Mutagenetix > Incidental Mutation

Incidental Mutation 'R0650:Lrrk1'

62207

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

038835-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0650 (G1)

Quality Score

108

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66292336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 718 (A718V)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: A718V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: A718V

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Meta Mutation Damage Score

0.8608

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
Atg16l1	A	T	1: 87,781,699	D403V	possibly damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Chd8	T	C	14: 52,202,304	E964G	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lamc2	T	A	1: 153,143,876	I440F	possibly damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pik3c2a	A	G	7: 116,346,247		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr5	T	C	15: 38,030,807		probably benign	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGAGCCCTTCAACAAGAAGAGTGTC -3'
(R):5'- ACAGGCCATGATCTCCTCAGAGAC -3'

Sequencing Primer
(F):5'- CCTTCAACAAGAAGAGTGTCTTTTCC -3'
(R):5'- TTCCTAAGACACACTGGAGTCTG -3'

Posted On

2013-07-30