Incidental Mutation 'R0650:Pidd1'
ID62215
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Namep53 induced death domain protein 1
Synonyms1200011D09Rik, Lrdd, Pidd
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0650 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141438113-141444025 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 141440813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 457 (L457*)
Ref Sequence ENSEMBL: ENSMUSP00000101627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000190068] [ENSMUST00000201822] [ENSMUST00000190882] [ENSMUST00000201710] [ENSMUST00000172654]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026580
AA Change: L457*
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: L457*

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106005
AA Change: L457*
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: L457*

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141439163 missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141443108 missense probably benign 0.00
IGL03083:Pidd1 APN 7 141440456 critical splice donor site probably null
IGL03347:Pidd1 APN 7 141439168 missense probably damaging 0.97
R0329:Pidd1 UTSW 7 141439561 unclassified probably benign
R0426:Pidd1 UTSW 7 141439133 missense probably damaging 1.00
R0651:Pidd1 UTSW 7 141440813 nonsense probably null
R1201:Pidd1 UTSW 7 141440274 missense probably benign
R1221:Pidd1 UTSW 7 141438812 missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141440777 missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141439630 missense probably benign
R3967:Pidd1 UTSW 7 141439082 missense possibly damaging 0.86
R4072:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4073:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4075:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141441366 missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141441443 unclassified probably benign
R4700:Pidd1 UTSW 7 141442249 missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141442986 missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141438591 makesense probably null
R5402:Pidd1 UTSW 7 141438594 missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141441111 splice site probably null
R5790:Pidd1 UTSW 7 141441392 unclassified probably benign
R5909:Pidd1 UTSW 7 141441270 missense probably damaging 1.00
R6275:Pidd1 UTSW 7 141439795 missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141439581 missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6872:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6935:Pidd1 UTSW 7 141440302 missense probably damaging 1.00
R7088:Pidd1 UTSW 7 141440487 missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141439900 missense probably benign 0.05
R7544:Pidd1 UTSW 7 141440339 missense possibly damaging 0.81
R7821:Pidd1 UTSW 7 141442280 missense probably benign 0.36
R7861:Pidd1 UTSW 7 141440142 missense probably damaging 1.00
R7903:Pidd1 UTSW 7 141439831 missense probably damaging 0.99
R8218:Pidd1 UTSW 7 141439653 missense probably damaging 1.00
Z1176:Pidd1 UTSW 7 141440361 missense probably benign 0.03
Z1177:Pidd1 UTSW 7 141438696 missense probably damaging 1.00
Z1177:Pidd1 UTSW 7 141441016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGAACCATTTCAGTGCCCTCC -3'
(R):5'- TGGCTTTCCAGCAAGTATGTCCAG -3'

Sequencing Primer
(F):5'- TCCTGTCTGCTGAGGCAC -3'
(R):5'- ACACTATTGTGGCCTACAGG -3'
Posted On2013-07-30