38) P117T probably damaging Het
Hip1r A G 5: 123,997,010 (GRCm38) Q403R probably damaging Het
Hist1h1b T C 13: 21,780,094 (GRCm38) K154R unknown Het
Hist1h4i C A 13: 22,041,214 (GRCm38) R37L probably damaging Het
Hist2h2ab G T 3: 96,220,051 (GRCm38) A46S probably benign Het
Hivep3 C T 4: 120,133,782 (GRCm38) R2160W probably damaging Het
Hlcs A C 16: 94,262,659 (GRCm38) L367R probably damaging Het
Hmcn1 G T 1: 150,586,445 (GRCm38) Q5161K probably null Het
Hmcn1 A G 1: 150,663,917 (GRCm38) V2941A probably benign Het
Hmcn1 A G 1: 150,655,921 (GRCm38) V3199A possibly damaging Het
Hmcn2 C A 2: 31,425,416 (GRCm38) L3726M probably damaging Het
Hmcn2 G T 2: 31,429,091 (GRCm38) R3934S probably damaging Het
Hmcn2 G C 2: 31,344,029 (GRCm38) D269H possibly damaging Het
Hmga2 G C 10: 120,370,671 (GRCm38) P113A unknown Het
Hmgcs2 G A 3: 98,290,945 (GRCm38) G55S probably damaging Het
Hmx2 A T 7: 131,554,467 (GRCm38) E54V probably damaging Het
Hnf1a CA C 5: 114,950,124 (GRCm38) probably null Het
Hnrnpa2b1 G T 6: 51,467,243 (GRCm38) T20N probably damaging Het
Hnrnpf G A 6: 117,923,784 (GRCm38) G10S probably benign Het
Hnrnph2 G T X: 134,605,133 (GRCm38) E76* probably null Het
Hnrnpu T G 1: 178,332,215 (GRCm38) N434H unknown Het
Hnrnpul1 G C 7: 25,724,698 (GRCm38) P710A unknown Het
Hnrnpul1 C A 7: 25,724,664 (GRCm38) S721I probably benign Het
Hoxb1 C A 11: 96,367,051 (GRCm38) P269Q probably benign Het
Hoxd9 G C 2: 74,698,128 (GRCm38) A25P probably damaging Het
Hp1bp3 C T 4: 138,221,673 (GRCm38) L16F not run Het
Hpd C A 5: 123,181,475 (GRCm38) G49V probably damaging Het
Hps1 C A 19: 42,766,686 (GRCm38) R272S probably null Het
Hsd17b13 G T 5: 103,968,705 (GRCm38) P184T probably benign Het
Hsd17b3 C T 13: 64,063,138 (GRCm38) G182S possibly damaging Het
Hsd3b1 T G 3: 98,852,886 (GRCm38) Q263P probably damaging Het
Hsd3b2 C T 3: 98,712,222 (GRCm38) E136K probably benign Het
Hsd3b3 A G 3: 98,743,960 (GRCm38) V58A probably benign Het
Hsdl2 A T 4: 59,617,706 (GRCm38) K478* probably null Het
Hspa1l G C 17: 34,978,492 (GRCm38) K502N possibly damaging Het
Htr1f G T 16: 64,926,077 (GRCm38) S284* probably null Het
Htr1f G T 16: 64,926,874 (GRCm38) N18K probably benign Het
Htr7 G T 19: 35,969,423 (GRCm38) T397N probably damaging Het
Htra2 C A 6: 83,054,383 (GRCm38) R15L probably benign Het
Hunk C A 16: 90,472,573 (GRCm38) P335H probably damaging Het
Huwe1 C A X: 151,856,575 (GRCm38) H356N probably damaging Het
Huwe1 A C X: 151,928,381 (GRCm38) K3958T unknown Het
Hyal4 G A 6: 24,756,628 (GRCm38) V282M probably damaging Het
Hydin T G 8: 110,541,600 (GRCm38) F2904V possibly damaging Het
Hyou1 G T 9: 44,387,742 (GRCm38) E621* probably null Het
Ice1 C A 13: 70,605,201 (GRCm38) C922F probably damaging Het
Ide C T 19: 37,315,491 (GRCm38) V238M Het
Idh3b T A 2: 130,281,542 (GRCm38) probably null Het
Ifi204 C A 1: 173,751,628 (GRCm38) K550N probably null Het
Ifi206 T G 1: 173,482,048 (GRCm38) K127N Het
Ifi27l2b C A 12: 103,457,033 (GRCm38) G7C unknown Het
Ifi44 A G 3: 151,732,453 (GRCm38) L399P probably damaging Het
Ifih1 T G 2: 62,617,469 (GRCm38) Q297P probably benign Het
Ifitm1 C A 7: 140,969,517 (GRCm38) T71K probably benign Het
Ifna5 C T 4: 88,835,999 (GRCm38) H159Y probably damaging Het
Ifnab T G 4: 88,690,718 (GRCm38) E170D probably damaging Het
Ift122 A C 6: 115,915,994 (GRCm38) D854A probably damaging Het
Ift172 C A 5: 31,276,924 (GRCm38) W490L probably damaging Het
Igfbp4 C G 11: 99,051,515 (GRCm38) P234R probably damaging Het
Igfn1 G T 1: 135,972,000 (GRCm38) H524Q probably damaging Het
Ighv1-12 C A 12: 114,616,013 (GRCm38) G63V possibly damaging Het
Ighv14-4 C G 12: 114,176,672 (GRCm38) L39F probably damaging Het
Ighv14-4 C A 12: 114,176,667 (GRCm38) C41F probably damaging Het
Ighv1-52 C A 12: 115,145,777 (GRCm38) V21F probably damaging Het
Ighv1-63 C T 12: 115,495,645 (GRCm38) A111T possibly damaging Het
Ighv1-69 A C 12: 115,623,253 (GRCm38) S87A probably benign Het
Ighv1-9 T G 12: 114,583,834 (GRCm38) E29A probably benign Het
Igkv1-35 C T 6: 70,011,034 (GRCm38) G93R possibly damaging Het
Igkv1-99 T A 6: 68,542,262 (GRCm38) S68T Het
Igkv3-12 A T 6: 70,518,611 (GRCm38) I41F probably benign Het
Igkv4-74 T C 6: 69,185,345 (GRCm38) Q6R possibly damaging Het
Igkv6-32 T A 6: 70,074,586 (GRCm38) probably benign Het
Igsf21 A T 4: 140,067,215 (GRCm38) C116S probably damaging Het
Igsf5 C G 16: 96,391,023 (GRCm38) S274C probably damaging Het
Igsf8 G T 1: 172,318,354 (GRCm38) A406S probably damaging Het
Igsf9 G C 1: 172,492,149 (GRCm38) G337A probably damaging Het
Igsf9 G T 1: 172,495,226 (GRCm38) A586S probably benign Het
Igsf9b A G 9: 27,317,353 (GRCm38) probably null Het
Ihh T G 1: 74,946,094 (GRCm38) S411R probably damaging Het
Ik G T 18: 36,753,515 (GRCm38) D347Y possibly damaging Het
Ikbkap T A 4: 56,790,146 (GRCm38) T315S probably benign Het
Ikzf1 G T 11: 11,758,194 (GRCm38) probably null Het
Ikzf3 T G 11: 98,467,181 (GRCm38) E443D probably benign Het
Ikzf4 G A 10: 128,634,230 (GRCm38) P527S possibly damaging Het
Il10ra A C 9: 45,266,632 (GRCm38) S67A possibly damaging Het
Il16 C G 7: 83,652,827 (GRCm38) S727T probably benign Het
Il17rc G T 6: 113,476,795 (GRCm38) probably null Het
Il1rap G T 16: 26,722,399 (GRCm38) R463S probably damaging Het
Il27ra C A 8: 84,040,990 (GRCm38) W101C probably damaging Het
Il2ra C A 2: 11,681,931 (GRCm38) A191D probably damaging Het
Il6st A G 13: 112,493,618 (GRCm38) K333E probably benign Het
Impg1 C G 9: 80,378,467 (GRCm38) R418S probably benign Het
Incenp C A 19: 9,877,687 (GRCm38) W620L unknown Het
Inhbb C A 1: 119,417,798 (GRCm38) V254L probably benign Het
Inpp4b C G 8: 82,069,001 (GRCm38) A818G possibly damaging Het
Inpp5b CA C 4: 124,797,840 (GRCm38) probably null Het
Inpp5d T G 1: 87,703,131 (GRCm38) L671W probably damaging Het
Inpp5d T G 1: 87,669,709 (GRCm38) F201V probably benign Het
Inpp5j G T 11: 3,502,484 (GRCm38) Y255* probably null Het
Insc C T 7: 114,811,639 (GRCm38) Q244* probably null Het
Insm1 C T 2: 146,223,556 (GRCm38) Q431* probably null Het
Ints12 A C 3: 133,102,464 (GRCm38) D201A probably damaging Het
Ints6l G A X: 56,497,935 (GRCm38) M527I probably damaging Het
Ints9 G A 14: 65,037,454 (GRCm38) V620I probably benign Het
Ipo13 C A 4: 117,904,630 (GRCm38) E458* probably null Het
Ipp G T 4: 116,537,885 (GRCm38) G539V probably null Het
Iqca A T 1: 90,045,725 (GRCm38) V775E probably benign Het
Iqcf3 G T 9: 106,560,988 (GRCm38) P12Q unknown Het
Iqck C A 7: 118,941,654 (GRCm38) R259S probably benign Het
Iqgap1 C A 7: 80,768,309 (GRCm38) K104N probably benign Het
Iqgap2 A G 13: 95,731,443 (GRCm38) I219T possibly damaging Het
Irgq G T 7: 24,531,801 (GRCm38) G139V probably damaging Het
Irs2 T G 8: 11,006,185 (GRCm38) D749A probably damaging Het
Irx6 C A 8: 92,678,371 (GRCm38) P289H possibly damaging Het
Isl2 C A 9: 55,542,215 (GRCm38) C58* probably null Het
Ism1 A C 2: 139,731,874 (GRCm38) N48T probably benign Het
Itga7 A C 10: 128,953,827 (GRCm38) K1012T probably benign Het
Itga8 C A 2: 12,301,832 (GRCm38) probably benign Het
Itga8 A C 2: 12,247,518 (GRCm38) F294V probably damaging Het
Itga8 C A 2: 12,262,136 (GRCm38) A163S probably benign Het
Itga9 A C 9: 118,843,530 (GRCm38) D790A probably benign Het
Itga9 G A 9: 118,887,839 (GRCm38) V990M probably damaging Het
Itgad T A 7: 128,190,087 (GRCm38) N574K probably damaging Het
Itgax G C 7: 128,144,872 (GRCm38) R909T probably benign Het
Itgb2 A T 10: 77,557,962 (GRCm38) Q412L probably benign Het
Itgb3 G T 11: 104,643,623 (GRCm38) K435N possibly damaging Het
Itgb4 G A 11: 116,006,520 (GRCm38) G1536R probably damaging Het
Itgb6 G C 2: 60,611,468 (GRCm38) S666C possibly damaging Het
Itgbl1 G T 14: 123,954,672 (GRCm38) G373C probably damaging Het
Itih4 GAA G 14: 30,899,462 (GRCm38) probably null Het
Itm2c G A 1: 85,906,527 (GRCm38) V188M possibly damaging Het
Itpka G C 2: 119,742,800 (GRCm38) S141T probably damaging Het
Itpkc C A 7: 27,227,638 (GRCm38) D284Y probably benign Het
Itpr1 T A 6: 108,499,149 (GRCm38) W2275R probably damaging Het
Ivd G T 2: 118,876,344 (GRCm38) K272N possibly damaging Het
Ivns1abp A G 1: 151,351,033 (GRCm38) E12G probably damaging Het
Jak1 C T 4: 101,163,722 (GRCm38) M640I probably benign Het
Jak1 C A 4: 101,163,681 (GRCm38) G654V probably damaging Het
Jak2 G A 19: 29,271,398 (GRCm38) E92K possibly damaging Het
Jak3 C G 8: 71,680,683 (GRCm38) A340G possibly damaging Het
Jakmip3 G T 7: 139,020,133 (GRCm38) R254L probably benign Het
Jmjd1c T C 10: 67,238,174 (GRCm38) L1896P probably benign Het
Jph1 C T 1: 17,097,352 (GRCm38) E85K possibly damaging Het
Jph4 G A 14: 55,113,648 (GRCm38) R304C probably benign Het
Jun T A 4: 95,051,378 (GRCm38) probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,778,294 (GRCm38) probably null Het
Kat6a C G 8: 22,910,154 (GRCm38) C310W probably damaging Het
Katna1 G T 10: 7,759,785 (GRCm38) S328I probably damaging Het
Katnal2 T C 18: 77,012,057 (GRCm38) K127R probably benign Het
Kbtbd2 T G 6: 56,780,309 (GRCm38) E147D probably damaging Het
Kcna3 A T 3: 107,037,266 (GRCm38) N282Y probably damaging Het
Kcna5 T A 6: 126,533,716 (GRCm38) K483M probably damaging Het
Kcnb1 G T 2: 167,188,402 (GRCm38) D74E probably damaging Het
Kcne2 C T 16: 92,296,591 (GRCm38) A2V probably benign Het
Kcnh1 C A 1: 192,418,737 (GRCm38) R573S probably damaging Het
Kcnh8 C A 17: 52,894,061 (GRCm38) L508I probably damaging Het
Kcnj2 G T 11: 111,072,135 (GRCm38) V118L probably benign Het
Kcnk18 G T 19: 59,234,959 (GRCm38) A179S probably benign Het
Kcnq4 A C 4: 120,698,497 (GRCm38) probably null Het
Kcns1 G A 2: 164,168,633 (GRCm38) H69Y probably benign Het
Kcnt1 G C 2: 25,906,796 (GRCm38) R809P probably benign Het
Kcnt2 G C 1: 140,376,361 (GRCm38) W156C probably damaging Het
Kcnv2 G T 19: 27,323,438 (GRCm38) A230S probably benign Het
Kcp T A 6: 29,485,012 (GRCm38) E1247V probably benign Het
Kctd1 C T 18: 15,063,125 (GRCm38) S147N unknown Het
Kctd12 C G 14: 102,981,918 (GRCm38) G175R not run Het
Kctd19 A C 8: 105,385,136 (GRCm38) F842V probably damaging Het
Kdm3b G T 18: 34,809,069 (GRCm38) E738* probably null Het
Kdm4a T A 4: 118,177,502 (GRCm38) S11C probably benign Het
Kdm4a C T 4: 118,153,190 (GRCm38) E619K probably benign Het
Kdm5b G A 1: 134,625,035 (GRCm38) D1250N probably damaging Het
Kel G T 6: 41,687,572 (GRCm38) P644T probably damaging Het
Khdc1c G T 1: 21,369,563 (GRCm38) E113* probably null Het
Khdrbs2 G T 1: 32,333,662 (GRCm38) W139L unknown Het
Khdrbs3 T C 15: 69,017,467 (GRCm38) L155P probably damaging Het
Kif12 T G 4: 63,171,997 (GRCm38) E3D possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 (GRCm38) probably benign Het
Kif13b C G 14: 64,803,344 (GRCm38) P1627R probably benign Het
Kif14 G T 1: 136,500,016 (GRCm38) probably null Het
Kif14 A T 1: 136,496,653 (GRCm38) Q1002L probably damaging Het
Kif18a G A 2: 109,318,053 (GRCm38) G631R possibly damaging Het
Kif19a A T 11: 114,786,590 (GRCm38) E600V probably damaging Het
Kif19a C A 11: 114,789,829 (GRCm38) A925E probably benign Het
Kif1a G A 1: 93,022,491 (GRCm38) R1405W probably damaging Het
Kif1a G C 1: 93,021,316 (GRCm38) L1495V probably damaging Het
Kif1a G A 1: 93,055,697 (GRCm38) P693S probably benign Het
Kif1b T G 4: 149,266,298 (GRCm38) K273T possibly damaging Het
Kif20b C G 19: 34,952,875 (GRCm38) S1260C probably benign Het
Kif21b C A 1: 136,154,137 (GRCm38) T641K probably benign Het
Kif26a G C 12: 112,177,618 (GRCm38) E1435D probably damaging Het
Kif28 T G 1: 179,733,134 (GRCm38) K202T probably benign Het
Kif2b C A 11: 91,576,264 (GRCm38) E398* probably null Het
Kirrel2 T C 7: 30,453,457 (GRCm38) T379A probably benign Het
Klf17 G T 4: 117,760,351 (GRCm38) R270S probably benign Het
Klhdc7a G T 4: 139,967,797 (GRCm38) probably benign Het
Klhdc8b T A 9: 108,448,377 (GRCm38) Q326L probably benign Het
Klhl18 C G 9: 110,437,347 (GRCm38) A300P probably null Het
Klhl2 C A 8: 64,758,126 (GRCm38) R296L probably damaging Het
Klhl22 G A 16: 17,776,696 (GRCm38) D230N probably benign Het
Klhl30 C G 1: 91,359,465 (GRCm38) A491G probably damaging Het
Klhl6 G T 16: 19,953,674 (GRCm38) T307N probably damaging Het
Klk8 C A 7: 43,803,725 (GRCm38) R247S possibly damaging Het
Klkb1 G T 8: 45,273,629 (GRCm38) R446S probably damaging Het
Klra1 C G 6: 130,372,851 (GRCm38) W208S probably damaging Het
Klra3 C A 6: 130,335,721 (GRCm38) E27* probably null Het
Klra5 G C 6: 129,911,452 (GRCm38) P4A not run Het
Klrb1a GT G 6: 128,618,585 (GRCm38) probably null Het
Kmt2a C A 9: 44,847,979 (GRCm38) D858Y probably damaging Het
Kmt2b C A 7: 30,577,370 (GRCm38) R1674L probably damaging Het
Kmt2c G C 5: 25,354,413 (GRCm38) A1076G probably damaging Het
Kmt5b G T 19: 3,793,118 (GRCm38) G72* probably null Het
Kng1 G T 16: 23,079,616 (GRCm38) V589L probably benign Het
Kpna6 C A 4: 129,655,548 (GRCm38) W147L probably damaging Het
Kpna6 T A 4: 129,648,078 (GRCm38) S509C possibly damaging Het
Krt12 C A 11: 99,420,761 (GRCm38) E205* probably null Het
Krt17 T G 11: 100,260,923 (GRCm38) K15Q probably benign Het
Krt222 A T 11: 99,238,552 (GRCm38) L143Q probably damaging Het
Krt24 C G 11: 99,284,886 (GRCm38) G108R unknown Het
Krt25 C G 11: 99,322,822 (GRCm38) A24P probably benign Het
Krt27 C A 11: 99,348,978 (GRCm38) E253D probably damaging Het
Krt33a C A 11: 100,011,914 (GRCm38) E361D probably benign Het
Krt34 G T 11: 100,041,434 (GRCm38) C21* probably null Het
Krt82 C T 15: 101,541,852 (GRCm38) V470I probably benign Het
Krtap1-3 A G 11: 99,590,995 (GRCm38) C109R possibly damaging Het
Krtap16-1 C T 11: 99,985,597 (GRCm38) R327Q possibly damaging Het
Krtap21-1 C A 16: 89,403,581 (GRCm38) G58C unknown Het
Krtap28-13 G T 1: 83,061,090 (GRCm38) C32F unknown Het
Krtap3-1 G C 11: 99,566,567 (GRCm38) A6G probably benign Het
Krtap4-2 C A 11: 99,634,976 (GRCm38) G17C unknown Het
Krtap6-1 G C 16: 89,031,809 (GRCm38) C31S unknown Het
Krtap7-1 C A 16: 89,508,260 (GRCm38) M1I probably null Het
Ksr1 C A 11: 79,020,751 (GRCm38) R735L possibly damaging Het
Ksr1 C A 11: 79,027,600 (GRCm38) R576L probably benign Het
Kyat1 G T 2: 30,187,732 (GRCm38) T175N probably damaging Het
L2hgdh C T 12: 69,707,132 (GRCm38) S233N probably benign Het
L3mbtl4 G T 17: 68,425,687 (GRCm38) W54L probably damaging Het
Lama1 G A 17: 67,752,883 (GRCm38) D656N probably benign Het
Lamb1 A T 12: 31,327,702 (GRCm38) S1697C possibly damaging Het
Lamb2 G T 9: 108,482,901 (GRCm38) G419C probably damaging Het
Lamc2 C A 1: 153,133,621 (GRCm38) V813L probably benign Het
Lamp2 T C X: 38,424,381 (GRCm38) S332G probably damaging Het
Lao1 C A 4: 118,968,440 (GRCm38) H486N probably damaging Het
Large2 G C 2: 92,370,198 (GRCm38) T87R probably benign Het
Lats1 G T 10: 7,705,809 (GRCm38) G786V probably damaging Het
Lbp T A 2: 158,325,762 (GRCm38) L402Q probably damaging Het
Lcn11 G T 2: 25,777,724 (GRCm38) K41N probably benign Het
Lct C A 1: 128,287,611 (GRCm38) E1743* probably null Het
Ldb3 C G 14: 34,555,365 (GRCm38) A351P probably benign Het
Ldhd G T 8: 111,627,520 (GRCm38) T382N probably damaging Het
Lect2 A T 13: 56,548,361 (GRCm38) M1K probably null Het
Lef1 C A 3: 131,200,323 (GRCm38) A344D probably damaging Het
Lep G C 6: 29,070,970 (GRCm38) A98P possibly damaging Het
Lepr C A 4: 101,745,614 (GRCm38) P200T probably damaging Het
Lexm G T 4: 106,607,300 (GRCm38) D387E probably benign Het
Lgr5 C A 10: 115,460,876 (GRCm38) R382M probably damaging Het
Lhcgr T G 17: 88,742,270 (GRCm38) K609N probably damaging Het
Lhx3 G T 2: 26,203,987 (GRCm38) R77S probably damaging Het
Lhx4 C A 1: 155,705,255 (GRCm38) A175S probably damaging Het
Lilra6 C T 7: 3,915,074 (GRCm38) probably null Het
Lingo3 G C 10: 80,834,855 (GRCm38) Q414E possibly damaging Het
Lins1 C G 7: 66,710,264 (GRCm38) A263G possibly damaging Het
Lipf T A 19: 33,965,595 (GRCm38) L101Q probably damaging Het
Lipo3 A C 19: 33,584,928 (GRCm38) L14R probably null Het
Lipo4 C A 19: 33,503,184 (GRCm38) M261I probably benign Het
Lipt1 G A 1: 37,875,903 (GRCm38) V347I probably benign Het
Llgl2 G T 11: 115,849,554 (GRCm38) E359* probably null Het
Lman2l C A 1: 36,428,376 (GRCm38) G197V probably damaging Het
Lmnb2 C G 10: 80,903,238 (GRCm38) G594R probably damaging Het
Lmo7 G A 14: 101,919,443 (GRCm38) E1350K unknown Het
Lmo7 T C 14: 101,929,228 (GRCm38) S1548P unknown Het
Lmo7 A T 14: 101,919,281 (GRCm38) T1296S probably benign Het
Lmo7 C A 14: 101,884,306 (GRCm38) P269Q probably damaging Het
Lmx1a A T 1: 167,691,999 (GRCm38) K32M possibly damaging Het
Lnp1 C T 16: 56,927,903 (GRCm38) D9N possibly damaging Het
Lox T G 18: 52,520,834 (GRCm38) T397P probably damaging Het
Lpar5 C A 6: 125,081,379 (GRCm38) T21K possibly damaging Het
Lpar5 T G 6: 125,082,072 (GRCm38) L252R probably damaging Het
Lpgat1 T G 1: 191,778,475 (GRCm38) F391V probably benign Het
Lpin2 C G 17: 71,225,211 (GRCm38) S225* probably null Het
Lpin3 C G 2: 160,899,785 (GRCm38) P492A probably damaging Het
Lpp G C 16: 24,761,603 (GRCm38) S148T probably benign Het
Lpxn C A 19: 12,824,947 (GRCm38) A212D probably damaging Het
Lrba G T 3: 86,751,532 (GRCm38) G2569C possibly damaging Het
Lrba G C 3: 86,715,538 (GRCm38) C2409S probably benign Het
Lrch3 A C 16: 32,914,316 (GRCm38) T59P possibly damaging Het
Lrfn1 A G 7: 28,459,115 (GRCm38) E153G possibly damaging Het
Lrig1 G T 6: 94,609,026 (GRCm38) T727N possibly damaging Het
Lrp1 C G 10: 127,554,962 (GRCm38) C3022S probably damaging Het
Lrp12 A T 15: 39,878,123 (GRCm38) F418I probably damaging Het
Lrp1b A C 2: 40,677,506 (GRCm38) L4070V Het
Lrp1b G T 2: 41,728,710 (GRCm38) N231K Het
Lrp1b T A 2: 40,697,582 (GRCm38) D3887V Het
Lrp1b C A 2: 40,922,383 (GRCm38) E2517D Het
Lrp2 A T 2: 69,507,881 (GRCm38) V1185E possibly damaging Het
Lrp2 C G 2: 69,480,042 (GRCm38) G2729A possibly damaging Het
Lrp6 C T 6: 134,456,157 (GRCm38) G1404R possibly damaging Het
Lrpprc C G 17: 84,770,431 (GRCm38) A359P possibly damaging Het
Lrrc15 C G 16: 30,274,252 (GRCm38) A90P probably benign Het
Lrrc18 C G 14: 33,009,200 (GRCm38) P232R probably benign Het
Lrrc20 A G 10: 61,527,165 (GRCm38) K63R probably damaging Het
Lrrc27 C A 7: 139,242,720 (GRCm38) P509Q probably damaging Het
Lrrc30 C T 17: 67,632,436 (GRCm38) V50I probably benign Het
Lrrc37a C A 11: 103,456,486 (GRCm38) D3128Y probably damaging Het
Lrrc37a G T 11: 103,499,034 (GRCm38) A1855D possibly damaging Het
Lrrc37a T G 11: 103,501,094 (GRCm38) E1168D probably benign Het
Lrrc49 T A 9: 60,677,221 (GRCm38) Q186L probably damaging Het
Lrrc4b GC G 7: 44,461,312 (GRCm38) probably null Het
Lrrc4b G A 7: 44,445,123 (GRCm38) V72M probably damaging Het
Lrrc59 A C 11: 94,643,321 (GRCm38) K235T probably benign Het
Lrrc8e A T 8: 4,234,822 (GRCm38) E349V probably damaging Het
Lrrc9 A G 12: 72,477,393 (GRCm38) K791R probably damaging Het
Lrrd1 C T 5: 3,850,025 (GRCm38) P110L probably benign Het
Lrrfip1 G T 1: 91,101,199 (GRCm38) M68I possibly damaging Het
Lrrfip2 C A 9: 111,161,340 (GRCm38) A43E probably damaging Het
Lrriq1 G T 10: 103,234,085 (GRCm38) S23R probably damaging Het
Lrriq1 T A 10: 103,202,359 (GRCm38) Q861L probably damaging Het
Lrriq1 G T 10: 103,202,360 (GRCm38) Q861K probably damaging Het
Lrrtm2 T C 18: 35,214,659 (GRCm38) probably benign Het
Lrrtm3 C A 10: 64,089,355 (GRCm38) G11V probably damaging Het
Lrsam1 C G 2: 32,941,814 (GRCm38) R383P probably damaging Het
Lrwd1 G A 5: 136,134,008 (GRCm38) R120C probably damaging Het
Ltbp2 G C 12: 84,875,853 (GRCm38) R147G probably benign Het
Luc7l2 G T 6: 38,551,908 (GRCm38) G21* probably null Het
Ly9 G T 1: 171,594,060 (GRCm38) T541K probably damaging Het
Lyg1 C A 1: 37,947,177 (GRCm38) G159C probably null Het
Lyg2 C A 1: 37,911,127 (GRCm38) C40F probably damaging Het
Lyst C G 13: 13,777,079 (GRCm38) A3755G probably benign Het
Lyst T C 13: 13,640,107 (GRCm38) L1149S probably damaging Het
M1ap A T 6: 82,968,042 (GRCm38) R106* probably null Het
Macrod2 T A 2: 141,024,090 (GRCm38) C123S probably damaging Het
Macrod2 G T 2: 140,706,208 (GRCm38) G93V probably damaging Het
Madd C A 2: 91,159,272 (GRCm38) G1129V probably damaging Het
Mafg T G 11: 120,629,528 (GRCm38) Q82P probably damaging Het
Mageb18 G A X: 92,119,896 (GRCm38) P247S probably damaging Het
Magi2 C A 5: 20,702,109 (GRCm38) Q1094K probably benign Het
Magohb C A 6: 131,288,063 (GRCm38) W79C probably damaging Het
Malrd1 C A 2: 16,217,845 (GRCm38) Q2015K unknown Het
Mamdc2 A C 19: 23,334,057 (GRCm38) F478V possibly damaging Het
Man1a G T 10: 53,919,315 (GRCm38) P523Q probably damaging Het
Man1b1 G C 2: 25,344,983 (GRCm38) R270T possibly damaging Het
Man2b1 A C 8: 85,093,938 (GRCm38) D618A probably damaging Het
Manba G T 3: 135,563,274 (GRCm38) G647* probably null Het
Map1a G T 2: 121,303,238 (GRCm38) G1512C possibly damaging Het
Map2k5 C A 9: 63,358,038 (GRCm38) R69S probably damaging Het
Map3k13 G T 16: 21,905,162 (GRCm38) G298V probably damaging Het
Map3k14 G T 11: 103,225,496 (GRCm38) T702K probably benign Het
Map3k14 T G 11: 103,231,073 (GRCm38) E506A probably benign Het
Map3k7 T G 4: 32,015,963 (GRCm38) I496S probably damaging Het
Map3k9 C A 12: 81,772,782 (GRCm38) D233Y possibly damaging Het
Map4k3 C G 17: 80,618,337 (GRCm38) A410P possibly damaging Het
Map6 G C 7: 99,317,660 (GRCm38) E565D probably damaging Het
Mapk10 A T 5: 102,991,887 (GRCm38) L166Q probably damaging Het
Mapk4 A G 18: 73,937,184 (GRCm38) W213R probably damaging Het
Mapk8 G T 14: 33,410,886 (GRCm38) P31H probably damaging Het
March4 C T 1: 72,452,500 (GRCm38) C204Y probably damaging Het
Marf1 C A 16: 14,115,777 (GRCm38) Q1582H probably benign Het
Mast1 T G 8: 84,912,459 (GRCm38) S1414R probably damaging Het
Mast1 G C 8: 84,918,681 (GRCm38) R712G probably damaging Het
Mast4 C G 13: 102,738,460 (GRCm38) E1467Q probably damaging Het
Mat1a A T 14: 41,105,510 (GRCm38) probably benign Het
Mat2b C G 11: 40,682,485 (GRCm38) Q233H probably damaging Het
Mat2b T A 11: 40,687,777 (GRCm38) S28C probably benign Het
Matn1 T A 4: 130,946,105 (GRCm38) L128Q probably damaging Het
Mavs G T 2: 131,240,401 (GRCm38) W68C probably damaging Het
Mbd5 A C 2: 49,279,308 (GRCm38) N1497T probably benign Het
Mbip T G 12: 56,340,385 (GRCm38) E156D probably damaging Het
Mbnl2 G C 14: 120,403,359 (GRCm38) A346P probably benign Het
Mboat2 G T 12: 24,948,344 (GRCm38) A282S possibly damaging Het
Mcm3 C A 1: 20,820,181 (GRCm38) V10L probably benign Het
Mcm8 G T 2: 132,827,567 (GRCm38) G319* probably null Het
Mcm9 C A 10: 53,537,507 (GRCm38) R492S unknown Het
Mcoln3 C G 3: 146,140,466 (GRCm38) H510Q probably benign Het
Mcts1 A C X: 38,601,941 (GRCm38) K8N possibly damaging Het
Mdga2 C A 12: 66,689,443 (GRCm38) G337V probably damaging Het
Mdh1b G T 1: 63,711,531 (GRCm38) T426K probably benign Het
Mdh2 C A 5: 135,789,629 (GRCm38) S246Y probably damaging Het
Mdn1 A G 4: 32,667,102 (GRCm38) N189S probably benign Het
Mdn1 A C 4: 32,696,244 (GRCm38) N1209T probably damaging Het
Mdn1 G T 4: 32,668,944 (GRCm38) G334V probably damaging Het
Med1 C A 11: 98,161,183 (GRCm38) V452L possibly damaging Het
Med12 G T X: 101,281,225 (GRCm38) D679Y probably damaging Het
Med12 G T X: 101,293,573 (GRCm38) Q1902H possibly damaging Het
Med12l C A 3: 59,244,943 (GRCm38) L1050I probably damaging Het
Med12l C A 3: 59,091,417 (GRCm38) N599K probably damaging Het
Med12l C A 3: 59,296,117 (GRCm38) P2020Q probably benign Het
Med13 T A 11: 86,345,862 (GRCm38) K156N probably benign Het
Med13 T G 11: 86,355,423 (GRCm38) D51A probably damaging Het
Med13 T A 11: 86,328,544 (GRCm38) S359C possibly damaging Het
Medag G T 5: 149,427,507 (GRCm38) probably null Het
Mef2b G C 8: 70,166,375 (GRCm38) R202S probably damaging Het
Mefv C A 16: 3,715,455 (GRCm38) E317D possibly damaging Het
Megf10 C G 18: 57,277,694 (GRCm38) P692A probably damaging Het
Meis1 C A 11: 19,014,317 (GRCm38) G105V probably damaging Het
Mep1a C G 17: 43,477,320 (GRCm38) R628T probably benign Het
Mepce C A 5: 137,785,842 (GRCm38) G74V probably damaging Het
Mettl25 C A 10: 105,826,098 (GRCm38) R337I possibly damaging Het
Mettl4 T G 17: 94,733,563 (GRCm38) T388P probably benign Het
Mettl7b G T 10: 128,958,748 (GRCm38) P236T probably damaging Het
Mex3d C G 10: 80,386,713 (GRCm38) E236D Het
Mfsd11 G C 11: 116,863,940 (GRCm38) A226P probably damaging Het
Mfsd13b G A 7: 120,991,677 (GRCm38) V214I probably benign Het
Mfsd2a G C 4: 122,951,839 (GRCm38) T173S probably benign Het
Mfsd2a G T 4: 122,959,311 (GRCm38) L62M possibly damaging Het
Mfsd2b C A 12: 4,866,530 (GRCm38) probably null Het
Mfsd4b2 C T 10: 39,921,600 (GRCm38) S253N probably benign Het
Mfsd4b4 G T 10: 39,892,599 (GRCm38) P212H possibly damaging Het
Mfsd4b5 G C 10: 39,986,390 (GRCm38) L46V probably damaging Het
Mgam G T 6: 40,677,644 (GRCm38) probably null Het
Mgam G T 6: 40,729,066 (GRCm38) R23L probably damaging Het
Mgat4d G C 8: 83,348,521 (GRCm38) V13L probably benign Het
Mgat4d A C 8: 83,368,112 (GRCm38) K259N probably benign Het
Mia2 C G 12: 59,108,801 (GRCm38) D433E probably damaging Het
Mia2 G T 12: 59,108,124 (GRCm38) D208Y probably benign Het
Mib2 G C 4: 155,661,141 (GRCm38) A71G probably benign Het
Midn G A 10: 80,153,628 (GRCm38) G142E probably benign Het
Mier2 C A 10: 79,540,501 (GRCm38) V197L unknown Het
Mill1 A T 7: 18,245,499 (GRCm38) probably benign Het
Mkln1 A C 6: 31,398,921 (GRCm38) K22T possibly damaging Het
Mkln1 G T 6: 31,451,554 (GRCm38) G273C probably damaging Het
Mkrn1 T A 6: 39,400,456 (GRCm38) N282Y probably null Het
Mkrn3 C T 7: 62,419,810 (GRCm38) G78R probably benign Het
Mmel1 C T 4: 154,895,208 (GRCm38) R762* probably null Het
Mmp10 G T 9: 7,508,205 (GRCm38) probably null Het
Mmp24 G A 2: 155,810,392 (GRCm38) G340E probably damaging Het
Mmp25 C G 17: 23,630,659 (GRCm38) C586S probably damaging Het
Mmp7 G C 9: 7,695,602 (GRCm38) G160A probably damaging Het
Mmrn1 C G 6: 60,945,034 (GRCm38) D158E probably benign Het
Mn1 A C 5: 111,454,706 (GRCm38) K1270T possibly damaging Het
Mn1 C G 5: 111,420,379 (GRCm38) S738R probably benign Het
Mnt C T 11: 74,836,675 (GRCm38) P129L probably damaging Het
Mnx1 C A 5: 29,474,174 (GRCm38) E304* probably null Het
Mnx1 C A 5: 29,474,088 (GRCm38) E332D unknown Het
Moap1 C G 12: 102,743,075 (GRCm38) E72Q probably damaging Het
Mocos A T 18: 24,670,633 (GRCm38) H337L probably benign Het
Mogs G T 6: 83,116,213 (GRCm38) G181W probably damaging Het
Mon1b G C 8: 113,637,809 (GRCm38) E73Q probably benign Het
Morc1 G T 16: 48,587,058 (GRCm38) V646L probably benign Het
Mpig6b C A 17: 35,065,340 (GRCm38) G158V probably damaging Het
Mpp3 G T 11: 102,008,356 (GRCm38) H419N probably damaging Het
Mprip A T 11: 59,759,484 (GRCm38) Q1338L probably benign Het
Mprip G T 11: 59,737,404 (GRCm38) G226W possibly damaging Het
Mpv17l G T 16: 13,940,829 (GRCm38) R39L probably benign Het
Mrc2 G T 11: 105,347,360 (GRCm38) E1153* probably null Het
Mrc2 G C 11: 105,341,376 (GRCm38) W886S possibly damaging Het
Mrgprd T A 7: 145,321,953 (GRCm38) L187H probably damaging Het
Mrgprx2 A C 7: 48,482,342 (GRCm38) F243V probably damaging Het
Mrpl37 C A 4: 107,057,426 (GRCm38) Q380H probably damaging Het
Mrpl39 C T 16: 84,723,972 (GRCm38) V260I probably benign Het
Mrpl45 G T 11: 97,321,559 (GRCm38) A121S probably benign Het
Mrps14 A C 1: 160,197,027 (GRCm38) M43L probably benign Het
Mrps24 T A 11: 5,704,538 (GRCm38) S139C possibly damaging Het
Mrvi1 C T 7: 110,923,999 (GRCm38) R79H probably benign Het
Ms4a6b A T 19: 11,529,486 (GRCm38) probably null Het
Ms4a8a G A 19: 11,070,760 (GRCm38) S202L possibly damaging Het
Msc A T 1: 14,755,239 (GRCm38) C39S unknown Het
Msi2 C A 11: 88,348,792 (GRCm38) G331C probably damaging Het
Msln G T 17: 25,753,794 (GRCm38) Q38K possibly damaging Het
Mss51 C T 14: 20,486,146 (GRCm38) probably null Het
Mtcl1 T C 17: 66,379,460 (GRCm38) E817G probably benign Het
Mtf2 G C 5: 108,087,944 (GRCm38) G163R probably damaging Het
Mtfr1l C G 4: 134,530,679 (GRCm38) probably null Het
Mthfd1 G A 12: 76,303,967 (GRCm38) G708R possibly damaging Het
Mtmr2 A C 9: 13,799,281 (GRCm38) E375D probably benign Het
Mtmr3 G C 11: 4,485,913 (GRCm38) A1098G probably damaging Het
Mtor G C 4: 148,550,130 (GRCm38) V2403L possibly damaging Het
Mtor A T 4: 148,550,125 (GRCm38) H2401L probably benign Het
Mttp C A 3: 138,104,779 (GRCm38) R625L probably benign Het
Mtus2 G T 5: 148,077,258 (GRCm38) R287L probably benign Het
Mtus2 A G 5: 148,076,742 (GRCm38) K115R probably benign Het
Muc13 T C 16: 33,815,850 (GRCm38) M568T possibly damaging Het
Muc13 A C 16: 33,799,087 (GRCm38) Q68H unknown Het
Muc2 T G 7: 141,746,714 (GRCm38) I258S Het
Muc4 G A 16: 32,768,730 (GRCm38) V754I possibly damaging Het
Muc5b C A 7: 141,842,705 (GRCm38) L185I unknown Het
Mug1 G A 6: 121,841,294 (GRCm38) M151I probably benign Het
Mug1 T G 6: 121,880,493 (GRCm38) F1059V probably damaging Het
Mup11 C A 4: 60,660,215 (GRCm38) M121I probably benign Het
Mup8 C A 4: 60,222,542 (GRCm38) probably benign Het
Mup8 T C 4: 60,222,378 (GRCm38) E31G probably benign Het
Mvb12b A T 2: 33,874,370 (GRCm38) S56T probably damaging Het
Mybl1 C A 1: 9,685,769 (GRCm38) R185L probably damaging Het
Mybpc1 G T 10: 88,560,327 (GRCm38) N205K probably benign Het
Mybpc2 A C 7: 44,521,696 (GRCm38) S144A probably benign Het
Mybpc3 C A 2: 91,120,403 (GRCm38) P192Q possibly damaging Het
Mycbp2 C A 14: 103,156,637 (GRCm38) K2829N probably benign Het
Mycbp2 T A 14: 103,346,249 (GRCm38) Q90L probably benign Het
Myf6 G T 10: 107,494,260 (GRCm38) H149N probably benign Het
Myh11 C A 16: 14,239,396 (GRCm38) A345S probably null Het
Myh11 T A 16: 14,277,775 (GRCm38) E41V Het
Myh13 T A 11: 67,329,295 (GRCm38) S157T possibly damaging Het
Myh14 A G 7: 44,638,309 (GRCm38) V592A probably damaging Het
Myh14 G T 7: 44,608,515 (GRCm38) R1858S probably damaging Het
Myh15 A C 16: 49,096,531 (GRCm38) S405R probably damaging Het
Myh3 G C 11: 67,082,415 (GRCm38) W113S possibly damaging Het
Myh4 G T 11: 67,248,641 (GRCm38) G595C probably damaging Het
Myh4 G T 11: 67,253,505 (GRCm38) D1234Y probably damaging Het
Myh4 G A 11: 67,256,271 (GRCm38) A1581T probably benign Het
Myh8 A C 11: 67,303,674 (GRCm38) Q1570H probably damaging Het
Mylk3 A T 8: 85,365,179 (GRCm38) Het
Myo15 G C 11: 60,498,403 (GRCm38) R873P Het
Myo15 G T 11: 60,524,441 (GRCm38) V3410L probably damaging Het
Myo15 G C 11: 60,488,258 (GRCm38) A232P Het
Myo15b A T 11: 115,887,925 (GRCm38) T2582S unknown Het
Myo15b C T 11: 115,883,452 (GRCm38) P339S possibly damaging Het
Myo18b A T 5: 112,809,738 (GRCm38) L1453Q possibly damaging Het
Myo18b C T 5: 112,762,721 (GRCm38) R1935H not run Het
Myo18b C A 5: 112,831,190 (GRCm38) G1186W probably damaging Het
Myo19 GCACACAC GCACAC 11: 84,909,350 (GRCm38) probably null Het
Myo19 G A 11: 84,885,278 (GRCm38) G30E probably benign Het
Myo1g C G 11: 6,519,045 (GRCm38) A86P probably damaging Het
Myo7a C G 7: 98,095,727 (GRCm38) R291P probably damaging Het
Myo7b C A 18: 31,980,998 (GRCm38) R1100L possibly damaging Het
Myo9a A C 9: 59,895,259 (GRCm38) T2010P probably damaging Het
Myoc G C 1: 162,649,154 (GRCm38) D476H probably damaging Het
Myoc G T 1: 162,639,636 (GRCm38) E125* probably null Het
Myom3 G T 4: 135,764,820 (GRCm38) V92L probably benign Het
Myot G T 18: 44,346,085 (GRCm38) M296I probably damaging Het
N4bp2l2 C A 5: 150,662,320 (GRCm38) R65L probably benign Het
Nab2 C A 10: 127,663,132 (GRCm38) E426* probably null Het
Nabp1 T A 1: 51,477,725 (GRCm38) probably benign Het
Nacad G T 11: 6,602,297 (GRCm38) S298Y probably damaging Het
Nagpa C G 16: 5,203,933 (GRCm38) G17A probably damaging Het
Naip2 A T 13: 100,161,909 (GRCm38) Y540N probably benign Het
Naip2 T G 13: 100,161,593 (GRCm38) E645A probably benign Het
Nanog G A 6: 122,713,231 (GRCm38) W198* probably null Het
Nars2 G T 7: 96,951,897 (GRCm38) D32Y probably benign Het
Nat2 A G 8: 67,501,264 (GRCm38) R9G probably damaging Het
Nat3 G T 8: 67,547,814 (GRCm38) S115I possibly damaging Het
Nat8f2 T C 6: 85,868,044 (GRCm38) E112G probably damaging Het
Nat8f5 T C 6: 85,817,685 (GRCm38) T98A probably benign Het
Nat8l C T 5: 33,996,811 (GRCm38) probably benign Het
Nav1 C A 1: 135,452,886 (GRCm38) V1432L unknown Het
Nav1 T A 1: 135,472,420 (GRCm38) S471C probably damaging Het
Nbas G T 12: 13,483,876 (GRCm38) Q1837H probably benign Het
Nbeal2 C A 9: 110,638,835 (GRCm38) M455I probably benign Het
Nbeal2 G C 9: 110,625,816 (GRCm38) Q2645E probably benign Het
Nbr1 G C 11: 101,572,554 (GRCm38) G616R probably benign Het
Ncdn C A 4: 126,750,153 (GRCm38) C292F probably benign Het
Ncdn C A 4: 126,750,151 (GRCm38) G293C probably damaging Het
Nckap1 A C 2: 80,540,508 (GRCm38) probably null Het
Nckap5 C T 1: 126,528,681 (GRCm38) probably null Het
Ncoa6 T A 2: 155,421,302 (GRCm38) Q404L probably damaging Het
Ncor1 C A 11: 62,438,516 (GRCm38) probably null Het
Ndc1 G C 4: 107,386,602 (GRCm38) A332P probably damaging Het
Ndfip2 G T 14: 105,258,709 (GRCm38) A13S probably benign Het
Ndn C A 7: 62,348,544 (GRCm38) P46Q probably benign Het
Ndst3 C A 3: 123,671,494 (GRCm38) L276F probably damaging Het
Ndst3 A C 3: 123,552,630 (GRCm38) F665C probably damaging Het
Ndst3 T G 3: 123,627,969 (GRCm38) K405T possibly damaging Het
Ndufa9 C A 6: 126,844,815 (GRCm38) G66C probably damaging Het
Ndufs1 C A 1: 63,163,836 (GRCm38) A190S probably damaging Het
Ndufs6 A G 13: 73,328,436 (GRCm38) V4A probably benign Het
Neb C G 2: 52,267,782 (GRCm38) W2271S probably benign Het
Neb C T 2: 52,279,631 (GRCm38) probably null Het
Nectin2 C A 7: 19,738,363 (GRCm38) V34L probably benign Het
Neil2 A C 14: 63,188,496 (GRCm38) F142V probably damaging Het
Nek11 G C 9: 105,293,669 (GRCm38) A389G probably benign Het
Nek2 G T 1: 191,827,239 (GRCm38) R285S probably benign Het
Nell1 C G 7: 50,560,882 (GRCm38) S377C unknown Het
Neu4 G T 1: 94,025,250 (GRCm38) G447V probably benign Het
Neurl1a C A 19: 47,239,873 (GRCm38) L53M probably damaging Het
Nfasc C A 1: 132,634,638 (GRCm38) R133L probably benign Het
Nfatc2 G A 2: 168,571,349 (GRCm38) Q139* probably null Het
Nfe2l2 T A 2: 75,679,164 (GRCm38) Q104L probably null Het
Nfkbil1 C A 17: 35,234,962 (GRCm38) Q109H probably benign Het
Nfkbil1 C A 17: 35,234,961 (GRCm38) G110C probably damaging Het
Nfxl1 T G 5: 72,538,150 (GRCm38) Q450H probably null Het
Nfyc C A 4: 120,790,487 (GRCm38) probably benign Het
Ngb C A 12: 87,098,429 (GRCm38) G151C probably damaging Het
Nhlrc4 C A 17: 25,943,744 (GRCm38) A10S possibly damaging Het
Nin T A 12: 70,049,164 (GRCm38) probably null Het
Nipbl G C 15: 8,338,699 (GRCm38) P1180A possibly damaging Het
Nipsnap3a G T 4: 52,997,216 (GRCm38) E161* probably null Het
Nkain2 C A 10: 32,402,271 (GRCm38) G53* probably null Het
Nkapl C G 13: 21,468,303 (GRCm38) G47R unknown Het
Nkx2-1 C A 12: 56,534,964 (GRCm38) G33C probably damaging Het
Nkx2-1 G T 12: 56,533,684 (GRCm38) P157H probably benign Het
Nle1 C A 11: 82,904,312 (GRCm38) D298Y probably damaging Het
Nlgn1 G T 3: 25,436,604 (GRCm38) L320I probably benign Het
Nlgn3 G T X: 101,317,982 (GRCm38) V300L probably benign Het
Nlgn3 T C X: 101,319,877 (GRCm38) L698P probably damaging Het
Nlk C G 11: 78,583,399 (GRCm38) G358A probably damaging Het
Nlrp12 T C 7: 3,222,537 (GRCm38) K1034R probably benign Het
Nlrp14 A G 7: 107,182,714 (GRCm38) T373A probably benign Het
Nlrp1b T G 11: 71,182,270 (GRCm38) K249T probably damaging Het
Nlrp6 T A 7: 140,922,721 (GRCm38) W247R probably damaging Het
Nlrp9a G T 7: 26,558,229 (GRCm38) W424L probably damaging Het
Nlrx1 A C 9: 44,256,923 (GRCm38) V559G possibly damaging Het
Nme9 G A 9: 99,470,795 (GRCm38) R266Q possibly damaging Het
Nmur2 T G 11: 56,027,101 (GRCm38) K354T probably benign Het
Nos3 C A 5: 24,377,654 (GRCm38) R627S probably benign Het
Notch3 A T 17: 32,151,370 (GRCm38) C739S probably damaging Het
Notch3 A T 17: 32,141,516 (GRCm38) F1480L probably benign Het
Nova2 G T 7: 18,958,449 (GRCm38) G501V unknown Het
Noxa1 T A 2: 25,090,273 (GRCm38) Q170L possibly damaging Het
Noxred1 A C 12: 87,223,057 (GRCm38) L300W probably damaging Het
Npas2 T A 1: 39,336,010 (GRCm38) S470T probably benign Het
Npas3 T C 12: 53,501,180 (GRCm38) L103P probably damaging Het
Npm1 C A 11: 33,160,831 (GRCm38) V117L probably benign Het
Npr2 A T 4: 43,650,720 (GRCm38) H1000L probably damaging Het
Nr1h4 G C 10: 89,498,350 (GRCm38) Y59* probably null Het
Nr2f2 C A 7: 70,357,778 (GRCm38) V319F probably damaging Het
Nr3c2 G A 8: 76,909,700 (GRCm38) V477M probably damaging Het
Nrap CTGTGTGT CTGTGT 19: 56,345,517 (GRCm38) probably null Het
Nrcam G T 12: 44,571,570 (GRCm38) R781L probably damaging Het
Nrg2 G T 18: 36,018,470 (GRCm38) P673H probably damaging Het
Nrg3 C G 14: 39,472,533 (GRCm38) V90L possibly damaging Het
Nrn1l G T 8: 105,894,416 (GRCm38) A47S probably damaging Het
Nrxn3 C A 12: 89,517,909 (GRCm38) A676E possibly damaging Het
Nrxn3 C A 12: 89,187,055 (GRCm38) S264* probably null Het
Nsd1 A T 13: 55,245,525 (GRCm38) Q416L probably damaging Het
Nsf C G 11: 103,910,554 (GRCm38) D212H probably damaging Het
Nsrp1 C A 11: 77,050,695 (GRCm38) Q62H probably damaging Het
Ntmt1 G C 2: 30,822,428 (GRCm38) G161A probably damaging Het
Ntn4 G C 10: 93,741,153 (GRCm38) R561P probably damaging Het
Ntrk2 A G 13: 58,874,333 (GRCm38) T401A probably benign Het
Nudt8 G T 19: 4,001,690 (GRCm38) R130S not run Het
Nufip2 G C 11: 77,741,791 (GRCm38) *711S probably null Het
Nup214 G T 2: 32,010,258 (GRCm38) R866S possibly damaging Het
Nup214 G T 2: 32,034,225 (GRCm38) E1589* probably null Het
Nwd1 T G 8: 72,672,300 (GRCm38) L696R not run Het
Nwd2 C A 5: 63,806,157 (GRCm38) T1028K probably damaging Het
Nwd2 A G 5: 63,725,197 (GRCm38) Y64C probably damaging Het
Oas1d T C 5: 120,914,914 (GRCm38) W11R probably benign Het
Obox2 C T 7: 15,397,196 (GRCm38) P76S possibly damaging Het
Obox3 C A 7: 15,626,224 (GRCm38) E173D probably benign Het
Obscn G T 11: 58,994,372 (GRCm38) A8020E unknown Het
Obscn A G 11: 59,082,823 (GRCm38) I1894T probably benign Het
Obscn G T 11: 59,040,347 (GRCm38) A5018E probably benign Het
Obscn G C 11: 59,136,286 (GRCm38) C30W probably benign Het
Obscn G T 11: 59,049,725 (GRCm38) N4614K probably benign Het
Obscn T G 11: 59,038,807 (GRCm38) D5194A probably damaging Het
Obscn A T 11: 58,995,530 (GRCm38) Y7835N unknown Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Olfm4 T G 14: 80,021,219 (GRCm38) D302E probably benign Het
Olfr1015 T C 2: 85,786,120 (GRCm38) V203A probably damaging Het
Olfr1018 G A 2: 85,823,021 (GRCm38) G17R probably damaging Het
Olfr1025-ps1 C A 2: 85,918,501 (GRCm38) T192N probably damaging Het
Olfr1048 C T 2: 86,236,458 (GRCm38) A119T probably damaging Het
Olfr1052 T C 2: 86,298,226 (GRCm38) S137P probably damaging Het
Olfr1054 A T 2: 86,332,706 (GRCm38) Y217N probably damaging Het
Olfr1055 G T 2: 86,346,883 (GRCm38) N294K possibly damaging Het
Olfr1057 G C 2: 86,375,115 (GRCm38) T99R possibly damaging Het
Olfr1061 T A 2: 86,413,528 (GRCm38) S175C probably damaging Het
Olfr1062 G C 2: 86,423,374 (GRCm38) L101V probably benign Het
Olfr109 T A 17: 37,466,661 (GRCm38) F152I possibly damaging Het
Olfr1095 T G 2: 86,850,940 (GRCm38) S253R Het
Olfr1102 T A 2: 87,002,610 (GRCm38) C214S probably benign Het
Olfr1102 G T 2: 87,002,611 (GRCm38) C214F probably benign Het
Olfr1105 G T 2: 87,033,487 (GRCm38) L245I probably damaging Het
Olfr1109 G T 2: 87,093,224 (GRCm38) P58T possibly damaging Het
Olfr1128 A C 2: 87,544,621 (GRCm38) L308V probably benign Het
Olfr1130 C T 2: 87,607,754 (GRCm38) A122V probably benign Het
Olfr1131 T A 2: 87,629,315 (GRCm38) L168Q probably damaging Het
Olfr1136 G T 2: 87,693,151 (GRCm38) H244N probably damaging Het
Olfr1155 T G 2: 87,943,467 (GRCm38) N54H probably damaging Het
Olfr1155 G T 2: 87,943,209 (GRCm38) Q140K possibly damaging Het
Olfr1160 A C 2: 88,006,437 (GRCm38) C105G probably damaging Het
Olfr1164 A T 2: 88,093,334 (GRCm38) C201S probably damaging Het
Olfr1168 T C 2: 88,185,071 (GRCm38) S65P probably damaging Het
Olfr1178 C A 2: 88,392,033 (GRCm38) T262K probably damaging Het
Olfr1179 G C 2: 88,402,122 (GRCm38) L271V probably damaging Het
Olfr1180 G T 2: 88,411,986 (GRCm38) P224H probably damaging Het
Olfr1183 C A 2: 88,462,114 (GRCm38) P277Q probably damaging Het
Olfr1199 T G 2: 88,755,797 (GRCm38) K293Q probably damaging Het
Olfr1205 T A 2: 88,831,578 (GRCm38) S154T probably damaging Het
Olfr1208 A T 2: 88,897,061 (GRCm38) F179I probably damaging Het
Olfr121 G T 17: 37,752,767 (GRCm38) K304N probably damaging Het
Olfr1217 A T 2: 89,023,795 (GRCm38) D69E possibly damaging Het
Olfr1217 T G 2: 89,023,896 (GRCm38) T36P probably damaging Het
Olfr1219 C A 2: 89,074,438 (GRCm38) G218C probably benign Het
Olfr1224-ps1 A G 2: 89,156,467 (GRCm38) L236P probably damaging Het
Olfr1229 TGGG TGGGG 2: 89,282,897 (GRCm38) probably null Het
Olfr1229 C A 2: 89,282,537 (GRCm38) V199F probably benign Het
Olfr1230 C T 2: 89,296,953 (GRCm38) G106S probably damaging Het
Olfr1262 T A 2: 90,003,048 (GRCm38) V214E probably damaging Het
Olfr1287 C A 2: 111,449,784 (GRCm38) L215M probably damaging Het
Olfr1290 A G 2: 111,489,877 (GRCm38) F94L probably damaging Het
Olfr1294 C A 2: 111,538,285 (GRCm38) M1I probably null Het
Olfr1297 A G 2: 111,621,261 (GRCm38) L271P probably damaging Het
Olfr1300-ps1 T A 2: 111,692,429 (GRCm38) F304I unknown Het
Olfr1303 C A 2: 111,814,034 (GRCm38) G231C probably benign Het
Olfr1309 A C 2: 111,983,753 (GRCm38) V107G probably benign Het
Olfr1310 T A 2: 112,008,457 (GRCm38) H243L probably damaging Het
Olfr1328 T G 4: 118,933,918 (GRCm38) H310P probably benign Het
Olfr1329 T G 4: 118,917,135 (GRCm38) T111P probably damaging Het
Olfr1329 C T 4: 118,917,027 (GRCm38) G147R probably benign Het
Olfr1333 G T 4: 118,830,050 (GRCm38) P129Q probably damaging Het
Olfr1340 A G 4: 118,727,141 (GRCm38) K298R probably damaging Het
Olfr1342 G T 4: 118,690,272 (GRCm38) T60K probably benign Het
Olfr1347 A T 7: 6,488,692 (GRCm38) C54S probably benign Het
Olfr1347 G T 7: 6,488,698 (GRCm38) L52I probably damaging Het
Olfr1350 C A 7: 6,570,048 (GRCm38) P19H probably damaging Het
Olfr1351 G C 10: 79,018,205 (GRCm38) R294S probably damaging Het
Olfr1356 T A 10: 78,847,021 (GRCm38) Q298L possibly damaging Het
Olfr1357 T G 10: 78,612,056 (GRCm38) N195T probably damaging Het
Olfr136 A C 17: 38,335,352 (GRCm38) N65T probably damaging Het
Olfr1369-ps1 A T 13: 21,116,601 (GRCm38) K303I probably damaging Het
Olfr1375 T G 11: 51,048,835 (GRCm38) C243G probably damaging Het
Olfr1382 C G 11: 49,535,253 (GRCm38) L23V probably damaging Het
Olfr1385 G C 11: 49,495,067 (GRCm38) C178S probably damaging Het
Olfr140 G T 2: 90,052,265 (GRCm38) Q20K probably benign Het
Olfr1410 G T 1: 92,607,751 (GRCm38) probably benign Het
Olfr1425 G T 19: 12,073,840 (GRCm38) P264H probably damaging Het
Olfr1425 G T 19: 12,073,910 (GRCm38) H241N probably damaging Het
Olfr143 G T 9: 38,253,852 (GRCm38) C142F probably benign Het
Olfr1437 T G 19: 12,322,267 (GRCm38) N187H possibly damaging Het
Olfr1442 C A 19: 12,674,310 (GRCm38) T35N probably benign Het
Olfr1454 A T 19: 13,063,646 (GRCm38) K78N probably benign Het
Olfr1467 G C 19: 13,364,916 (GRCm38) C96S probably damaging Het
Olfr1467 T G 19: 13,364,915 (GRCm38) C96G probably damaging Het
Olfr1487 T G 19: 13,619,662 (GRCm38) F124V probably damaging Het
Olfr1490 C A 19: 13,654,463 (GRCm38) H11Q probably benign Het
Olfr1491 C G 19: 13,705,203 (GRCm38) D125E probably damaging Het
Olfr1500 G T 19: 13,827,899 (GRCm38) L166I probably damaging Het
Olfr152 C A 2: 87,783,024 (GRCm38) H161Q probably damaging Het
Olfr159 A C 4: 43,770,267 (GRCm38) V248G probably damaging Het
Olfr161 T A 16: 3,592,540 (GRCm38) L48Q probably damaging Het
Olfr161 G A 16: 3,593,133 (GRCm38) A246T probably benign Het
Olfr165 T A 16: 19,407,735 (GRCm38) M94L probably benign Het
Olfr173 C A 16: 58,797,423 (GRCm38) C141F probably damaging Het
Olfr173 G C 16: 58,797,673 (GRCm38) P58A probably damaging Het
Olfr175-ps1 GT GTT 16: 58,824,307 (GRCm38) probably null Het
Olfr197 C A 16: 59,186,485 (GRCm38) probably benign Het
Olfr203 G T 16: 59,303,169 (GRCm38) R5S probably benign Het
Olfr211 T C 6: 116,494,376 (GRCm38) Y256H probably damaging Het
Olfr218 C A 1: 173,203,797 (GRCm38) S147Y probably benign Het
Olfr266 C G 3: 106,822,043 (GRCm38) C172S probably damaging Het
Olfr301 T G 7: 86,412,698 (GRCm38) F112C probably benign Het
Olfr310 G A 7: 86,268,947 (GRCm38) P281S probably damaging Het
Olfr354 C A 2: 36,907,701 (GRCm38) L252I possibly damaging Het
Olfr361 C G 2: 37,085,636 (GRCm38) M37I probably benign Het
Olfr362 G A 2: 37,105,636 (GRCm38) P5S probably benign Het
Olfr387-ps1 C A 11: 73,664,774 (GRCm38) T55K not run Het
Olfr397 TC T 11: 73,965,297 (GRCm38) probably null Het
Olfr404-ps1 T A 11: 74,239,747 (GRCm38) F61Y probably damaging Het
Olfr404-ps1 T G 11: 74,240,203 (GRCm38) L213R probably damaging Het
Olfr404-ps1 G A 11: 74,240,120 (GRCm38) M185I possibly damaging Het
Olfr414 C G 1: 174,430,591 (GRCm38) S54R probably benign Het
Olfr430 A T 1: 174,069,331 (GRCm38) E11V probably damaging Het
Olfr430 G T 1: 174,069,514 (GRCm38) W72L probably damaging Het
Olfr444 G C 6: 42,956,298 (GRCm38) E267Q probably benign Het
Olfr444 A C 6: 42,955,690 (GRCm38) H64P probably damaging Het
Olfr449 T C 6: 42,837,977 (GRCm38) L32P probably damaging Het
Olfr469 C T 7: 107,822,993 (GRCm38) A159T probably benign Het
Olfr472 T G 7: 107,903,058 (GRCm38) L114V probably damaging Het
Olfr478 T C 7: 108,031,446 (GRCm38) E299G probably damaging Het
Olfr482 C A 7: 108,094,994 (GRCm38) C192F probably damaging Het
Olfr484 G T 7: 108,124,879 (GRCm38) A128E probably damaging Het
Olfr498 T A 7: 108,465,371 (GRCm38) F16I probably benign Het
Olfr509 T A 7: 108,645,767 (GRCm38) T270S possibly damaging Het
Olfr560 C G 7: 102,753,416 (GRCm38) C171S possibly damaging Het
Olfr560 T A 7: 102,753,414 (GRCm38) S172C probably benign Het
Olfr577 C T 7: 102,973,309 (GRCm38) V228I not run Het
Olfr62 A C 4: 118,665,826 (GRCm38) Q103P probably damaging Het
Olfr625-ps1 A T 7: 103,683,105 (GRCm38) Y129F probably benign Het
Olfr628 T C 7: 103,732,781 (GRCm38) L285P probably damaging Het
Olfr631 G A 7: 103,929,777 (GRCm38) W318* probably null Het
Olfr642 T A 7: 104,050,273 (GRCm38) H27L probably benign Het
Olfr67 C A 7: 103,787,453 (GRCm38) V275F probably benign Het
Olfr675 G T 7: 105,024,099 (GRCm38) P294T probably damaging Het
Olfr681 C A 7: 105,122,120 (GRCm38) S221Y probably damaging Het
Olfr681 T A 7: 105,122,122 (GRCm38) Y222N probably damaging Het
Olfr688 T A 7: 105,288,722 (GRCm38) W210R probably damaging Het
Olfr716 G T 7: 107,148,155 (GRCm38) V280L probably benign Het
Olfr721-ps1 G T 14: 14,407,732 (GRCm38) C168F probably damaging Het
Olfr742 C G 14: 50,516,065 (GRCm38) P287R probably damaging Het
Olfr780 G A 10: 129,322,219 (GRCm38) G199S probably benign Het
Olfr788 T A 10: 129,473,615 (GRCm38) S308T probably benign Het
Olfr794 G T 10: 129,571,236 (GRCm38) E194* probably null Het
Olfr796 G T 10: 129,608,103 (GRCm38) A126D probably damaging Het
Olfr8 A T 10: 78,955,219 (GRCm38) N5Y probably damaging Het
Olfr807 C A 10: 129,754,824 (GRCm38) A209S possibly damaging Het
Olfr807 A G 10: 129,754,688 (GRCm38) F254S probably damaging Het
Olfr809 A T 10: 129,776,042 (GRCm38) I43F probably damaging Het
Olfr822 G T 10: 130,075,104 (GRCm38) Q231H probably benign Het
Olfr826 A C 10: 130,179,965 (GRCm38) L305R possibly damaging Het
Olfr828 AGG AG 9: 18,815,980 (GRCm38) probably null Het
Olfr854 T A 9: 19,566,526 (GRCm38) Q286L probably damaging Het
Olfr871 G T 9: 20,212,844 (GRCm38) R165L possibly damaging Het
Olfr890 G A 9: 38,143,431 (GRCm38) A94T probably benign Het
Olfr912 G T 9: 38,581,885 (GRCm38) G203W probably damaging Het
Olfr919 C T 9: 38,697,928 (GRCm38) G146D possibly damaging Het
Olfr936 T G 9: 39,046,919 (GRCm38) T167P probably damaging Het
Olfr969 C A 9: 39,795,929 (GRCm38) L185M possibly damaging Het
Olfr970 A T 9: 39,820,355 (GRCm38) S239C probably damaging Het
Olfr987 C T 2: 85,331,893 (GRCm38) E2K probably benign Het
Olfr99 A T 17: 37,279,674 (GRCm38) Y249N probably damaging Het
Olfr993 G C 2: 85,414,685 (GRCm38) H65D possibly damaging Het
Olfr993 C G 2: 85,414,663 (GRCm38) C72S probably damaging Het
Omt2b T A 9: 78,329,330 (GRCm38) W113R probably damaging Het
Oog1 G C 12: 87,608,364 (GRCm38) E427D probably damaging Het
Opn1sw C G 6: 29,379,456 (GRCm38) G183A probably damaging Het
Oprk1 G A 1: 5,602,702 (GRCm38) R354H probably benign Het
Osbpl7 G A 11: 97,060,153 (GRCm38) G609S probably damaging Het
Otof G T 5: 30,371,586 (GRCm38) A1826E probably damaging Het
Otogl G T 10: 107,789,032 (GRCm38) H1582N probably benign Het
Otogl C T 10: 107,777,213 (GRCm38) R2046H probably benign Het
Otogl A T 10: 107,778,873 (GRCm38) C1973S probably damaging Het
Otop3 C G 11: 115,341,012 (GRCm38) H234Q probably damaging Het
Otop3 T A 11: 115,339,844 (GRCm38) L147Q probably damaging Het
Otud4 C T 8: 79,658,929 (GRCm38) T217I probably benign Het
Otud6a C A X: 100,429,391 (GRCm38) R127S possibly damaging Het
Otud7a G T 7: 63,758,700 (GRCm38) R917L unknown Het
Oxct2a G T 4: 123,322,538 (GRCm38) P350Q probably damaging Het
Oxtr T A 6: 112,489,695 (GRCm38) N35Y probably damaging Het
P2rx6 G C 16: 17,568,055 (GRCm38) D223H probably damaging Het
P2ry14 A C 3: 59,115,737 (GRCm38) F101V probably damaging Het
P2ry4 G A X: 100,593,321 (GRCm38) R324C probably benign Het
Pabpc4 G A 4: 123,295,274 (GRCm38) G469D probably benign Het
Padi3 A G 4: 140,798,123 (GRCm38) L193P not run Het
Padi3 G T 4: 140,795,671 (GRCm38) A330E possibly damaging Het
Pafah1b1 T G 11: 74,690,241 (GRCm38) K54T probably damaging Het
Pafah1b1 C A 11: 74,689,119 (GRCm38) G86V probably benign Het
Pak7 A C 2: 136,083,246 (GRCm38) L712R probably damaging Het
Pam C A 1: 97,934,723 (GRCm38) R99L probably benign Het
Pam16 C A 16: 4,624,906 (GRCm38) probably benign Het
Pappa2 A C 1: 158,956,933 (GRCm38) I169S probably benign Het
Pappa2 A T 1: 158,814,816 (GRCm38) D1286E probably damaging Het
Pappa2 C G 1: 158,814,814 (GRCm38) G1287A probably damaging Het
Paqr8 G T 1: 20,934,798 (GRCm38) G59W probably damaging Het
Paqr9 G C 9: 95,560,306 (GRCm38) W116C possibly damaging Het
Pard3b G T 1: 62,238,892 (GRCm38) V694L probably benign Het
Patj C T 4: 98,611,130 (GRCm38) S1347L probably benign Het
Patj A T 4: 98,676,318 (GRCm38) K1636* probably null Het
Pax3 C A 1: 78,122,590 (GRCm38) probably null Het
Pax5 C A 4: 44,697,678 (GRCm38) G19V probably damaging Het
Paxip1 C T 5: 27,783,729 (GRCm38) probably null Het
Pcdh1 C A 18: 38,198,688 (GRCm38) V560L possibly damaging Het
Pcdh15 G A 10: 74,630,701 (GRCm38) D1517N probably benign Het
Pcdh19 C T X: 133,682,092 (GRCm38) R763K probably null Het
Pcdh8 G A 14: 79,769,077 (GRCm38) P682L probably benign Het
Pcdha7 G C 18: 36,975,840 (GRCm38) E639D probably benign Het
Pcdhb10 AC A 18: 37,413,395 (GRCm38) probably null Het
Pcdhb13 C A 18: 37,443,235 (GRCm38) S222* probably null Het
Pcdhb16 C A 18: 37,479,160 (GRCm38) P391H probably damaging Het
Pcdhgb1 A T 18: 37,681,840 (GRCm38) Q461H probably benign Het
Pcgf2 T G 11: 97,690,021 (GRCm38) K332T probably damaging Het
Pck2 G T 14: 55,545,269 (GRCm38) A387S probably benign Het
Pclo G C 5: 14,681,779 (GRCm38) E306Q Het
Pclo C A 5: 14,712,648 (GRCm38) Q427K probably damaging Het
Pclo C A 5: 14,681,516 (GRCm38) S218Y possibly damaging Het
Pcna-ps2 G T 19: 9,284,112 (GRCm38) G245V probably damaging Het
Pcnt C A 10: 76,382,157 (GRCm38) E2095* probably null Het
Pcnx2 A C 8: 125,838,014 (GRCm38) L1047V probably benign Het
Pcnx2 G A 8: 125,761,654 (GRCm38) P1717L probably damaging Het
Pcnx3 T A 19: 5,687,220 (GRCm38) probably null Het
Pcolce2 G C 9: 95,637,836 (GRCm38) A15P possibly damaging Het
Pcsk1 A T 13: 75,098,042 (GRCm38) N180Y probably damaging Het
Pcsk4 G T 10: 80,322,726 (GRCm38) T564K possibly damaging Het
Pcsk9 G T 4: 106,458,941 (GRCm38) Q102K probably damaging Het
Pcx G T 19: 4,619,073 (GRCm38) V701L possibly damaging Het
Pcyt2 C G 11: 120,614,373 (GRCm38) G122A probably damaging Het
Pde11a C T 2: 76,194,905 (GRCm38) A451T probably benign Het
Pde1a G T 2: 79,906,028 (GRCm38) S87R probably damaging Het
Pde6c G T 19: 38,132,881 (GRCm38) probably benign Het
Pdk2 A C 11: 95,027,918 (GRCm38) L344V probably damaging Het
Pdk4 G T 6: 5,487,170 (GRCm38) S292Y probably damaging Het
Pds5a G C 5: 65,659,727 (GRCm38) S177R possibly damaging Het
Pdxdc1 C A 16: 13,903,043 (GRCm38) probably benign Het
Pdxk T G 10: 78,441,188 (GRCm38) T259P probably damaging Het
Pdzk1 A G 3: 96,854,557 (GRCm38) N162D probably benign Het
Pdzrn3 T A 6: 101,151,999 (GRCm38) S569C probably damaging Het
Pdzrn4 G A 15: 92,396,957 (GRCm38) A15T probably benign Het
Peg10 T TCCC 6: 4,756,451 (GRCm38) probably benign Het
Peli3 C A 19: 4,934,967 (GRCm38) R172L probably benign Het
Penk G T 4: 4,138,106 (GRCm38) A13E probably damaging Het
Per2 T A 1: 91,421,493 (GRCm38) N1052I possibly damaging Het
Pfas T C 11: 68,990,070 (GRCm38) M198V Het
Pfas C T 11: 69,002,487 (GRCm38) G91R probably damaging Het
Pfkl C A 10: 78,000,136 (GRCm38) G213W probably damaging Het
Pfpl G T 19: 12,429,941 (GRCm38) E519* probably null Het
Pga5 T C 19: 10,669,159 (GRCm38) T372A probably damaging Het
Pgc C G 17: 47,728,868 (GRCm38) Y62* probably null Het
Pgd C A 4: 149,166,679 (GRCm38) probably benign Het
Pglyrp3 A T 3: 92,028,085 (GRCm38) H214L probably damaging Het
Pglyrp4 A G 3: 90,739,005 (GRCm38) Q282R probably damaging Het
Pgm2 C T 4: 99,978,997 (GRCm38) T444I probably damaging Het
Pgm2l1 G T 7: 100,270,455 (GRCm38) G586V possibly damaging Het
Phactr3 C A 2: 178,269,374 (GRCm38) P139Q probably damaging Het
Phax G T 18: 56,586,952 (GRCm38) G322W probably damaging Het
Phc3 C G 3: 30,936,597 (GRCm38) M478I probably benign Het
Phf2 T A 13: 48,807,707 (GRCm38) T836S unknown Het
Phldb2 C A 16: 45,825,827 (GRCm38) L85F probably benign Het
Phldb2 C A 16: 45,825,826 (GRCm38) A86S probably benign Het
Phldb2 T A 16: 45,953,508 (GRCm38) probably benign Het
Phrf1 G T 7: 141,258,818 (GRCm38) R642L unknown Het
Phrf1 G C 7: 141,243,883 (GRCm38) G46R unknown Het
Picalm A T 7: 90,196,967 (GRCm38) S639C probably damaging Het
Pidd1 T A 7: 141,440,361 (GRCm38) S551C probably benign Het
Pigb C G 9: 73,034,572 (GRCm38) G135A probably benign Het
Pigr A C 1: 130,850,815 (GRCm38) E745D possibly damaging Het
Pigx T G 16: 32,087,425 (GRCm38) Q130P probably benign Het
Pik3c2b C A 1: 133,066,553 (GRCm38) S85Y probably damaging Het
Pik3c2b G T 1: 133,099,686 (GRCm38) E1308* probably null Het
Pik3cd TG T 4: 149,654,847 (GRCm38) probably null Het
Pik3cg T C 12: 32,204,795 (GRCm38) R398G probably damaging Het
Pik3r6 G T 11: 68,544,765 (GRCm38) A614S probably benign Het
Pik3r6 G A 11: 68,520,200 (GRCm38) probably benign Het
Pja2 C A 17: 64,292,869 (GRCm38) S540I probably damaging Het
Pkd1l1 C A 11: 8,826,801 (GRCm38) G2513C Het
Pkd1l2 G C 8: 117,054,914 (GRCm38) C797W probably damaging Het
Pkd1l3 C A 8: 109,623,242 (GRCm38) P240T unknown Het
Pkd2 G A 5: 104,460,049 (GRCm38) G138E probably benign Het
Pkd2l1 G T 19: 44,149,271 (GRCm38) T708K probably benign Het
Pkhd1 A C 1: 20,523,747 (GRCm38) F1381V possibly damaging Het
Pklr C G 3: 89,144,855 (GRCm38) P489R probably damaging Het
Pkn1 C T 8: 83,673,497 (GRCm38) R632Q probably damaging Het
Pkp2 T C 16: 16,230,700 (GRCm38) V323A probably benign Het
Pkp4 G C 2: 59,342,244 (GRCm38) probably null Het
Pla2g7 C G 17: 43,602,919 (GRCm38) A251G probably benign Het
Plagl1 A G 10: 13,128,716 (GRCm38) Q576R unknown Het
Plau A C 14: 20,839,481 (GRCm38) S205R probably damaging Het
Plcb2 T A 2: 118,723,128 (GRCm38) K171N probably damaging Het
Plcd4 T A 1: 74,548,126 (GRCm38) L15Q probably benign Het
Plcd4 C A 1: 74,557,792 (GRCm38) H398N probably damaging Het
Plce1 C T 19: 38,701,894 (GRCm38) A674V probably damaging Het
Plce1 G T 19: 38,724,980 (GRCm38) E1231* probably null Het
Plce1 A G 19: 38,769,460 (GRCm38) H1959R probably damaging Het
Plcg1 A T 2: 160,758,127 (GRCm38) R936W probably damaging Het
Plcl1 C T 1: 55,751,284 (GRCm38) Q1038* probably null Het
Plcl1 G A 1: 55,696,040 (GRCm38) G180D probably benign Het
Plcl2 T G 17: 50,608,456 (GRCm38) V831G probably damaging Het
Plcz1 C G 6: 140,013,676 (GRCm38) V252L possibly damaging Het
Pld1 A T 3: 28,131,577 (GRCm38) K984* probably null Het
Pld1 T C 3: 28,076,533 (GRCm38) L494P probably damaging Het
Pld6 G C 11: 59,787,438 (GRCm38) C66W probably damaging Het
Plekha6 G T 1: 133,272,471 (GRCm38) G263W probably damaging Het
Plekha6 G T 1: 133,263,813 (GRCm38) R40L probably benign Het
Plekhg3 G T 12: 76,575,856 (GRCm38) probably null Het
Plekhn1 C G 4: 156,223,431 (GRCm38) G346A possibly damaging Het
Plekho1 C G 3: 95,995,715 (GRCm38) G3A unknown Het
Plg A C 17: 12,414,185 (GRCm38) T678P probably benign Het
Plk1 C T 7: 122,167,650 (GRCm38) R364W not run Het
Plod1 C A 4: 147,923,200 (GRCm38) G342C probably damaging Het
Plppr4 T C 3: 117,322,849 (GRCm38) K453R probably damaging Het
Plxdc2 G A 2: 16,565,403 (GRCm38) G180E possibly damaging Het
Plxna1 C A 6: 89,321,052 (GRCm38) W1748L probably damaging Het
Plxna3 G T X: 74,336,020 (GRCm38) W788C probably damaging Het
Plxnb3 T A X: 73,759,165 (GRCm38) V213E probably damaging Het
Plxnc1 G T 10: 94,865,029 (GRCm38) P598T probably benign Het
Pm20d1 G T 1: 131,797,558 (GRCm38) E47D possibly damaging Het
Pmch T C 10: 88,091,833 (GRCm38) I132T not run Het
Pmfbp1 T A 8: 109,531,751 (GRCm38) L649Q probably damaging Het
Pnisr C G 4: 21,873,684 (GRCm38) R476G probably benign Het
Pnmal2 C A 7: 16,946,810 (GRCm38) A573D possibly damaging Het
Pnpla8 CAGA CA 12: 44,295,990 (GRCm38) probably null Het
Pnpt1 G A 11: 29,145,477 (GRCm38) D409N possibly damaging Het
Pnpt1 C T 11: 29,145,475 (GRCm38) S408L probably benign Het
Poc5 G T 13: 96,401,722 (GRCm38) Q298H probably benign Het
Podxl T A 6: 31,528,634 (GRCm38) K158M probably damaging Het
Pola1 T G X: 93,480,604 (GRCm38) T1144P probably damaging Het
Pold1 G A 7: 44,542,232 (GRCm38) P110L probably benign Het
Pold1 C A 7: 44,541,780 (GRCm38) R209L probably benign Het
Pold4 G T 19: 4,232,172 (GRCm38) E27D probably benign Het
Polg G T 7: 79,453,741 (GRCm38) A960D probably damaging Het
Polg2 C A 11: 106,773,429 (GRCm38) V357F probably damaging Het
Polq G T 16: 37,042,257 (GRCm38) probably null Het
Polr2b A C 5: 77,331,971 (GRCm38) K524Q probably damaging Het
Pom121l12 C A 11: 14,599,639 (GRCm38) A115E probably damaging Het
Pom121l12 C A 11: 14,599,681 (GRCm38) T129K probably damaging Het
Pop7 C A 5: 137,502,187 (GRCm38) probably benign Het
Poteg G T 8: 27,447,954 (GRCm38) R46I possibly damaging Het
Pou5f2 G C 13: 78,025,097 (GRCm38) V53L probably benign Het
Pou6f2 T C 13: 18,378,635 (GRCm38) Q38R unknown Het
Ppfia2 A T 10: 106,474,645 (GRCm38) E4D probably damaging Het
Ppfia4 C A 1: 134,327,379 (GRCm38) R246L probably benign Het
Ppia G T 11: 6,419,600 (GRCm38) G162V possibly damaging Het
Ppip5k1 A C 2: 121,337,866 (GRCm38) L685R probably damaging Het
Ppl A T 16: 5,106,778 (GRCm38) L141Q probably damaging Het
Ppm1b G T 17: 84,994,265 (GRCm38)