Mutagenetix > Incidental Mutation

Incidental Mutation 'R0650:Pik3c2a'

62213

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

038835-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0650 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 116346247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000170430

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206248

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
Atg16l1	A	T	1: 87,781,699	D403V	possibly damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Chd8	T	C	14: 52,202,304	E964G	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lamc2	T	A	1: 153,143,876	I440F	possibly damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Lrrk1	G	A	7: 66,292,336	A718V	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr5	T	C	15: 38,030,807		probably benign	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGAGCAAGcagaggtcctaaa -3'
(R):5'- TCAGAATGCAGTGATGTGTACTGTAAATACAA -3'

Sequencing Primer
(F):5'- tcctaaattcaattcccaacaacc -3'
(R):5'- GACTATACAGAGAAACCCTGTCTCG -3'

Posted On

2013-07-30