Incidental Mutation 'R0650:Olfr494'
ID62211
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0650 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108367789 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect probably damaging
Transcript: ENSMUST00000073059
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: C100S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209743
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210291
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7463 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
R8237:Olfr494 UTSW 7 108368027 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCCTTAATCTAGCAGCAGC -3'
(R):5'- TCCCACGACTAACTGGATACAGGAC -3'

Sequencing Primer
(F):5'- GATGGCCCAATCCTCAGAGTC -3'
(R):5'- TGGCAGCCAGAAGAAAGCAT -3'
Posted On2013-07-30