Incidental Mutation 'R0650:Snrnp40'
ID62196
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Namesmall nuclear ribonucleoprotein 40 (U5)
Synonyms0610009C03Rik, Wdr57
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0650 (G1)
Quality Score109
Status Validated
Chromosome4
Chromosomal Location130360132-130390026 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 130378043 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
Predicted Effect probably null
Transcript: ENSMUST00000105994
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGTCCTCTTTCTTGAACAACCAG -3'
(R):5'- GCATTAAGTGCCAACCTCCTGCAATC -3'

Sequencing Primer
(F):5'- GAAACCAGAAGAGGGAGTCAG -3'
(R):5'- TCCTGCAATCTCAACATTTAAAAAAG -3'
Posted On2013-07-30