Incidental Mutation 'R0650:Olfr502'
ID 62212
Institutional Source Beutler Lab
Gene Symbol Olfr502
Ensembl Gene ENSMUSG00000058014
Gene Name olfactory receptor 502
Synonyms GA_x6K02T2PBJ9-10853935-10852991, MOR204-8
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R0650 (G1)
Quality Score 155
Status Validated
Chromosome 7
Chromosomal Location 108520825-108525065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108523082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 289 (N289K)
Ref Sequence ENSEMBL: ENSMUSP00000151167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078933] [ENSMUST00000216919]
AlphaFold Q8VG09
Predicted Effect probably damaging
Transcript: ENSMUST00000078933
AA Change: N289K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077963
Gene: ENSMUSG00000058014
AA Change: N289K

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.8e-55 PFAM
Pfam:7tm_1 44 293 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208361
Predicted Effect probably damaging
Transcript: ENSMUST00000216919
AA Change: N289K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5509 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Olfr502
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr502 APN 7 108523285 missense probably benign 0.00
R0007:Olfr502 UTSW 7 108523213 missense probably damaging 1.00
R1448:Olfr502 UTSW 7 108523318 missense probably benign
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R1701:Olfr502 UTSW 7 108523524 missense probably benign 0.01
R3736:Olfr502 UTSW 7 108523419 missense possibly damaging 0.79
R5030:Olfr502 UTSW 7 108523177 missense possibly damaging 0.66
R5315:Olfr502 UTSW 7 108523890 missense probably damaging 1.00
R6052:Olfr502 UTSW 7 108523738 missense probably benign 0.34
R6548:Olfr502 UTSW 7 108523216 missense probably benign 0.00
R6866:Olfr502 UTSW 7 108523170 missense probably damaging 0.96
R6946:Olfr502 UTSW 7 108523321 missense probably benign 0.02
R7582:Olfr502 UTSW 7 108523851 missense probably benign 0.00
R8771:Olfr502 UTSW 7 108523425 missense possibly damaging 0.62
R8824:Olfr502 UTSW 7 108523143 missense probably benign 0.28
R8854:Olfr502 UTSW 7 108523729 missense probably benign 0.00
R9398:Olfr502 UTSW 7 108523828 missense probably damaging 0.98
Z1088:Olfr502 UTSW 7 108523398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTGTCACATGCTAACACTGTCATC -3'
(R):5'- CTTGTGTTTTGTGGACCAAACAGAGTC -3'

Sequencing Primer
(F):5'- GTCATCAATCCTTTTTAGTCAGAACC -3'
(R):5'- TTATCACCATCCTGAAGATGCG -3'
Posted On 2013-07-30