Incidental Mutation 'Z1176:Exoc3l'
ID 622176
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Name exocyst complex component 3-like
Synonyms C730015A04Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # Z1176 ()
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 106016556-106022733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 106017426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 546 (S546Y)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
AlphaFold Q8BI71
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000057855
AA Change: S546Y

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: S546Y

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 3316 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A C 6: 83,138,097 (GRCm39) K74N probably damaging Het
1700013G24Rik C A 4: 137,182,303 (GRCm39) P153T probably damaging Het
1700017N19Rik T G 10: 100,448,291 (GRCm39) M274R probably damaging Het
1700030J22Rik G T 8: 117,700,336 (GRCm39) T22K probably benign Het
1700123K08Rik G T 5: 138,561,815 (GRCm39) Q124K probably damaging Het
2610021A01Rik G C 7: 41,274,766 (GRCm39) L156F probably benign Het
2610028H24Rik C A 10: 76,288,697 (GRCm39) P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 (GRCm38) E10G probably damaging Het
3100002H09Rik T A 4: 124,504,498 (GRCm39) D18V unknown Het
3110018I06Rik C G 12: 107,455,114 (GRCm39) R67G unknown Het
3110082J24Rik G C 5: 30,310,065 (GRCm39) A98G unknown Het
4833420G17Rik C A 13: 119,614,344 (GRCm39) T484K not run Het
4921511C20Rik A G X: 126,302,465 (GRCm39) K135E probably damaging Het
4930447C04Rik G C 12: 72,963,500 (GRCm39) F18L probably benign Het
4930503B20Rik C T 3: 146,356,711 (GRCm39) D66N probably damaging Het
4930516K23Rik A T 7: 103,708,495 (GRCm39) F105I probably damaging Het
4930562C15Rik G A 16: 4,684,112 (GRCm39) V236M possibly damaging Het
4930595M18Rik C T X: 80,463,878 (GRCm39) G610R probably damaging Het
4933402D24Rik T A 1: 63,795,494 (GRCm39) K90* probably null Het
4933402J07Rik G T 8: 88,295,202 (GRCm39) M113I probably benign Het
4933427D14Rik C T 11: 72,049,826 (GRCm39) V852I probably benign Het
4933427I04Rik T C 4: 123,754,668 (GRCm39) L194P probably damaging Het
6430571L13Rik G T 9: 107,219,726 (GRCm39) G60C probably damaging Het
9430015G10Rik G C 4: 156,206,468 (GRCm39) G76A probably benign Het
A1cf A C 19: 31,895,417 (GRCm39) I167L probably benign Het
A2ml1 A G 6: 128,548,940 (GRCm39) F281L probably benign Het
A430005L14Rik CG C 4: 154,045,122 (GRCm39) probably null Het
A730049H05Rik C A 6: 92,805,047 (GRCm39) S69* probably null Het
A830018L16Rik C G 1: 11,588,849 (GRCm39) Q89E probably damaging Het
AA986860 A C 1: 130,670,728 (GRCm39) S317R probably benign Het
Aadacl2fm2 C A 3: 59,654,615 (GRCm39) Q150K probably benign Het
AAdacl4fm3 C A 4: 144,429,895 (GRCm39) G365W probably damaging Het
Aasdh C G 5: 77,039,643 (GRCm39) probably null Het
Aass T C 6: 23,078,856 (GRCm39) T719A probably damaging Het
Aatf C T 11: 84,333,411 (GRCm39) A500T probably benign Het
Abca12 A C 1: 71,323,229 (GRCm39) Y1618D probably damaging Het
Abca13 C A 11: 9,217,461 (GRCm39) P301H probably damaging Het
Abca13 G T 11: 9,244,342 (GRCm39) W2068C probably benign Het
Abca13 G T 11: 9,285,181 (GRCm39) A3272S probably damaging Het
Abca13 C A 11: 9,285,182 (GRCm39) A3272E probably damaging Het
Abca13 G T 11: 9,201,376 (GRCm39) G153C possibly damaging Het
Abca14 G T 7: 119,846,146 (GRCm39) G599V probably damaging Het
Abca15 T G 7: 119,945,249 (GRCm39) F442V probably benign Het
Abca15 G T 7: 119,981,728 (GRCm39) G1061W probably damaging Het
Abca2 G T 2: 25,334,122 (GRCm39) V1800L probably benign Het
Abca4 G T 3: 121,897,137 (GRCm39) W605C probably damaging Het
Abca4 C A 3: 121,950,092 (GRCm39) S1805R probably damaging Het
Abca7 C T 10: 79,835,266 (GRCm39) R208* probably null Het
Abca7 T C 10: 79,842,393 (GRCm39) L1109P probably damaging Het
Abca8b A T 11: 109,852,734 (GRCm39) C761S possibly damaging Het
Abca8b G A 11: 109,865,470 (GRCm39) T329I possibly damaging Het
Abca9 G A 11: 110,026,201 (GRCm39) A953V probably benign Het
Abcb10 C A 8: 124,709,402 (GRCm39) G51C possibly damaging Het
Abcb11 C A 2: 69,122,325 (GRCm39) G386V probably damaging Het
Abcb1b A G 5: 8,877,441 (GRCm39) Y667C probably benign Het
Abcb4 C A 5: 9,009,005 (GRCm39) R1221S probably damaging Het
Abcb5 C A 12: 118,882,007 (GRCm39) G574V probably damaging Het
Abcb8 A T 5: 24,605,993 (GRCm39) D226V probably damaging Het
Abcc10 C T 17: 46,635,188 (GRCm39) A272T probably benign Het
Abcc10 G A 17: 46,624,626 (GRCm39) H784Y probably damaging Het
Abcc12 T G 8: 87,277,230 (GRCm39) K389T probably damaging Het
Abcc3 C G 11: 94,252,101 (GRCm39) Q827H probably benign Het
Abcc6 C T 7: 45,629,158 (GRCm39) D1363N probably damaging Het
Abcc6 A T 7: 45,641,730 (GRCm39) probably null Het
Abcc8 T C 7: 45,756,389 (GRCm39) S1439G possibly damaging Het
Abhd12b G A 12: 70,210,225 (GRCm39) D134N probably damaging Het
Abhd13 A C 8: 10,037,413 (GRCm39) K3N probably damaging Het
Abl1 A C 2: 31,579,839 (GRCm39) K7N probably damaging Het
Ablim2 C T 5: 36,006,202 (GRCm39) P409L possibly damaging Het
Abo C G 2: 26,738,270 (GRCm39) V45L probably benign Het
Abtb2 G T 2: 103,538,517 (GRCm39) E649* probably null Het
Acaca G C 11: 84,151,546 (GRCm39) A815P probably damaging Het
Acacb G T 5: 114,387,009 (GRCm39) R2386L probably benign Het
Acan A C 7: 78,761,102 (GRCm39) H1938P probably benign Het
Acap3 C G 4: 155,989,636 (GRCm39) N693K probably damaging Het
Acmsd G T 1: 127,673,539 (GRCm39) V76F probably damaging Het
Actc1 C A 2: 113,882,478 (GRCm39) C12F probably benign Het
Actl11 T G 9: 107,808,899 (GRCm39) V1074G probably benign Het
Actl6a A C 3: 32,780,692 (GRCm39) I411L probably benign Het
Actl9 C A 17: 33,652,075 (GRCm39) P45Q possibly damaging Het
Actr10 C A 12: 71,008,803 (GRCm39) A412E probably damaging Het
Actr1b T A 1: 36,740,289 (GRCm39) H284L probably benign Het
Actrt2 G T 4: 154,751,289 (GRCm39) N282K probably benign Het
Acvr1 C A 2: 58,369,880 (GRCm39) G43V probably benign Het
Acy3 G T 19: 4,037,107 (GRCm39) R13L probably damaging Het
Adam17 T G 12: 21,411,738 (GRCm39) Q51P possibly damaging Het
Adam21 T G 12: 81,606,517 (GRCm39) N415T probably damaging Het
Adam30 A G 3: 98,069,676 (GRCm39) Y503C possibly damaging Het
Adam32 C A 8: 25,438,766 (GRCm39) E16* probably null Het
Adam6a A G 12: 113,508,941 (GRCm39) K438R possibly damaging Het
Adam7 A T 14: 68,765,150 (GRCm39) S82R probably benign Het
Adamts10 G T 17: 33,747,762 (GRCm39) R66L probably damaging Het
Adamts10 C T 17: 33,747,761 (GRCm39) R66W probably damaging Het
Adamts12 G T 15: 11,336,469 (GRCm39) C1518F not run Het
Adamts15 G C 9: 30,821,996 (GRCm39) C480W probably damaging Het
Adamts16 C T 13: 70,909,892 (GRCm39) R887K probably benign Het
Adamts18 A T 8: 114,469,800 (GRCm39) I634N possibly damaging Het
Adamts2 G T 11: 50,683,535 (GRCm39) R939L probably damaging Het
Adamts3 C T 5: 89,923,210 (GRCm39) V199I not run Het
Adamts4 G A 1: 171,086,352 (GRCm39) A715T probably benign Het
Adamts4 C G 1: 171,086,353 (GRCm39) A715G probably benign Het
Adamtsl1 T G 4: 86,260,930 (GRCm39) M1055R probably benign Het
Adamtsl1 C T 4: 86,260,414 (GRCm39) P883L probably damaging Het
Adamtsl2 C A 2: 26,971,732 (GRCm39) Q6K probably benign Het
Adcy1 C A 11: 7,099,536 (GRCm39) T672N probably damaging Het
Adcy1 G A 11: 7,100,857 (GRCm39) R802K probably damaging Het
Adcy1 G T 11: 7,100,858 (GRCm39) R802S possibly damaging Het
Adcy1 G A 11: 7,059,098 (GRCm39) D335N probably damaging Het
Adcy5 C G 16: 35,110,555 (GRCm39) F907L probably benign Het
Adcy5 G A 16: 35,111,914 (GRCm39) V924M not run Het
Adcy5 G T 16: 34,976,691 (GRCm39) G75C unknown Het
Adcy8 T C 15: 64,597,367 (GRCm39) T895A probably benign Het
Adcy9 G T 16: 4,125,096 (GRCm39) P745Q probably damaging Het
Add2 G T 6: 86,075,572 (GRCm39) K240N probably damaging Het
Adgb G T 10: 10,254,486 (GRCm39) T1159N probably benign Het
Adgrb2 G T 4: 129,911,356 (GRCm39) C1126F probably damaging Het
Adgrb3 C T 1: 25,132,995 (GRCm39) D1364N probably benign Het
Adgre1 T G 17: 57,668,729 (GRCm39) L30R possibly damaging Het
Adgrg4 C A X: 55,959,619 (GRCm39) P601H probably benign Het
Adgrg4 G T X: 55,940,062 (GRCm39) V174L probably benign Het
Adgrg5 G C 8: 95,661,779 (GRCm39) W173C Het
Adgrv1 C A 13: 81,707,753 (GRCm39) A1218S possibly damaging Het
Adh7 G A 3: 137,929,492 (GRCm39) G87D probably benign Het
Adora2a C A 10: 75,169,162 (GRCm39) Q209K probably benign Het
Adprhl1 C G 8: 13,275,613 (GRCm39) A382P probably benign Het
Adprs C G 4: 126,215,360 (GRCm39) G35A probably damaging Het
Adprs C G 4: 126,215,454 (GRCm39) A4P unknown Het
Adra1a C A 14: 66,965,077 (GRCm39) L356M probably benign Het
Adra2b C A 2: 127,205,958 (GRCm39) D158E probably benign Het
Adra2c G C 5: 35,438,248 (GRCm39) R340P probably damaging Het
Adss2 C A 1: 177,604,059 (GRCm39) C182F probably damaging Het
Adss2 C A 1: 177,624,064 (GRCm39) probably benign Het
Aff3 T A 1: 38,368,953 (GRCm39) K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,354,349 (GRCm39) probably null Het
Afg2a G T 3: 37,485,899 (GRCm39) S207I possibly damaging Het
Afg3l2 C A 18: 67,564,777 (GRCm39) L232F probably benign Het
Afmid G A 11: 117,725,792 (GRCm39) D129N probably benign Het
Agap2 G C 10: 126,916,094 (GRCm39) G202R unknown Het
Agbl1 T G 7: 76,068,433 (GRCm39) L333R Het
Agbl4 T A 4: 110,518,036 (GRCm39) L109Q probably damaging Het
Agbl4 G T 4: 111,383,840 (GRCm39) G232W probably damaging Het
Ago4 C A 4: 126,413,983 (GRCm39) probably null Het
Ahcyl T C 16: 45,974,592 (GRCm39) M262V probably benign Het
Ahnak G T 19: 8,986,220 (GRCm39) M2501I probably damaging Het
AI593442 C A 9: 52,589,245 (GRCm39) G111C probably damaging Het
AI597479 A G 1: 43,152,350 (GRCm39) H216R probably benign Het
Aipl1 G T 11: 71,921,359 (GRCm39) P179T possibly damaging Het
Ak9 G C 10: 41,224,247 (GRCm39) G524R Het
Ak9 G T 10: 41,299,019 (GRCm39) W1573C unknown Het
Akap1 G T 11: 88,727,993 (GRCm39) T663N probably benign Het
Akap13 G T 7: 75,380,300 (GRCm39) R491L probably damaging Het
Akap14 G T X: 36,426,898 (GRCm39) P279H unknown Het
Akap4 G T X: 6,944,599 (GRCm39) E831* probably null Het
Akap6 C G 12: 53,187,227 (GRCm39) T1547R possibly damaging Het
Akap8 C A 17: 32,525,523 (GRCm39) V519L probably damaging Het
Akap9 G T 5: 4,012,251 (GRCm39) G985W probably damaging Het
Akirin1 C T 4: 123,643,860 (GRCm39) G33D probably damaging Het
Akr1cl C A 1: 65,055,846 (GRCm39) G219C probably damaging Het
Alas1 G A 9: 106,115,968 (GRCm39) R349C probably benign Het
Alas1 C A 9: 106,120,566 (GRCm39) Q76H probably benign Het
Aldh1l1 G T 6: 90,560,155 (GRCm39) V601L probably benign Het
Aldh1l1 GAA GA 6: 90,534,266 (GRCm39) probably null Het
Aldh3a2 T G 11: 61,155,109 (GRCm39) K145T probably benign Het
Aldoart1 C A 4: 72,770,241 (GRCm39) R189L probably benign Het
Alg8 T G 7: 97,032,968 (GRCm39) F285V probably benign Het
Alkbh8 G C 9: 3,345,820 (GRCm39) G180A probably damaging Het
Alms1 C G 6: 85,655,400 (GRCm39) N2846K probably benign Het
Alox12b T A 11: 69,048,149 (GRCm39) I26N possibly damaging Het
Alox12b G C 11: 69,048,151 (GRCm39) V27L possibly damaging Het
Aloxe3 C A 11: 69,023,905 (GRCm39) L279M probably damaging Het
Alpi T C 1: 87,026,794 (GRCm39) N428S probably benign Het
Alpk1 T A 3: 127,467,087 (GRCm39) H1064L probably damaging Het
Alpk2 G C 18: 65,438,682 (GRCm39) L904V probably damaging Het
Alpk3 G T 7: 80,728,374 (GRCm39) L501F probably benign Het
Alpl G C 4: 137,481,321 (GRCm39) S110R probably damaging Het
Alppl2 G T 1: 87,015,426 (GRCm39) H378Q probably damaging Het
Alppl2 G A 1: 87,015,388 (GRCm39) S391F probably damaging Het
Amer3 G T 1: 34,628,094 (GRCm39) V778L probably benign Het
Ampd2 C A 3: 107,987,380 (GRCm39) G151V probably damaging Het
Amz1 G T 5: 140,729,828 (GRCm39) E121* probably null Het
Ang4 G T 14: 52,001,605 (GRCm39) C114* probably null Het
Ank3 G C 10: 69,827,045 (GRCm39) E1905Q Het
Ank3 C T 10: 69,786,840 (GRCm39) A968V possibly damaging Het
Ank3 T G 10: 69,768,304 (GRCm39) L941R possibly damaging Het
Ankar G T 1: 72,729,120 (GRCm39) L342I possibly damaging Het
Ankib1 G A 5: 3,742,763 (GRCm39) S1084L probably benign Het
Ankk1 T G 9: 49,333,211 (GRCm39) K91T probably damaging Het
Ankk1 T A 9: 49,327,943 (GRCm39) Q412L probably benign Het
Ankle2 G C 5: 110,382,365 (GRCm39) E114Q possibly damaging Het
Ankmy1 C T 1: 92,806,159 (GRCm39) G780E probably damaging Het
Ankmy2 T G 12: 36,236,858 (GRCm39) M222R probably damaging Het
Ankrd11 C T 8: 123,622,542 (GRCm39) V437M possibly damaging Het
Ankrd12 C A 17: 66,277,333 (GRCm39) probably null Het
Ankrd36 T A 11: 5,565,538 (GRCm39) F457L probably benign Het
Ankrd39 C G 1: 36,581,086 (GRCm39) A88P probably damaging Het
Ankrd45 C T 1: 160,990,853 (GRCm39) A202V possibly damaging Het
Ankrd49 C G 9: 14,692,724 (GRCm39) A147P probably damaging Het
Ankrd6 C T 4: 32,806,229 (GRCm39) E675K possibly damaging Het
Ankrd6 G C 4: 32,824,486 (GRCm39) N142K probably damaging Het
Ankrd6 G T 4: 32,806,326 (GRCm39) S642R probably benign Het
Anks3 T G 16: 4,768,578 (GRCm39) Q255P probably benign Het
Ano2 T G 6: 125,840,416 (GRCm39) Y362* probably null Het
Ano2 G T 6: 125,687,670 (GRCm39) Q58H probably benign Het
Ano4 A T 10: 88,948,807 (GRCm39) V101E probably benign Het
Ano5 T A 7: 51,224,451 (GRCm39) V469E probably damaging Het
Ano6 C A 15: 95,811,341 (GRCm39) P147Q probably damaging Het
Ano7 C A 1: 93,322,187 (GRCm39) D398E probably benign Het
Anpep G C 7: 79,477,387 (GRCm39) P727A possibly damaging Het
Anxa10 T G 8: 62,516,104 (GRCm39) probably null Het
Aoc1l2 A C 6: 48,909,402 (GRCm39) K549T probably benign Het
Aoc2 G T 11: 101,217,246 (GRCm39) G443V probably benign Het
Aox4 G C 1: 58,285,510 (GRCm39) E665Q possibly damaging Het
Ap1m2 G A 9: 21,209,552 (GRCm39) R375* probably null Het
Ap1s1 G A 5: 137,066,324 (GRCm39) T126I probably damaging Het
Apba1 C A 19: 23,921,479 (GRCm39) S767R probably damaging Het
Apex2 C A X: 149,355,095 (GRCm39) G414V probably benign Het
Apoa4 C A 9: 46,153,887 (GRCm39) R163S possibly damaging Het
Apob G T 12: 8,054,978 (GRCm39) V1326L probably benign Het
Apob G C 12: 8,048,011 (GRCm39) G997R probably damaging Het
Apobr A T 7: 126,186,436 (GRCm39) E649V probably damaging Het
Apoh G T 11: 108,234,285 (GRCm39) probably benign Het
Apol11b A C 15: 77,522,207 (GRCm39) I30R probably benign Het
App A G 16: 84,821,805 (GRCm39) L390P probably damaging Het
Aqr C G 2: 113,940,472 (GRCm39) A1225P probably benign Het
Aqr C A 2: 113,938,603 (GRCm39) R1283M probably damaging Het
Ar G T X: 97,194,615 (GRCm39) G410W probably damaging Het
Arfgef2 G A 2: 166,736,632 (GRCm39) R1768Q probably damaging Het
Arfgef3 T A 10: 18,510,600 (GRCm39) H787L probably benign Het
Arfgef3 C A 10: 18,484,106 (GRCm39) C1383F probably damaging Het
Arfgef3 T A 10: 18,467,185 (GRCm39) K2005M probably damaging Het
Arhgap1 C T 2: 91,480,559 (GRCm39) A27V possibly damaging Het
Arhgap10 T G 8: 78,159,434 (GRCm39) S107R probably damaging Het
Arhgap10 C A 8: 78,003,804 (GRCm39) G667V probably benign Het
Arhgap11a C G 2: 113,664,103 (GRCm39) A727P probably benign Het
Arhgap22 A T 14: 33,084,479 (GRCm39) R253W probably damaging Het
Arhgap24 G A 5: 103,028,673 (GRCm39) A283T probably benign Het
Arhgap24 G T 5: 103,023,625 (GRCm39) V220F probably damaging Het
Arhgap25 G T 6: 87,453,168 (GRCm39) L211M probably damaging Het
Arhgap31 G C 16: 38,444,255 (GRCm39) Q201E possibly damaging Het
Arhgap33 C A 7: 30,222,142 (GRCm39) R1263S probably benign Het
Arhgap40 C A 2: 158,376,805 (GRCm39) P317T probably benign Het
Arhgap45 C A 10: 79,861,370 (GRCm39) T511N probably damaging Het
Arhgap45 C G 10: 79,864,886 (GRCm39) R950G probably damaging Het
Arhgap5 G A 12: 52,565,246 (GRCm39) R739H possibly damaging Het
Arhgap9 C A 10: 127,163,558 (GRCm39) T452N probably damaging Het
Arhgef11 C T 3: 87,642,769 (GRCm39) P1434L not run Het
Arhgef12 T A 9: 42,882,368 (GRCm39) Q1492L probably benign Het
Arhgef18 G T 8: 3,503,224 (GRCm39) V877L probably damaging Het
Arhgef4 G T 1: 34,844,007 (GRCm39) G1358C probably damaging Het
Arhgef4 G T 1: 34,762,810 (GRCm39) D689Y unknown Het
Arid1a C A 4: 133,447,861 (GRCm39) Q217H probably null Het
Arid4a A C 12: 71,086,694 (GRCm39) K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,358,436 (GRCm39) probably null Het
Arl10 C G 13: 54,728,537 (GRCm39) L188V probably benign Het
Arl14 C A 3: 69,129,981 (GRCm39) P43T probably damaging Het
Arl4c T C 1: 88,629,172 (GRCm39) Q72R possibly damaging Het
Arl6ip5 C A 6: 97,206,516 (GRCm39) N65K probably benign Het
Armc2 C G 10: 41,839,652 (GRCm39) G438R probably damaging Het
Armc2 C A 10: 41,803,040 (GRCm39) Q544H probably damaging Het
Armcx4 C A X: 133,593,791 (GRCm39) A1233D not run Het
Armcx4 G A X: 133,594,840 (GRCm39) E1583K possibly damaging Het
Arnt2 G A 7: 83,912,404 (GRCm39) P579S probably benign Het
Arpc3 C T 5: 122,542,293 (GRCm39) P120L probably damaging Het
Arrdc5 C G 17: 56,607,189 (GRCm39) A19P probably damaging Het
Arsi C A 18: 61,049,852 (GRCm39) P245H probably damaging Het
Art2b T A 7: 101,228,089 (GRCm39) Q283L not run Het
Arx G T X: 92,332,790 (GRCm39) A280S probably damaging Het
Asap3 C A 4: 135,968,814 (GRCm39) P753Q probably damaging Het
Asap3 TGGG TGG 4: 135,967,512 (GRCm39) probably benign Het
Asb15 G T 6: 24,566,330 (GRCm39) D428Y probably damaging Het
Ascc1 G T 10: 59,843,615 (GRCm39) R59L possibly damaging Het
Ascc2 G T 11: 4,596,653 (GRCm39) R58L probably benign Het
Ascc2 G C 11: 4,622,487 (GRCm39) G518R probably benign Het
Ash1l G A 3: 88,950,524 (GRCm39) R2139Q probably damaging Het
Asic2 A T 11: 80,780,658 (GRCm39) L417Q possibly damaging Het
Asic2 T G 11: 81,858,496 (GRCm39) K172T probably benign Het
Aspg C G 12: 112,079,515 (GRCm39) Q98E possibly damaging Het
Asphd1 A T 7: 126,547,808 (GRCm39) L165Q probably damaging Het
Astl C T 2: 127,198,465 (GRCm39) A360V probably benign Het
Asxl3 G T 18: 22,655,277 (GRCm39) G1096C probably damaging Het
Atad5 A C 11: 79,985,722 (GRCm39) S270R probably damaging Het
Ate1 C A 7: 130,106,444 (GRCm39) D306Y probably benign Het
Atg7 G T 6: 114,650,011 (GRCm39) V63F possibly damaging Het
Atg9a A T 1: 75,163,203 (GRCm39) L299Q probably damaging Het
Atl1 C G 12: 69,983,849 (GRCm39) L192V possibly damaging Het
Atl3 T G 19: 7,487,402 (GRCm39) F106V probably damaging Het
Atp10a G T 7: 58,438,195 (GRCm39) probably null Het
Atp12a G C 14: 56,610,163 (GRCm39) G221A probably damaging Het
Atp13a2 A T 4: 140,732,428 (GRCm39) S898C probably benign Het
Atp13a4 C A 16: 29,241,405 (GRCm39) Q754H probably null Het
Atp1a2 A T 1: 172,107,321 (GRCm39) I733N possibly damaging Het
Atp1a3 C A 7: 24,698,113 (GRCm39) A198S probably benign Het
Atp1a4 C G 1: 172,059,521 (GRCm39) R857P probably benign Het
Atp1b2 G T 11: 69,492,141 (GRCm39) A269D possibly damaging Het
Atp2a3 G T 11: 72,871,448 (GRCm39) G650C possibly damaging Het
Atp2a3 C A 11: 72,880,366 (GRCm39) H1016N probably benign Het
Atp2b3 G A X: 72,579,030 (GRCm39) E343K possibly damaging Het
Atp6v0a4 G A 6: 38,025,971 (GRCm39) S819F possibly damaging Het
Atp6v1e1 T C 6: 120,781,080 (GRCm39) E97G probably benign Het
Atp6v1e1 T A 6: 120,799,410 (GRCm39) probably benign Het
Atp6v1h G C 1: 5,165,851 (GRCm39) R107P probably damaging Het
Atp7b G T 8: 22,518,730 (GRCm39) P36H probably benign Het
Atp8b4 C A 2: 126,256,349 (GRCm39) E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 (GRCm39) R650W probably benign Het
Atp9b T A 18: 80,809,080 (GRCm39) Q613L Het
Atpaf2 C A 11: 60,307,601 (GRCm39) A46S probably benign Het
Atrn G T 2: 130,788,113 (GRCm39) G305V probably benign Het
Atxn2 A T 5: 121,916,053 (GRCm39) S420C probably damaging Het
Atxn7l1 G T 12: 33,417,644 (GRCm39) A602S probably benign Het
Atxn7l1 G C 12: 33,418,016 (GRCm39) A726P probably benign Het
Atxn7l2 A C 3: 108,112,982 (GRCm39) S309A probably benign Het
Aup1 G T 6: 83,033,614 (GRCm39) R306L probably benign Het
Aurkaip1 G T 4: 155,917,220 (GRCm39) R156L probably damaging Het
Aurkc TGG TG 7: 6,998,513 (GRCm39) probably null Het
Avl9 G C 6: 56,713,749 (GRCm39) D336H probably damaging Het
Avpr1b C A 1: 131,537,311 (GRCm39) S365Y probably damaging Het
Axdnd1 A T 1: 156,176,633 (GRCm39) L714Q probably damaging Het
Azin2 C A 4: 128,828,452 (GRCm39) D347Y possibly damaging Het
B3gnt5 A T 16: 19,588,560 (GRCm39) R260* probably null Het
B3gnt6 C G 7: 97,843,096 (GRCm39) R288P probably benign Het
Bag6 G T 17: 35,358,286 (GRCm39) probably null Het
Bahcc1 G T 11: 120,175,220 (GRCm39) V1765L probably benign Het
Bahcc1 G T 11: 120,167,435 (GRCm39) G1279W possibly damaging Het
Bahd1 G A 2: 118,752,884 (GRCm39) R717H probably damaging Het
Baiap3 C A 17: 25,463,742 (GRCm39) R934S probably benign Het
Bbln C A 2: 32,271,776 (GRCm39) G3C possibly damaging Het
Bbs10 G T 10: 111,135,518 (GRCm39) L210F probably benign Het
Bbs10 G C 10: 111,134,769 (GRCm39) probably null Het
Bbs10 G T 10: 111,136,985 (GRCm39) R699S probably damaging Het
BC024063 G T 10: 81,944,884 (GRCm39) G168V probably damaging Het
Bcan T G 3: 87,898,062 (GRCm39) N633T probably damaging Het
Bcan C A 3: 87,898,057 (GRCm39) G635W probably damaging Het
Bcan C T 3: 87,902,957 (GRCm39) D274N probably benign Het
Bckdha T C 7: 25,330,568 (GRCm39) S343G probably damaging Het
Bcl10 T G 3: 145,636,268 (GRCm39) I55M probably damaging Het
Bcl11a G T 11: 24,115,010 (GRCm39) K784N probably damaging Het
Bcl6 C G 16: 23,788,708 (GRCm39) Q553H probably damaging Het
Bcorl1 T G X: 47,456,719 (GRCm39) L84R unknown Het
Bcorl1 GAAAA GAAA X: 47,463,967 (GRCm39) probably null Het
Bend6 C A 1: 33,903,604 (GRCm39) Q173H probably null Het
Best3 T G 10: 116,860,527 (GRCm39) L596V probably benign Het
Bltp3a G A 17: 28,105,280 (GRCm39) R602H probably damaging Het
Bltp3a C G 17: 28,095,650 (GRCm39) L20V probably damaging Het
Bmerb1 C A 16: 13,867,345 (GRCm39) R68S probably damaging Het
Bmp4 A C 14: 46,622,085 (GRCm39) V153G possibly damaging Het
Bmpr1b C A 3: 141,548,715 (GRCm39) E438D probably benign Het
Bmpr2 G A 1: 59,886,326 (GRCm39) R321Q not run Het
Bnc1 T G 7: 81,624,290 (GRCm39) E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,621,767 (GRCm39) probably benign Het
Borcs5 A T 6: 134,687,086 (GRCm39) Q147L probably benign Het
Borcs8 C G 8: 70,594,621 (GRCm39) H49D probably damaging Het
Bpi G T 2: 158,114,022 (GRCm39) G307W possibly damaging Het
Bpifa3 A T 2: 153,972,391 (GRCm39) probably benign Het
Bpifb4 A C 2: 153,784,752 (GRCm39) E153D probably benign Het
Bpifc C A 10: 85,801,092 (GRCm39) A419S probably benign Het
Bptf C A 11: 106,949,510 (GRCm39) G2270W probably damaging Het
Braf C A 6: 39,620,116 (GRCm39) W487C probably damaging Het
Brap A G 5: 121,813,440 (GRCm39) T298A possibly damaging Het
Brd2 C A 17: 34,332,662 (GRCm39) G573W possibly damaging Het
Brd9 G C 13: 74,092,870 (GRCm39) A287P probably damaging Het
Brdt G T 5: 107,507,764 (GRCm39) S664I possibly damaging Het
Brinp1 C A 4: 68,716,988 (GRCm39) E287* probably null Het
Brinp2 A T 1: 158,074,741 (GRCm39) L460* probably null Het
Brinp2 C G 1: 158,074,609 (GRCm39) G504A probably damaging Het
Brinp3 C T 1: 146,777,814 (GRCm39) P754S probably damaging Het
Btg4 G A 9: 51,030,475 (GRCm39) D192N probably benign Het
Btla G T 16: 45,059,721 (GRCm39) V142L probably damaging Het
Bub1 C A 2: 127,671,485 (GRCm39) W33L probably damaging Het
C1qb C G 4: 136,609,456 (GRCm39) G55R probably damaging Het
C1ql2 C G 1: 120,269,353 (GRCm39) H169Q possibly damaging Het
C2cd4a C G 9: 67,738,695 (GRCm39) G116A probably damaging Het
C2cd4c G A 10: 79,448,299 (GRCm39) P283S possibly damaging Het
C4b A T 17: 34,950,121 (GRCm39) L1383Q probably damaging Het
C8a C A 4: 104,719,883 (GRCm39) G76C probably damaging Het
Cabp7 T G 11: 4,696,669 (GRCm39) N20T probably benign Het
Cacna1a G T 8: 85,142,305 (GRCm39) R11L unknown Het
Cacna1b A T 2: 24,516,896 (GRCm39) L54* probably null Het
Cacna1c T G 6: 118,674,698 (GRCm39) K547T Het
Cacna1d A G 14: 29,901,145 (GRCm39) F325S probably benign Het
Cacna1d C T 14: 29,833,073 (GRCm39) A923T probably benign Het
Cacna1e T A 1: 154,511,596 (GRCm39) T176S probably damaging Het
Cacna1g A T 11: 94,328,937 (GRCm39) L1020M probably benign Het
Cacna1h G C 17: 25,610,224 (GRCm39) P761A probably benign Het
Cacna1s G T 1: 136,034,822 (GRCm39) E1322* probably null Het
Cacna2d2 C A 9: 107,403,301 (GRCm39) L921M probably benign Het
Cacna2d2 G C 9: 107,394,492 (GRCm39) A585P probably damaging Het
Cacna2d4 G T 6: 119,289,411 (GRCm39) R815M probably benign Het
Cacnb1 C A 11: 97,913,381 (GRCm39) probably benign Het
Cacnb4 C A 2: 52,565,824 (GRCm39) probably null Het
Cacng5 C G 11: 107,775,172 (GRCm39) G66R probably null Het
Cacng5 G T 11: 107,768,372 (GRCm39) P212T probably damaging Het
Cadps2 A C 6: 23,321,800 (GRCm39) L1031V probably benign Het
Calcoco2 C A 11: 95,994,346 (GRCm39) W69L probably damaging Het
Calr C A 8: 85,570,693 (GRCm39) probably null Het
Camk1g C A 1: 193,044,408 (GRCm39) G2V probably damaging Het
Camk2b G C 11: 5,927,940 (GRCm39) S447C possibly damaging Het
Camk2g C A 14: 20,814,980 (GRCm39) W215C probably damaging Het
Camsap1 G C 2: 25,830,893 (GRCm39) P461A probably benign Het
Camsap1 C T 2: 25,826,651 (GRCm39) A1260T probably damaging Het
Camta1 G T 4: 151,228,842 (GRCm39) H663Q probably benign Het
Cand1 A C 10: 119,075,099 (GRCm39) I16S probably benign Het
Capg G T 6: 72,532,459 (GRCm39) probably null Het
Capn1 C G 19: 6,064,308 (GRCm39) V64L probably benign Het
Capn13 G T 17: 73,648,105 (GRCm39) S298R probably benign Het
Capn6 C G X: 142,593,903 (GRCm39) G79R probably damaging Het
Car5b G T X: 162,783,306 (GRCm39) A90D probably benign Het
Car7 G T 8: 105,275,591 (GRCm39) C180F possibly damaging Het
Card9 T A 2: 26,247,808 (GRCm39) E181V probably damaging Het
Carnmt1 C G 19: 18,656,577 (GRCm39) A170G possibly damaging Het
Carnmt1 G C 19: 18,681,454 (GRCm39) C391S probably benign Het
Cartpt C A 13: 100,036,491 (GRCm39) E86* probably null Het
Cask C T X: 13,399,728 (GRCm39) V785I probably benign Het
Caskin1 C A 17: 24,724,012 (GRCm39) N933K probably damaging Het
Caskin2 C A 11: 115,694,446 (GRCm39) G385V probably benign Het
Caskin2 A G 11: 115,692,922 (GRCm39) L621P probably damaging Het
Caskin2 C G 11: 115,692,929 (GRCm39) A619P probably damaging Het
Casq1 G T 1: 172,043,481 (GRCm39) S191* probably null Het
Casz1 T C 4: 149,028,816 (GRCm39) L1087P probably benign Het
Catip A C 1: 74,406,948 (GRCm39) H240P probably damaging Het
Catsper2 C A 2: 121,237,866 (GRCm39) W171C probably damaging Het
Cav2 G T 6: 17,281,432 (GRCm39) V25F probably benign Het
Cavin2 G T 1: 51,340,315 (GRCm39) G331C probably damaging Het
Cbfa2t3 G C 8: 123,425,634 (GRCm39) probably benign Het
Cbx8 G A 11: 118,929,945 (GRCm39) A216V possibly damaging Het
Ccdc113 G T 8: 96,264,847 (GRCm39) R119L probably damaging Het
Ccdc121rt1 C T 1: 181,338,440 (GRCm39) E171K possibly damaging Het
Ccdc121rt2 T C 5: 112,597,741 (GRCm39) V96A probably benign Het
Ccdc14 G T 16: 34,526,868 (GRCm39) G306C probably damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,578,155 (GRCm39) probably null Het
Ccdc158 T C 5: 92,756,350 (GRCm39) M1086V probably damaging Het
Ccdc162 C T 10: 41,429,127 (GRCm39) R645H probably benign Het
Ccdc162 T G 10: 41,566,088 (GRCm39) K85T probably benign Het
Ccdc162 G A 10: 41,530,993 (GRCm39) T571I possibly damaging Het
Ccdc162 C T 10: 41,481,104 (GRCm39) D1318N possibly damaging Het
Ccdc171 G A 4: 83,713,467 (GRCm39) A1169T probably damaging Het
Ccdc175 C A 12: 72,159,082 (GRCm39) R619L possibly damaging Het
Ccdc180 A C 4: 45,916,406 (GRCm39) K869T probably damaging Het
Ccdc180 A C 4: 45,920,910 (GRCm39) K952T probably damaging Het
Ccdc187 G T 2: 26,171,519 (GRCm39) Q320K probably benign Het
Ccdc28b C A 4: 129,514,897 (GRCm39) G71C probably damaging Het
Ccdc33 G A 9: 58,024,699 (GRCm39) P176S probably benign Het
Ccdc40 G A 11: 119,142,834 (GRCm39) R864H probably damaging Het
Ccdc51 G T 9: 108,921,216 (GRCm39) E368* probably null Het
Ccdc51 G C 9: 108,921,294 (GRCm39) A394P probably damaging Het
Ccdc57 C A 11: 120,751,964 (GRCm39) Q872H probably null Het
Ccdc57 C G 11: 120,751,314 (GRCm39) A919P possibly damaging Het
Ccdc7a G T 8: 129,753,144 (GRCm39) R196S probably benign Het
Ccdc80 T C 16: 44,936,707 (GRCm39) F711L probably damaging Het
Ccdc80 G A 16: 44,916,570 (GRCm39) S442N probably benign Het
Ccdc80 G T 16: 44,916,149 (GRCm39) G302* probably null Het
Ccdc87 G A 19: 4,891,951 (GRCm39) W814* probably null Het
Ccdc88b C A 19: 6,827,108 (GRCm39) A1020S possibly damaging Het
Ccdc88c T C 12: 100,912,029 (GRCm39) K602E possibly damaging Het
Ccdc96 C G 5: 36,642,938 (GRCm39) R315G probably benign Het
Ccin A T 4: 43,985,018 (GRCm39) Q475L probably damaging Het
Ccnb1ip1 C A 14: 51,029,561 (GRCm39) R167L probably benign Het
Ccnb3 T C X: 6,875,614 (GRCm39) T322A possibly damaging Het
Ccr10 C G 11: 101,065,149 (GRCm39) G127A probably damaging Het
Ccr10 CG C 11: 101,065,166 (GRCm39) probably null Het
Ccr7 G T 11: 99,035,806 (GRCm39) T372N probably damaging Het
Cct6b C A 11: 82,654,891 (GRCm39) probably benign Het
Cct6b C T 11: 82,614,765 (GRCm39) V408I probably damaging Het
Cd164 G T 10: 41,395,561 (GRCm39) A11S probably damaging Het
Cd177 G T 7: 24,445,596 (GRCm39) Q616K probably benign Het
Cd180 C T 13: 102,842,274 (GRCm39) P440L probably damaging Het
Cd200r1 A T 16: 44,613,122 (GRCm39) I243F probably damaging Het
Cd209e C T 8: 3,899,196 (GRCm39) G172E probably benign Het
Cd22 T G 7: 30,567,388 (GRCm39) K732T probably benign Het
Cd22 G T 7: 30,568,955 (GRCm39) P693H probably damaging Het
Cd3d A G 9: 44,896,926 (GRCm39) D100G probably damaging Het
Cd59a C A 2: 103,934,543 (GRCm39) Q4K probably benign Het
Cd69 G T 6: 129,245,305 (GRCm39) C173* probably null Het
Cdc123 T G 2: 5,809,796 (GRCm39) Q205P probably damaging Het
Cdc14b C G 13: 64,422,483 (GRCm39) V28L possibly damaging Het
Cdc42bpa A G 1: 179,892,658 (GRCm39) E274G probably damaging Het
Cdc42ep2 A G 19: 5,968,520 (GRCm39) F62L probably benign Het
Cdc42ep5 A T 7: 4,154,725 (GRCm39) L21H probably damaging Het
Cdh15 G C 8: 123,590,998 (GRCm39) D416H probably damaging Het
Cdh16 G C 8: 105,341,817 (GRCm39) P783A probably damaging Het
Cdh19 C G 1: 110,859,944 (GRCm39) G179A probably damaging Het
Cdh19 T G 1: 110,821,036 (GRCm39) Q567H probably benign Het
Cdh19 A T 1: 110,823,117 (GRCm39) N522K probably damaging Het
Cdh20 G T 1: 110,036,466 (GRCm39) G549C probably damaging Het
Cdh22 G T 2: 164,958,104 (GRCm39) P621H probably damaging Het
Cdh23 T A 10: 60,146,549 (GRCm39) N2877Y probably damaging Het
Cdh23 T C 10: 60,264,100 (GRCm39) N683D probably benign Het
Cdh8 C A 8: 99,916,837 (GRCm39) R426M probably null Het
Cdh8 G A 8: 99,897,955 (GRCm39) P453S probably benign Het
Cdhr3 C A 12: 33,130,323 (GRCm39) G171W probably benign Het
Cdhr3 G T 12: 33,110,321 (GRCm39) P321H probably damaging Het
Cdk12 G T 11: 98,094,767 (GRCm39) G192* probably null Het
Cdk14 G T 5: 5,185,322 (GRCm39) Y212* probably null Het
Cdk5r2 C G 1: 74,894,509 (GRCm39) P85A probably damaging Het
Cdk5rap2 C T 4: 70,184,980 (GRCm39) G1157R probably damaging Het
Cdk6 T A 5: 3,440,694 (GRCm39) C83S possibly damaging Het
Cdsn T A 17: 35,866,968 (GRCm39) L499Q probably damaging Het
Cdsn T G 17: 35,866,722 (GRCm39) V417G possibly damaging Het
Cdyl C T 13: 35,999,949 (GRCm39) R77W probably damaging Het
Ceacam15 G T 7: 16,409,508 (GRCm39) P9H possibly damaging Het
Cela2a G T 4: 141,548,702 (GRCm39) P145T probably damaging Het
Celsr1 A C 15: 85,847,301 (GRCm39) F1479V probably damaging Het
Celsr2 C A 3: 108,300,447 (GRCm39) R2871L probably benign Het
Celsr2 G T 3: 108,319,657 (GRCm39) H1052N probably benign Het
Cenpf G A 1: 189,391,669 (GRCm39) T704I probably damaging Het
Cenpv A C 11: 62,418,351 (GRCm39) F201V probably damaging Het
Cep112 G A 11: 108,316,136 (GRCm39) G36D probably damaging Het
Cep152 C A 2: 125,425,891 (GRCm39) G825C probably benign Het
Cep170b G T 12: 112,707,446 (GRCm39) probably null Het
Cep192 A T 18: 68,014,359 (GRCm39) K2451M probably damaging Het
Cep290 AGG AG 10: 100,385,236 (GRCm39) probably benign Het
Cep295 G T 9: 15,268,993 (GRCm39) P16Q probably damaging Het
Cep295nl T C 11: 118,223,845 (GRCm39) E333G possibly damaging Het
Cep295nl T G 11: 118,224,699 (GRCm39) Q48H probably damaging Het
Cep44 C G 8: 56,997,163 (GRCm39) G125A possibly damaging Het
Cep97 C A 16: 55,748,098 (GRCm39) G111C probably damaging Het
Cerkl C A 2: 79,199,109 (GRCm39) Q160H probably benign Het
Cers1 C G 8: 70,770,968 (GRCm39) P126R probably benign Het
Ces1a C A 8: 93,762,713 (GRCm39) R186L probably benign Het
Ces1g G T 8: 94,052,439 (GRCm39) H283Q probably benign Het
Ces2a C A 8: 105,460,638 (GRCm39) probably benign Het
Ces2a A T 8: 105,461,482 (GRCm39) E77V probably damaging Het
Ces3a A C 8: 105,780,234 (GRCm39) K327T possibly damaging Het
Ces4a A G 8: 105,858,609 (GRCm39) K9R probably benign Het
Cetn2 T G X: 71,958,495 (GRCm39) K127T probably damaging Het
Cfap100 G C 6: 90,383,132 (GRCm39) A347G unknown Het
Cfap20 C T 8: 96,161,153 (GRCm39) S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 (GRCm39) P251R possibly damaging Het
Cfap221 G T 1: 119,922,871 (GRCm39) L24I probably benign Het
Cfap45 G T 1: 172,372,851 (GRCm39) E515D probably benign Het
Cfap46 A C 7: 139,219,464 (GRCm39) L1334V Het
Cfap65 G A 1: 74,949,906 (GRCm39) R1200C probably damaging Het
Cfap68 C A 9: 50,679,519 (GRCm39) probably benign Het
Cfap74 C G 4: 155,510,575 (GRCm39) R387G Het
Cfhr4 G C 1: 139,661,186 (GRCm39) C554W probably damaging Het
Cfhr4 G T 1: 139,625,994 (GRCm39) R827S probably benign Het
Cflar G T 1: 58,779,472 (GRCm39) probably null Het
Cflar C G 1: 58,770,388 (GRCm39) C160W Het
Cgn G T 3: 94,683,488 (GRCm39) A389D probably benign Het
Cgn A T 3: 94,681,583 (GRCm39) V504E possibly damaging Het
Cgn T C 3: 94,681,656 (GRCm39) R480G probably damaging Het
Chd1 G T 17: 15,988,995 (GRCm39) G1583C probably damaging Het
Chd1 G T 17: 15,986,609 (GRCm39) V1482L probably damaging Het
Chd4 G T 6: 125,077,823 (GRCm39) R95L possibly damaging Het
Chd4 G T 6: 125,078,561 (GRCm39) A228S probably benign Het
Chd5 G A 4: 152,462,936 (GRCm39) R1363K probably damaging Het
Chd7 C G 4: 8,844,313 (GRCm39) A1502G probably damaging Het
Cherp C T 8: 73,224,797 (GRCm39) G101D Het
Chfr C G 5: 110,292,761 (GRCm39) S176* probably null Het
Chi3l1 C G 1: 134,116,968 (GRCm39) R319G probably damaging Het
Chi3l1 G T 1: 134,110,517 (GRCm39) probably null Het
Chml C A 1: 175,515,328 (GRCm39) G198C possibly damaging Het
Chmp3 A C 6: 71,537,948 (GRCm39) E58D probably benign Het
Chmp3 G C 6: 71,556,759 (GRCm39) A220P probably damaging Het
Chpf G C 1: 75,452,114 (GRCm39) L609V probably damaging Het
Chpf C G 1: 75,452,102 (GRCm39) A613P probably benign Het
Chrna2 C A 14: 66,386,753 (GRCm39) L300M probably damaging Het
Chrna5 G T 9: 54,911,766 (GRCm39) G189C probably damaging Het
Chrna7 A T 7: 62,861,932 (GRCm39) L40Q probably damaging Het
Chst3 T A 10: 60,021,498 (GRCm39) R450W possibly damaging Het
Chst4 A C 8: 110,756,724 (GRCm39) F380V probably damaging Het
Chsy1 C G 7: 65,821,974 (GRCm39) S736R probably damaging Het
Cic A C 7: 24,970,444 (GRCm39) E58D possibly damaging Het
Cidea A G 18: 67,491,923 (GRCm39) K61R probably null Het
Ciita C A 16: 10,326,564 (GRCm39) P252T probably damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cimap2 G T 4: 106,464,497 (GRCm39) D387E probably benign Het
Cimip2b A G 4: 43,427,172 (GRCm39) S87P Het
Cimip2b G T 4: 43,427,171 (GRCm39) S87Y Het
Cimip3 T G 17: 47,724,659 (GRCm39) N154T probably benign Het
Cipc G T 12: 87,007,111 (GRCm39) G103C probably damaging Het
Cit G C 5: 116,124,662 (GRCm39) G1526R probably damaging Het
Cited4 C A 4: 120,524,011 (GRCm39) H4Q probably damaging Het
Ckap2 G A 8: 22,659,810 (GRCm39) P557L probably damaging Het
Ckap2l C A 2: 129,127,282 (GRCm39) D299Y probably damaging Het
Clca3a1 G T 3: 144,719,682 (GRCm39) S429R probably damaging Het
Clcn1 T C 6: 42,284,501 (GRCm39) V613A probably damaging Het
Cldn11 T A 3: 31,204,455 (GRCm39) W53R probably damaging Het
Cldn18 T A 9: 99,580,900 (GRCm39) K116M possibly damaging Het
Cldn23 A T 8: 36,293,431 (GRCm39) L19Q probably damaging Het
Cldn34b1 T G X: 153,670,704 (GRCm39) K5T probably benign Het
Clec4d T G 6: 123,251,645 (GRCm39) F176V probably benign Het
Clic1 G T 17: 35,271,435 (GRCm39) G22W probably damaging Het
Clic6 G A 16: 92,295,783 (GRCm39) D148N probably benign Het
Clip3 A C 7: 29,998,263 (GRCm39) E236D probably benign Het
Clk1 C A 1: 58,456,531 (GRCm39) R186L probably benign Het
Clstn3 C T 6: 124,436,159 (GRCm39) V234M probably damaging Het
Cltc A G 11: 86,593,458 (GRCm39) V1525A probably benign Het
Cmklr1 T A 5: 113,751,952 (GRCm39) S350C probably damaging Het
Cmya5 C G 13: 93,233,298 (GRCm39) D597H unknown Het
Cmya5 C G 13: 93,200,087 (GRCm39) A3414P probably benign Het
Cnksr1 A T 4: 133,959,446 (GRCm39) L396Q probably damaging Het
Cnksr3 C T 10: 7,084,544 (GRCm39) R308Q probably damaging Het
Cnnm4 G T 1: 36,544,832 (GRCm39) R697L possibly damaging Het
Cnot1 C G 8: 96,474,905 (GRCm39) Q1103H possibly damaging Het
Cnot8 C G 11: 58,003,916 (GRCm39) A117G probably benign Het
Cnppd1 C A 1: 75,117,595 (GRCm39) G42V probably damaging Het
Cntn2 C A 1: 132,455,526 (GRCm39) R237L probably damaging Het
Cntn3 T G 6: 102,414,892 (GRCm39) probably null Het
Cntn4 T G 6: 106,486,425 (GRCm39) N284K probably benign Het
Cntn4 T G 6: 106,500,524 (GRCm39) F334V probably benign Het
Cntnap1 C A 11: 101,073,724 (GRCm39) T625K probably damaging Het
Cntnap2 A C 6: 47,248,082 (GRCm39) K1163Q probably benign Het
Cntnap3 AC A 13: 64,888,686 (GRCm39) probably null Het
Cntnap3 T G 13: 64,940,202 (GRCm39) N332H probably damaging Het
Cntnap4 A T 8: 113,584,821 (GRCm39) K1086M possibly damaging Het
Cntnap5a T A 1: 116,356,246 (GRCm39) V759E probably damaging Het
Cntnap5b C A 1: 100,091,953 (GRCm39) S231R possibly damaging Het
Cntnap5b C G 1: 100,374,565 (GRCm39) Q734E probably benign Het
Cntnap5b C A 1: 99,894,995 (GRCm39) T89K probably damaging Het
Cobl G A 11: 12,325,827 (GRCm39) A223V probably damaging Het
Cobl G T 11: 12,203,433 (GRCm39) Q1090K probably benign Het
Cobl C A 11: 12,319,645 (GRCm39) E244D probably damaging Het
Cog1 C A 11: 113,542,808 (GRCm39) H151Q probably damaging Het
Coil C A 11: 88,872,802 (GRCm39) P388T probably damaging Het
Col10a1 C A 10: 34,271,174 (GRCm39) P382H probably damaging Het
Col11a2 G T 17: 34,275,376 (GRCm39) G420C unknown Het
Col16a1 G C 4: 129,966,671 (GRCm39) G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,637,868 (GRCm39) probably benign Het
Col18a1 C A 10: 76,948,685 (GRCm39) A276S unknown Het
Col18a1 G C 10: 76,891,543 (GRCm39) A1097G possibly damaging Het
Col1a2 A C 6: 4,532,750 (GRCm39) T792P unknown Het
Col23a1 G T 11: 51,440,535 (GRCm39) D142Y unknown Het
Col24a1 G A 3: 145,048,259 (GRCm39) G619S probably damaging Het
Col25a1 AC A 3: 129,976,444 (GRCm39) probably null Het
Col27a1 C G 4: 63,144,025 (GRCm39) S571C probably damaging Het
Col5a1 G A 2: 27,892,529 (GRCm39) R1014H unknown Het
Col5a2 C A 1: 45,415,306 (GRCm39) V1478L possibly damaging Het
Col5a2 C G 1: 45,435,644 (GRCm39) G697A probably benign Het
Col5a2 C A 1: 45,422,840 (GRCm39) G1126C probably damaging Het
Col6a4 T C 9: 105,877,996 (GRCm39) S1994G probably benign Het
Col6a4 G C 9: 105,878,069 (GRCm39) C1969W probably damaging Het
Col6a6 G C 9: 105,658,151 (GRCm39) A687G probably damaging Het
Col9a1 C A 1: 24,253,669 (GRCm39) P464H probably damaging Het
Col9a2 C G 4: 120,910,994 (GRCm39) A543G probably damaging Het
Colec11 C A 12: 28,645,283 (GRCm39) Q129H probably damaging Het
Commd10 G T 18: 47,123,633 (GRCm39) G163* probably null Het
Commd2 C A 3: 57,554,278 (GRCm39) R141L probably damaging Het
Copb2 A C 9: 98,468,199 (GRCm39) K737T probably benign Het
Coq3 C A 4: 21,899,102 (GRCm39) P145H probably damaging Het
Coq4 G T 2: 29,685,461 (GRCm39) Q158H probably null Het
Coq6 G C 12: 84,417,737 (GRCm39) A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,358,691 (GRCm39) probably null Het
Cox6a1 C T 5: 115,483,967 (GRCm39) G92S probably damaging Het
Cox6b2 C A 7: 4,755,146 (GRCm39) V43L probably benign Het
Cpeb1 C A 7: 81,009,476 (GRCm39) probably null Het
Cpeb2 G T 5: 43,392,060 (GRCm39) G419C Het
Cpne1 C A 2: 155,919,564 (GRCm39) D302Y probably damaging Het
Cpq A C 15: 33,381,537 (GRCm39) D300A probably damaging Het
Cps1 CTT CT 1: 67,187,878 (GRCm39) probably null Het
Cps1 G T 1: 67,162,427 (GRCm39) G35V possibly damaging Het
Cpsf4 A T 5: 145,104,225 (GRCm39) E20V possibly damaging Het
Cr2 G T 1: 194,836,461 (GRCm39) Q901K probably benign Het
Cracd C A 5: 77,005,093 (GRCm39) P485T unknown Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Crb2 C T 2: 37,666,383 (GRCm39) P11S probably benign Het
Crebl2 G T 6: 134,826,252 (GRCm39) E68* probably null Het
Crem T A 18: 3,267,730 (GRCm39) E258V probably damaging Het
Crispld1 G T 1: 17,823,075 (GRCm39) A381S possibly damaging Het
Crispld1 C A 1: 17,798,837 (GRCm39) probably benign Het
Crtac1 T G 19: 42,276,365 (GRCm39) E521A probably benign Het
Cry1 C A 10: 84,980,061 (GRCm39) V416L probably benign Het
Crybg2 C A 4: 133,809,971 (GRCm39) P1241H probably damaging Het
Cryz A T 3: 154,327,406 (GRCm39) T277S probably benign Het
Csmd1 T A 8: 16,087,212 (GRCm39) T1946S probably damaging Het
Csmd1 T C 8: 16,048,814 (GRCm39) D2296G probably damaging Het
Cspg5 G T 9: 110,080,118 (GRCm39) A429S probably damaging Het
Ctbp2 C A 7: 132,617,019 (GRCm39) probably benign Het
Ctf2 T A 7: 127,318,628 (GRCm39) I124F possibly damaging Het
Ctps1 G C 4: 120,399,940 (GRCm39) D472E probably benign Het
Ctsf C A 19: 4,906,334 (GRCm39) Q155K probably benign Het
Ctsj C T 13: 61,151,929 (GRCm39) E43K probably damaging Het
Ctsq C A 13: 61,184,937 (GRCm39) V250L probably benign Het
Cttnbp2 C A 6: 18,408,724 (GRCm39) G966C possibly damaging Het
Cttnbp2 C A 6: 18,408,708 (GRCm39) S971I probably benign Het
Cttnbp2 C A 6: 18,501,959 (GRCm39) E60* probably null Het
Cttnbp2 G T 6: 18,420,835 (GRCm39) A892E possibly damaging Het
Cubn T A 2: 13,386,636 (GRCm39) E1543V probably damaging Het
Cul9 C A 17: 46,831,502 (GRCm39) G1571* probably null Het
Cul9 C A 17: 46,831,511 (GRCm39) G1568* probably null Het
Cutal G T 2: 34,772,437 (GRCm39) R67I probably damaging Het
Cux2 G T 5: 122,023,997 (GRCm39) T92K probably benign Het
Cux2 C A 5: 122,011,876 (GRCm39) G520* probably null Het
Cxcr1 A T 1: 74,231,551 (GRCm39) L157* probably null Het
Cyb561d2 G C 9: 107,417,495 (GRCm39) C85W probably damaging Het
Cybb T C X: 9,304,479 (GRCm39) I564V probably damaging Het
Cybb G A X: 9,306,240 (GRCm39) H494Y probably damaging Het
Cyfip2 G A 11: 46,113,442 (GRCm39) S968F not run Het
Cylc1 G A X: 110,166,915 (GRCm39) V399I unknown Het
Cyp11b1 T A 15: 74,711,204 (GRCm39) K158I probably damaging Het
Cyp19a1 T A 9: 54,083,883 (GRCm39) K169* probably null Het
Cyp1a1 C A 9: 57,607,877 (GRCm39) S168R probably benign Het
Cyp26b1 T C 6: 84,554,096 (GRCm39) S174G probably benign Het
Cyp2a4 C T 7: 26,010,266 (GRCm39) P264S probably damaging Het
Cyp2a4 G T 7: 26,006,748 (GRCm39) G36* probably null Het
Cyp2a5 G A 7: 26,536,199 (GRCm39) R148H probably damaging Het
Cyp2a5 A C 7: 26,534,922 (GRCm39) N45T probably damaging Het
Cyp2c29 G A 19: 39,313,441 (GRCm39) M351I probably benign Het
Cyp2c54 G A 19: 40,034,659 (GRCm39) P337L probably damaging Het
Cyp2c55 C T 19: 39,023,957 (GRCm39) R344C probably benign Het
Cyp2j11 G T 4: 96,195,673 (GRCm39) S341Y probably damaging Het
Cyp2j11 T G 4: 96,195,540 (GRCm39) E385D probably damaging Het
Cyp2j5 G T 4: 96,517,743 (GRCm39) P490T probably damaging Het
Cyp2j6 C A 4: 96,424,305 (GRCm39) G151* probably null Het
Cyp39a1 A C 17: 44,036,468 (GRCm39) I333L probably benign Het
Cyp39a1 A C 17: 44,041,939 (GRCm39) E382A probably damaging Het
Cyp3a44 T C 5: 145,728,474 (GRCm39) K250R probably benign Het
Cyp4a10 G T 4: 115,375,523 (GRCm39) S2I probably damaging Het
Cyp4a12a G T 4: 115,186,200 (GRCm39) probably null Het
Cyp4a14 G C 4: 115,347,214 (GRCm39) A408G probably benign Het
Cyp4a30b G T 4: 115,328,156 (GRCm39) R475L possibly damaging Het
Cypt14-ps T C X: 38,952,432 (GRCm39) K10R possibly damaging Het
Cypt15-ps A C X: 38,435,261 (GRCm39) K33T possibly damaging Het
Cypt2 G T X: 104,543,405 (GRCm39) R3L probably benign Het
Cyth2 C A 7: 45,462,529 (GRCm39) R24L possibly damaging Het
Cytip C A 2: 58,024,049 (GRCm39) S257I probably damaging Het
Cytl1 G T 5: 37,893,039 (GRCm39) A50S probably benign Het
D430041D05Rik C A 2: 103,985,280 (GRCm39) L1262F probably damaging Het
D430041D05Rik C A 2: 104,087,201 (GRCm39) A592S probably benign Het
D5Ertd579e C G 5: 36,773,106 (GRCm39) E430Q probably benign Het
D930020B18Rik C A 10: 121,503,521 (GRCm39) A232D probably benign Het
Dab1 G C 4: 104,585,275 (GRCm39) V472L probably benign Het
Dab2ip G T 2: 35,598,880 (GRCm39) D191Y probably damaging Het
Dapk1 AC A 13: 60,908,618 (GRCm39) probably null Het
Dars1 C A 1: 128,299,944 (GRCm39) E347* probably null Het
Daw1 A C 1: 83,186,976 (GRCm39) K262T probably damaging Het
Daw1 C G 1: 83,158,112 (GRCm39) L54V probably damaging Het
Daw1 C A 1: 83,161,021 (GRCm39) T121K probably damaging Het
Dbh T A 2: 27,067,739 (GRCm39) L454Q probably damaging Het
Dcaf12l1 G A X: 43,878,774 (GRCm39) T8M probably benign Het
Dcaf8 G T 1: 172,000,496 (GRCm39) R218L probably benign Het
Dcdc2c G T 12: 28,574,706 (GRCm39) P139T probably benign Het
Dcxr GA G 11: 120,618,034 (GRCm39) probably null Het
Ddhd2 C T 8: 26,225,856 (GRCm39) M500I possibly damaging Het
Ddo C A 10: 40,523,929 (GRCm39) H306Q probably damaging Het
Ddr2 T C 1: 169,812,524 (GRCm39) Y656C probably damaging Het
Ddr2 T G 1: 169,825,653 (GRCm39) T316P probably benign Het
Ddr2 G T 1: 169,825,652 (GRCm39) T316N probably benign Het
Ddx51 G T 5: 110,802,424 (GRCm39) E176* probably null Het
Deaf1 C T 7: 140,881,387 (GRCm39) W573* probably null Het
Dedd2 C A 7: 24,903,023 (GRCm39) R312L probably damaging Het
Def8 G T 8: 124,186,705 (GRCm39) E428D possibly damaging Het
Defa21 T G 8: 21,515,739 (GRCm39) F46V probably benign Het
Defa27 A G 8: 21,805,614 (GRCm39) Q18R probably damaging Het
Defa27 C A 8: 21,805,613 (GRCm39) Q18K probably damaging Het
Defb14 G T 8: 19,245,136 (GRCm39) G38C probably damaging Het
Defb21 C A 2: 152,415,753 (GRCm39) P22H unknown Het
Defb26 C T 2: 152,350,221 (GRCm39) probably null Het
Dennd4b T G 3: 90,186,802 (GRCm39) L1425R probably damaging Het
Depdc5 A T 5: 33,100,626 (GRCm39) M846L possibly damaging Het
Dffb G T 4: 154,057,300 (GRCm39) L126M probably damaging Het
Dgat2l6 C A X: 99,568,556 (GRCm39) Q10K probably benign Het
Dgcr8 C T 16: 18,096,182 (GRCm39) probably null Het
Dgkb A G 12: 38,031,995 (GRCm39) Q19R possibly damaging Het
Dgkb C A 12: 38,186,612 (GRCm39) L254M probably damaging Het
Dgkd A C 1: 87,855,532 (GRCm39) S725R probably benign Het
Dgkg C A 16: 22,407,148 (GRCm39) A146S probably benign Het
Dglucy A C 12: 100,819,563 (GRCm39) K425T probably benign Het
Dhx30 C A 9: 109,916,033 (GRCm39) G722C probably damaging Het
Dhx34 G A 7: 15,952,569 (GRCm39) R19* probably null Het
Dhx57 T G 17: 80,553,234 (GRCm39) K1231T probably damaging Het
Diaph3 C A 14: 86,893,868 (GRCm39) C1136F probably benign Het
Dicer1 C G 12: 104,697,279 (GRCm39) A93P probably null Het
Dip2a T G 10: 76,116,654 (GRCm39) T890P probably damaging Het
Dip2a T A 10: 76,102,157 (GRCm39) S1446C possibly damaging Het
Disp3 G T 4: 148,335,414 (GRCm39) P908T probably damaging Het
Dlc1 C A 8: 37,051,365 (GRCm39) G338C probably damaging Het
Dlec1 C A 9: 118,967,854 (GRCm39) P1218T probably benign Het
Dlg4 G A 11: 69,932,746 (GRCm39) G512E probably benign Het
Dlgap1 C T 17: 71,122,204 (GRCm39) P878S probably damaging Het
Dll4 G T 2: 119,156,533 (GRCm39) probably benign Het
Dmbt1 T G 7: 130,690,542 (GRCm39) I925S unknown Het
Dmd A G X: 82,670,892 (GRCm39) K225R probably damaging Het
Dmd A T X: 82,922,090 (GRCm39) L1453F possibly damaging Het
Dmkn G T 7: 30,475,922 (GRCm39) W25L possibly damaging Het
Dmrt1 C T 19: 25,537,334 (GRCm39) T307I possibly damaging Het
Dmrt2 T C 19: 25,655,364 (GRCm39) L321P probably damaging Het
Dmrtb1 T A 4: 107,538,027 (GRCm39) D47V probably damaging Het
Dnaaf1 A C 8: 120,302,180 (GRCm39) D27A possibly damaging Het
Dnaaf10 A C 11: 17,178,184 (GRCm39) K226T probably damaging Het
Dnaaf2 G C 12: 69,244,624 (GRCm39) H146D probably damaging Het
Dnah10 G T 5: 124,852,419 (GRCm39) A1883S probably benign Het
Dnah11 A T 12: 118,094,534 (GRCm39) L845M probably damaging Het
Dnah11 C T 12: 117,894,912 (GRCm39) R3645H possibly damaging Het
Dnah11 A C 12: 118,090,854 (GRCm39) I1030S probably benign Het
Dnah14 G C 1: 181,584,916 (GRCm39) E3216Q possibly damaging Het
Dnah17 G T 11: 118,017,992 (GRCm39) L168M probably benign Het
Dnah2 G A 11: 69,312,647 (GRCm39) A4306V possibly damaging Het
Dnah2 C G 11: 69,407,349 (GRCm39) G478A probably damaging Het
Dnah2 T G 11: 69,407,307 (GRCm39) Y492S probably damaging Het
Dnah2 G A 11: 69,389,493 (GRCm39) H800Y probably benign Het
Dnah2 G C 11: 69,377,880 (GRCm39) N1317K possibly damaging Het
Dnah2 G T 11: 69,341,946 (GRCm39) Q2986K probably benign Het
Dnah3 A G 7: 119,567,026 (GRCm39) V13A Het
Dnah6 T A 6: 73,064,766 (GRCm39) E2605D possibly damaging Het
Dnah6 G T 6: 73,110,542 (GRCm39) T1681K probably benign Het
Dnah7a T G 1: 53,522,622 (GRCm39) K2872T probably damaging Het
Dnah7a A C 1: 53,458,858 (GRCm39) L3760R probably damaging Het
Dnah7c T A 1: 46,506,462 (GRCm39) L180M probably benign Het
Dnah7c T C 1: 46,799,476 (GRCm39) F3379L possibly damaging Het
Dnah7c A T 1: 46,686,152 (GRCm39) probably null Het
Dnah7c G C 1: 46,678,825 (GRCm39) V1790L probably benign Het
Dnah7c G T 1: 46,654,441 (GRCm39) G107V probably damaging Het
Dnah8 A G 17: 30,867,514 (GRCm39) K322R probably benign Het
Dnah9 C A 11: 65,963,661 (GRCm39) G1764V probably damaging Het
Dnah9 T A 11: 65,928,300 (GRCm39) Q2123L probably damaging Het
Dnah9 A T 11: 65,860,910 (GRCm39) L2820Q probably damaging Het
Dnah9 G T 11: 65,818,679 (GRCm39) L3220M probably damaging Het
Dnah9 T A 11: 65,786,798 (GRCm39) I3612F probably damaging Het
Dnai1 G T 4: 41,614,323 (GRCm39) R333L probably benign Het
Dnai4 T G 4: 102,929,968 (GRCm39) N341T probably benign Het
Dnai7 C A 6: 145,151,019 (GRCm39) E18* probably null Het
Dnajb6 G A 5: 29,957,443 (GRCm39) G75D possibly damaging Het
Dnajb8 A T 6: 88,199,892 (GRCm39) M143L possibly damaging Het
Dnajc1 C T 2: 18,298,798 (GRCm39) A259T possibly damaging Het
Dnajc11 G A 4: 152,018,240 (GRCm39) D11N probably benign Het
Dnajc28 G A 16: 91,413,921 (GRCm39) H108Y probably benign Het
Dner C A 1: 84,361,701 (GRCm39) R636L possibly damaging Het
Dnhd1 GT GTT 7: 105,352,787 (GRCm39) probably null Het
Dnhd1 A T 7: 105,352,243 (GRCm39) probably null Het
Dnhd1 G T 7: 105,327,506 (GRCm39) K50N probably benign Het
Dnhd1 A T 7: 105,317,754 (GRCm39) K483M probably damaging Het
Dnmbp T A 19: 43,877,806 (GRCm39) T422S probably benign Het
Dnmbp T A 19: 43,855,127 (GRCm39) K265N probably damaging Het
Dnmt1 C A 9: 20,837,850 (GRCm39) V381L probably benign Het
Dnmt1 T G 9: 20,827,159 (GRCm39) K979T probably damaging Het
Dnmt3a G T 12: 3,954,201 (GRCm39) W791L probably damaging Het
Doc2b A T 11: 75,667,898 (GRCm39) L284Q probably benign Het
Dock10 A C 1: 80,538,671 (GRCm39) L959V probably benign Het
Dock11 G T X: 35,248,501 (GRCm39) A699S possibly damaging Het
Dock2 A C 11: 34,609,751 (GRCm39) F230V probably benign Het
Dock4 G C 12: 40,681,615 (GRCm39) V105L probably benign Het
Dock4 A T 12: 40,681,613 (GRCm39) Y104F probably benign Het
Dock7 C A 4: 98,833,462 (GRCm39) G1945V unknown Het
Dock9 C A 14: 121,889,194 (GRCm39) G308C probably benign Het
Dop1b T A 16: 93,566,469 (GRCm39) S1083R probably benign Het
Dop1b G T 16: 93,600,434 (GRCm39) S2037I probably damaging Het
Dop1b G A 16: 93,604,756 (GRCm39) G2132E possibly damaging Het
Dpagt1 G T 9: 44,240,422 (GRCm39) V213L probably benign Het
Dpp10 C A 1: 123,281,169 (GRCm39) E627* probably null Het
Dpp3 T G 19: 4,972,369 (GRCm39) Q185P probably damaging Het
Dpp6 C A 5: 27,603,996 (GRCm39) A142E probably damaging Het
Dpysl5 G T 5: 30,935,464 (GRCm39) R189L probably benign Het
Drd2 G T 9: 49,306,955 (GRCm39) E14* probably null Het
Dsc1 C A 18: 20,247,595 (GRCm39) A7S probably benign Het
Dsc2 A T 18: 20,168,356 (GRCm39) L701Q probably damaging Het
Dsg1c G T 18: 20,416,630 (GRCm39) G844C probably damaging Het
Dsg2 C A 18: 20,713,678 (GRCm39) F216L probably damaging Het
Dsp C G 13: 38,381,166 (GRCm39) T2637R possibly damaging Het
Dst C G 1: 34,204,224 (GRCm39) A806G probably benign Het
Dst G C 1: 34,283,526 (GRCm39) E3330D probably benign Het
Dst A G 1: 34,314,289 (GRCm39) K4397E probably damaging Het
Dst G T 1: 34,227,548 (GRCm39) E1714* probably null Het
Dtx1 T C 5: 120,821,360 (GRCm39) S396G probably benign Het
Dtx3l G C 16: 35,753,553 (GRCm39) S351C probably damaging Het
Dtx3l C G 16: 35,752,827 (GRCm39) C593S probably damaging Het
Dtx4 C G 19: 12,469,273 (GRCm39) A285P probably benign Het
Duox1 G T 2: 122,163,519 (GRCm39) G784W probably damaging Het
Duox2 T C 2: 122,126,988 (GRCm39) T176A probably damaging Het
Dusp8 C A 7: 141,635,680 (GRCm39) G637W unknown Het
Dusp8 C G 7: 141,643,814 (GRCm39) R33P probably damaging Het
Dvl1 G T 4: 155,940,068 (GRCm39) G400V probably benign Het
Dvl3 G C 16: 20,349,631 (GRCm39) A535P probably damaging Het
Dydc2 C A 14: 40,783,940 (GRCm39) R61L probably benign Het
Dync1i2 G T 2: 71,078,228 (GRCm39) V306L probably benign Het
Dync2h1 G T 9: 7,142,361 (GRCm39) P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 (GRCm39) probably null Het
Dyrk1a A T 16: 94,492,621 (GRCm39) H618L probably benign Het
Dyrk4 T G 6: 126,869,091 (GRCm39) K240N probably damaging Het
Dysf T A 6: 84,049,667 (GRCm39) L372H probably damaging Het
Dzip1l G T 9: 99,523,814 (GRCm39) G205V possibly damaging Het
E030025P04Rik C A 11: 109,034,797 (GRCm39) Q30H unknown Het
E130114P18Rik G T 4: 97,457,437 (GRCm39) P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 (GRCm39) C615F probably damaging Het
E230025N22Rik T A 18: 36,828,877 (GRCm39) probably benign Het
E2f6 A C 12: 16,870,274 (GRCm39) K142T possibly damaging Het
E4f1 G A 17: 24,665,119 (GRCm39) S355L probably benign Het
Ears2 C G 7: 121,643,804 (GRCm39) G385R probably damaging Het
Ears2 C G 7: 121,654,933 (GRCm39) A112P possibly damaging Het
Ebna1bp2 A C 4: 118,478,343 (GRCm39) K44T probably damaging Het
Ece1 T G 4: 137,648,338 (GRCm39) F32V probably benign Het
Ecm1 T C 3: 95,642,188 (GRCm39) I466V probably benign Het
Edil3 G C 13: 89,092,989 (GRCm39) G40R probably benign Het
Eef2 G T 10: 81,016,992 (GRCm39) probably null Het
Efcab3 G C 11: 104,892,793 (GRCm39) G4247R probably benign Het
Efcab3 T G 11: 104,999,598 (GRCm39) Y162* probably null Het
Efcab3 C A 11: 104,990,872 (GRCm39) A93D probably damaging Het
Efcab5 C G 11: 77,022,965 (GRCm39) D583H probably damaging Het
Efcc1 G T 6: 87,709,778 (GRCm39) E257D probably benign Het
Efs C A 14: 55,157,793 (GRCm39) V173L probably benign Het
Egf C A 3: 129,491,366 (GRCm39) probably null Het
Ehbp1 G C 11: 22,045,590 (GRCm39) P720A probably benign Het
Ehbp1l1 T A 19: 5,767,917 (GRCm39) M1129L probably benign Het
Ehd3 C A 17: 74,112,280 (GRCm39) P15T probably benign Het
Ehf C A 2: 103,109,863 (GRCm39) G115C probably null Het
Eif2a G T 3: 58,456,305 (GRCm39) V435L probably benign Het
Eif2d C G 1: 131,092,239 (GRCm39) P337A probably damaging Het
Eif2d A T 1: 131,092,202 (GRCm39) K324N probably damaging Het
Eif3i C A 4: 129,494,368 (GRCm39) probably benign Het
Eif4a3l1 G C 6: 136,306,021 (GRCm39) A161P possibly damaging Het
Eif4e2 G A 1: 87,153,661 (GRCm39) M155I probably benign Het
Eif4g1 G T 16: 20,492,158 (GRCm39) probably benign Het
Eipr1 G T 12: 28,909,286 (GRCm39) Q184H probably benign Het
Elapor1 C A 3: 108,379,294 (GRCm39) G345C probably damaging Het
Elapor1 C A 3: 108,378,751 (GRCm39) W349L probably damaging Het
Ell A C 8: 71,031,577 (GRCm39) S92R probably damaging Het
Ell2 A T 13: 75,918,808 (GRCm39) N605Y probably damaging Het
Ell2 A C 13: 75,904,571 (GRCm39) K220T probably damaging Het
Elmod1 T G 9: 53,854,144 (GRCm39) K2T probably benign Het
Elovl5 G C 9: 77,884,037 (GRCm39) R111P possibly damaging Het
Elp1 T A 4: 56,790,146 (GRCm39) T315S probably benign Het
Eme1 A C 11: 94,541,522 (GRCm39) I100S possibly damaging Het
Eml4 G C 17: 83,753,394 (GRCm39) R355T probably damaging Het
Enam C A 5: 88,640,830 (GRCm39) P164H probably damaging Het
Eng G T 2: 32,563,436 (GRCm39) G331C probably null Het
Eng G C 2: 32,571,464 (GRCm39) R618P probably damaging Het
Eng C G 2: 32,561,434 (GRCm39) I148M possibly damaging Het
Enpp3 T G 10: 24,663,691 (GRCm39) T557P probably benign Het
Entpd1 G T 19: 40,727,408 (GRCm39) A519S probably benign Het
Entpd7 G C 19: 43,713,797 (GRCm39) L385F probably benign Het
Ep400 A C 5: 110,904,501 (GRCm39) L33V unknown Het
Epas1 C T 17: 87,135,374 (GRCm39) S669L possibly damaging Het
Epb41l2 A T 10: 25,375,800 (GRCm39) R80* probably null Het
Epb41l2 G T 10: 25,317,618 (GRCm39) G45V probably benign Het
Epc2 G T 2: 49,425,312 (GRCm39) G396C probably damaging Het
Epha10 G C 4: 124,779,568 (GRCm39) G138A probably damaging Het
Epha10 T C 4: 124,777,735 (GRCm39) W50R probably damaging Het
Epha3 G T 16: 63,405,375 (GRCm39) P695Q probably damaging Het
Epha4 T G 1: 77,359,648 (GRCm39) K735T probably damaging Het
Epha4 T C 1: 77,350,370 (GRCm39) *987W probably null Het
Epha5 C T 5: 84,218,979 (GRCm39) D765N possibly damaging Het
Epha8 C A 4: 136,666,007 (GRCm39) R383L probably benign Het
Ephb1 G A 9: 102,100,597 (GRCm39) P38L probably damaging Het
Ephb3 G T 16: 21,036,786 (GRCm39) G337V possibly damaging Het
Ephx3 T G 17: 32,404,211 (GRCm39) N343T probably damaging Het
Epop C A 11: 97,519,236 (GRCm39) R291L probably damaging Het
Eral1 T G 11: 77,966,446 (GRCm39) K244T probably damaging Het
Erap1 T A 13: 74,805,757 (GRCm39) L166H probably damaging Het
Erbb4 G T 1: 68,367,418 (GRCm39) S433* probably null Het
Erbb4 CA CAA 1: 68,337,561 (GRCm39) probably null Het
Ercc2 A C 7: 19,119,593 (GRCm39) S136R probably benign Het
Ercc6 A T 14: 32,248,444 (GRCm39) S332C probably benign Het
Ereg G T 5: 91,237,979 (GRCm39) G155V possibly damaging Het
Erg T G 16: 95,162,176 (GRCm39) Q317P probably damaging Het
Erg T G 16: 95,210,609 (GRCm39) Q81P possibly damaging Het
Erh C A 12: 80,689,578 (GRCm39) L15F probably benign Het
Erich2 C A 2: 70,339,458 (GRCm39) D4E possibly damaging Het
Erich3 G T 3: 154,468,067 (GRCm39) V840L Het
Erich3 T G 3: 154,404,338 (GRCm39) I65S Het
Ero1a G A 14: 45,537,347 (GRCm39) P193L probably damaging Het
Esp18 C T 17: 39,719,057 (GRCm39) L19F probably damaging Het
Esrp1 C T 4: 11,384,396 (GRCm39) G96R probably damaging Het
Esrp1 A T 4: 11,385,765 (GRCm39) L34Q possibly damaging Het
Ess2 C T 16: 17,720,174 (GRCm39) G393S possibly damaging Het
Etv4 C T 11: 101,661,416 (GRCm39) V412M probably damaging Het
Exoc3l2 C A 7: 19,213,986 (GRCm39) L471M probably null Het
Exoc3l4 G T 12: 111,390,154 (GRCm39) W243L probably damaging Het
Exoc8 C T 8: 125,623,405 (GRCm39) V321I possibly damaging Het
Eya1 G C 1: 14,322,654 (GRCm39) A270G probably benign Het
Eya1 G T 1: 14,373,092 (GRCm39) P9Q probably damaging Het
Ezhip T G X: 5,994,375 (GRCm39) E213D unknown Het
Ezhip G T X: 5,994,368 (GRCm39) P216T unknown Het
F5 C G 1: 164,012,085 (GRCm39) F434L probably damaging Het
F830045P16Rik G T 2: 129,378,450 (GRCm39) probably benign Het
Fabp1 A T 6: 71,176,939 (GRCm39) Q10L possibly damaging Het
Fads1 T A 19: 10,171,068 (GRCm39) L299M probably damaging Het
Fads2b C T 2: 85,348,806 (GRCm39) R102Q probably benign Het
Fads3 A T 19: 10,019,171 (GRCm39) I26F probably benign Het
Faf1 A G 4: 109,697,553 (GRCm39) D293G probably damaging Het
Fam124a T C 14: 62,843,857 (GRCm39) M455T probably benign Het
Fam124b A C 1: 80,191,120 (GRCm39) F88V possibly damaging Het
Fam149a C A 8: 45,795,495 (GRCm39) R672L possibly damaging Het
Fam161b G T 12: 84,402,827 (GRCm39) Q268K probably benign Het
Fam170a C A 18: 50,414,651 (GRCm39) A99D possibly damaging Het
Fam170b A C 14: 32,557,761 (GRCm39) N199H probably damaging Het
Fam171a2 C G 11: 102,338,272 (GRCm39) A24P unknown Het
Fam236f G A X: 101,750,633 (GRCm39) T72M probably benign Het
Fam240a T G 9: 110,745,577 (GRCm39) K29T probably damaging Het
Fam3b C A 16: 97,283,044 (GRCm39) R77L probably damaging Het
Fam47e G T 5: 92,727,527 (GRCm39) R145L possibly damaging Het
Fam83g C A 11: 61,598,296 (GRCm39) P728T probably benign Het
Fance T G 17: 28,537,038 (GRCm39) L14R probably damaging Het
Fancm A C 12: 65,141,700 (GRCm39) E440D probably benign Het
Fap C A 2: 62,359,118 (GRCm39) S428I possibly damaging Het
Farp2 T C 1: 93,507,858 (GRCm39) F519L probably benign Het
Farp2 G C 1: 93,508,183 (GRCm39) G627A probably benign Het
Farp2 G T 1: 93,508,189 (GRCm39) G629V probably benign Het
Fat1 G T 8: 45,489,875 (GRCm39) D3596Y probably damaging Het
Fat1 A C 8: 45,476,633 (GRCm39) H1893P possibly damaging Het
Fat1 G A 8: 45,403,635 (GRCm39) D129N probably benign Het
Fat2 T G 11: 55,194,526 (GRCm39) K1171T probably damaging Het
Fat2 G T 11: 55,175,817 (GRCm39) A1632E probably damaging Het
Fat2 A G 11: 55,173,621 (GRCm39) L2364P probably damaging Het
Fat2 T G 11: 55,200,947 (GRCm39) H709P probably damaging Het
Fat3 G T 9: 15,858,822 (GRCm39) P3798Q probably damaging Het
Fat3 T G 9: 16,286,913 (GRCm39) H870P probably benign Het
Fat3 G T 9: 16,286,725 (GRCm39) P933T probably damaging Het
Fat4 G T 3: 39,037,508 (GRCm39) G3720V probably benign Het
Fat4 C G 3: 39,037,964 (GRCm39) P3872R probably damaging Het
Fblim1 C T 4: 141,322,682 (GRCm39) A34T possibly damaging Het
Fbn1 C T 2: 125,229,270 (GRCm39) G504S possibly damaging Het
Fbxl16 G C 17: 26,035,985 (GRCm39) G194A possibly damaging Het
Fbxl18 T G 5: 142,872,179 (GRCm39) K352T possibly damaging Het
Fbxl19 CT C 7: 127,360,447 (GRCm39) probably null Het
Fbxl21 C A 13: 56,674,816 (GRCm39) L56I probably benign Het
Fbxl22 G T 9: 66,419,170 (GRCm39) R156S probably benign Het
Fbxl4 T C 4: 22,427,280 (GRCm39) L507P probably damaging Het
Fbxo17 G C 7: 28,432,202 (GRCm39) G93A unknown Het
Fbxo24 T G 5: 137,619,665 (GRCm39) K187T probably damaging Het
Fbxo28 T A 1: 182,145,435 (GRCm39) I218F probably damaging Het
Fbxo30 A T 10: 11,171,064 (GRCm39) E714V probably damaging Het
Fbxo32 C A 15: 58,068,638 (GRCm39) D115Y probably damaging Het
Fbxo40 T A 16: 36,789,961 (GRCm39) D383V probably damaging Het
Fbxo42 T G 4: 140,907,845 (GRCm39) probably null Het
Fbxw19 T C 9: 109,310,650 (GRCm39) K424R probably benign Het
Fbxw21 T C 9: 108,974,605 (GRCm39) H305R probably benign Het
Fbxw25 C A 9: 109,480,806 (GRCm39) W291C Het
Fcgbpl1 G A 7: 27,841,811 (GRCm39) S582N probably benign Het
Fcgbpl1 G A 7: 27,854,187 (GRCm39) G1717D probably benign Het
Fdx2 C A 9: 20,984,788 (GRCm39) M5I probably benign Het
Fer1l5 C A 1: 36,429,644 (GRCm39) Y465* probably null Het
Fermt1 G T 2: 132,777,938 (GRCm39) P177Q probably benign Het
Fermt1 C G 2: 132,748,676 (GRCm39) G649A probably damaging Het
Fermt1 G T 2: 132,783,863 (GRCm39) Q49K probably benign Het
Ffar3 A T 7: 30,554,618 (GRCm39) F234Y probably damaging Het
Fgd3 C A 13: 49,435,302 (GRCm39) D319Y probably damaging Het
Fgd5 A C 6: 91,965,870 (GRCm39) K701T probably damaging Het
Fgr C A 4: 132,727,481 (GRCm39) H461N probably benign Het
Fhip1a G T 3: 85,580,508 (GRCm39) L566I probably benign Het
Fhip2b G T 14: 70,823,644 (GRCm39) S575R not run Het
Fibcd1 G A 2: 31,728,551 (GRCm39) T102I probably benign Het
Flg A C 3: 93,187,269 (GRCm39) R240S probably benign Het
Flii C A 11: 60,613,139 (GRCm39) G221C possibly damaging Het
Flnb T G 14: 7,942,066 (GRCm38) I2348S probably benign Het
Flot1 A C 17: 36,136,715 (GRCm39) K219T probably damaging Het
Flrt2 G T 12: 95,745,686 (GRCm39) W8L possibly damaging Het
Flrt2 G T 12: 95,746,333 (GRCm39) G224C probably damaging Het
Flywch1 A C 17: 23,979,983 (GRCm39) W264G probably benign Het
Fmn2 G T 1: 174,435,960 (GRCm39) V644L unknown Het
Fmo2 C A 1: 162,725,843 (GRCm39) G11V probably damaging Het
Fmo2 G T 1: 162,715,167 (GRCm39) Q152K probably benign Het
Fmo6 G C 1: 162,753,701 (GRCm39) S147* probably null Het
Fmod T G 1: 133,968,657 (GRCm39) Y232* probably null Het
Fn1 C G 1: 71,636,570 (GRCm39) G2194A probably benign Het
Fndc1 C A 17: 7,992,425 (GRCm39) G424* probably null Het
Fndc1 T G 17: 8,023,709 (GRCm39) K82T possibly damaging Het
Fndc3a C A 14: 72,804,813 (GRCm39) K489N probably damaging Het
Fndc3c1 G T X: 105,477,935 (GRCm39) P767T not run Het
Foxd1 G C 13: 98,492,446 (GRCm39) G440A unknown Het
Foxd3 C A 4: 99,545,303 (GRCm39) P148T probably damaging Het
Foxf1 G T 8: 121,811,268 (GRCm39) R44L probably damaging Het
Foxi1 G T 11: 34,157,488 (GRCm39) P179H probably damaging Het
Foxi3 G A 6: 70,933,782 (GRCm39) A90T probably benign Het
Foxj2 A T 6: 122,809,895 (GRCm39) probably null Het
Foxj2 G T 6: 122,810,670 (GRCm39) A217S probably benign Het
Foxo3 T TG 10: 42,151,261 (GRCm39) probably null Het
Fpgs C T 2: 32,582,672 (GRCm39) R67H probably benign Het
Fpr3 C A 17: 18,191,255 (GRCm39) H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,333,655 (GRCm39) W278C probably benign Het
Fras1 T C 5: 96,906,001 (GRCm39) L3135P probably benign Het
Frem1 C A 4: 82,918,220 (GRCm39) G574V probably damaging Het
Frem3 C A 8: 81,338,132 (GRCm39) R142S probably damaging Het
Frem3 T C 8: 81,342,060 (GRCm39) L1451P probably benign Het
Frg1 T A 8: 41,852,675 (GRCm39) R186* probably null Het
Frmd4a A G 2: 4,502,832 (GRCm39) D107G probably damaging Het
Frmpd3 G T X: 139,333,759 (GRCm39) E1575* probably null Het
Fryl T C 5: 73,230,180 (GRCm39) D1659G probably benign Het
Fscb T G 12: 64,519,704 (GRCm39) E587D unknown Het
Fsd2 T C 7: 81,202,940 (GRCm39) E213G probably damaging Het
Fshr C G 17: 89,354,095 (GRCm39) A88P probably benign Het
Fsip1 G T 2: 117,966,964 (GRCm39) L454I possibly damaging Het
Fsip2 G T 2: 82,820,009 (GRCm39) M5247I probably benign Het
Fstl3 G C 10: 79,617,032 (GRCm39) V192L probably benign Het
Fstl5 A T 3: 76,615,289 (GRCm39) K783N probably damaging Het
Fubp1 G A 3: 151,927,724 (GRCm39) G391D probably damaging Het
Fxn C G 19: 24,239,406 (GRCm39) R162P probably damaging Het
Fyb2 G C 4: 104,770,857 (GRCm39) Q57H probably damaging Het
Gabpb2 G T 3: 95,098,004 (GRCm39) T223N probably benign Het
Gabra3 C T X: 71,488,959 (GRCm39) S322N probably damaging Het
Gabra4 G T 5: 71,781,238 (GRCm39) A391D probably benign Het
Gabrp T C 11: 33,502,673 (GRCm39) E397G probably benign Het
Gabrr3 C A 16: 59,227,845 (GRCm39) S34* probably null Het
Gadd45a C A 6: 67,013,720 (GRCm39) G109V probably benign Het
Gal3st2b T G 1: 93,866,407 (GRCm39) L36R probably damaging Het
Galm C G 17: 80,490,662 (GRCm39) T273S possibly damaging Het
Galnt9 CG C 5: 110,744,012 (GRCm39) probably null Het
Galntl5 C A 5: 25,408,187 (GRCm39) P220T probably damaging Het
Galntl6 A C 8: 58,310,592 (GRCm39) Y370D probably damaging Het
Garem1 T G 18: 21,262,849 (GRCm39) K655T probably damaging Het
Garem1 G A 18: 21,281,382 (GRCm39) H325Y probably damaging Het
Garin4 C T 1: 190,895,942 (GRCm39) V234I probably benign Het
Gatad2a T A 8: 70,388,688 (GRCm39) probably null Het
Gba1 A T 3: 89,111,312 (GRCm39) K26* probably null Het
Gbp3 G A 3: 142,267,624 (GRCm39) V34M probably damaging Het
Gck C A 11: 5,856,526 (GRCm39) M210I probably damaging Het
Gckr G T 5: 31,458,175 (GRCm39) R172I probably damaging Het
Gdap1l1 G T 2: 163,289,590 (GRCm39) R185L probably damaging Het
Gdf10 C T 14: 33,654,489 (GRCm39) T332M possibly damaging Het
Gdf15 T C 8: 71,082,540 (GRCm39) S189G probably benign Het
Gdf7 C T 12: 8,348,409 (GRCm39) R304H unknown Het
Gdf7 G T 12: 8,348,578 (GRCm39) P240T unknown Het
Gdf9 C A 11: 53,328,352 (GRCm39) T436K probably damaging Het
Gemin4 G T 11: 76,108,405 (GRCm39) probably benign Het
Gga3 T G 11: 115,478,429 (GRCm39) Q454H probably benign Het
Ggt5 A G 10: 75,438,452 (GRCm39) probably null Het
Ggt7 T A 2: 155,340,983 (GRCm39) N394I probably damaging Het
Ggt7 T A 2: 155,332,998 (GRCm39) R622W probably damaging Het
Gh G C 11: 106,192,010 (GRCm39) R67G probably damaging Het
Ghdc A G 11: 100,660,243 (GRCm39) L168P probably benign Het
Ghr A G 15: 3,376,967 (GRCm39) Y85H probably benign Het
Gimap1 A C 6: 48,720,183 (GRCm39) K265T probably damaging Het
Gimap1 T G 6: 48,720,290 (GRCm39) *301E probably null Het
Gimap7 C A 6: 48,701,087 (GRCm39) D224E probably benign Het
Gins3 G T 8: 96,360,148 (GRCm39) probably benign Het
Gjd3 C A 11: 102,690,834 (GRCm39) G390W unknown Het
Glcci1 A T 6: 8,582,674 (GRCm39) Q345L possibly damaging Het
Glipr1 G T 10: 111,824,742 (GRCm39) P155T probably benign Het
Glis3 G C 19: 28,261,168 (GRCm39) P791R possibly damaging Het
Glra3 G T 8: 56,515,535 (GRCm39) M203I probably benign Het
Gls C G 1: 52,253,647 (GRCm39) D274H probably damaging Het
Gm10300 C G 4: 131,802,120 (GRCm39) P38R unknown Het
Gm10340 A G 14: 14,826,710 (GRCm39) R60G possibly damaging Het
Gm10803 G C 2: 93,394,481 (GRCm39) Q84H unknown Het
Gm11565 C T 11: 99,805,677 (GRCm39) S23F possibly damaging Het
Gm11567 C A 11: 99,770,247 (GRCm39) Q62K unknown Het
Gm11567 C A 11: 99,770,451 (GRCm39) Q130K unknown Het
Gm11567 G A 11: 99,770,158 (GRCm39) S32N unknown Het
Gm11983 T C 11: 6,787,047 (GRCm39) K27E unknown Het
Gm11983 T G 11: 6,786,861 (GRCm39) K89Q unknown Het
Gm12185 T G 11: 48,798,913 (GRCm39) I527L probably benign Het
Gm12888 G T 4: 121,182,005 (GRCm39) P29H probably damaging Het
Gm15130 A G 2: 110,974,932 (GRCm39) probably null Het
Gm16503 A C 4: 147,625,613 (GRCm39) T36P unknown Het
Gm17019 C T 5: 15,083,011 (GRCm39) probably benign Het
Gm17124 A G 14: 42,419,180 (GRCm39) probably null Het
Gm19410 G T 8: 36,259,765 (GRCm39) W800L possibly damaging Het
Gm21083 T G 5: 15,782,456 (GRCm39) V41G probably benign Het
Gm21149 G C 5: 15,681,410 (GRCm39) R18G not run Het
Gm21149 G T 5: 15,677,146 (GRCm39) A236D probably damaging Het
Gm21190 G A 5: 15,729,892 (GRCm39) P242L probably benign Het
Gm21190 A C 5: 15,729,972 (GRCm39) D215E not run Het
Gm21190 G T 5: 15,731,578 (GRCm39) T136N probably benign Het
Gm21680 C T 5: 26,176,417 (GRCm39) S60N probably benign Het
Gm21886 G T 18: 80,133,138 (GRCm39) L14M probably damaging Het
Gm21886 G C 18: 80,132,602 (GRCm39) Y185* probably null Het
Gm28729 C T 9: 96,374,141 (GRCm39) R401H unknown Het
Gm29609 A T 5: 31,311,586 (GRCm39) W852R probably benign Het
Gm29797 G C 2: 181,300,888 (GRCm39) A128P probably damaging Het
Gm3238 G T 10: 77,606,858 (GRCm39) P101Q unknown Het
Gm32742 G A 9: 51,070,465 (GRCm39) Q76* probably null Het
Gm3285 G A 10: 77,698,268 (GRCm39) C139Y unknown Het
Gm3543 T G 14: 41,802,964 (GRCm39) N60T probably damaging Het
Gm45618 T C 7: 141,673,955 (GRCm39) K171R unknown Het
Gm45861 G A 8: 28,074,897 (GRCm39) G1416S unknown Het
Gm4779 G T X: 100,835,792 (GRCm39) P504H unknown Het
Gm47985 T C 1: 151,058,892 (GRCm39) S178P possibly damaging Het
Gm49336 C A 14: 60,476,951 (GRCm39) C240F probably null Het
Gm5111 C A 6: 48,567,243 (GRCm39) L153M unknown Het
Gm5592 C A 7: 40,938,105 (GRCm39) D462E probably benign Het
Gm5592 G A 7: 40,935,743 (GRCm39) E82K possibly damaging Het
Gm5592 C G 7: 40,935,741 (GRCm39) T81R probably damaging Het
Gm57858 T C 3: 36,073,037 (GRCm39) Q415R possibly damaging Het
Gm5862 TGGG TGG 5: 26,223,485 (GRCm39) probably null Het
Gm6377 T G X: 108,241,899 (GRCm39) L160R probably damaging Het
Gm6871 C A 7: 41,195,837 (GRCm39) G300V probably damaging Het
Gm7138 C G 10: 77,612,687 (GRCm39) C31S unknown Het
Gm7145 A C 1: 117,914,081 (GRCm39) K321T probably benign Het
Gm7298 G T 6: 121,741,834 (GRCm39) D419Y possibly damaging Het
Gm7298 A C 6: 121,741,829 (GRCm39) E417A probably benign Het
Gm7579 G T 7: 141,765,678 (GRCm39) G28V unknown Het
Gm8369 G C 19: 11,488,988 (GRCm39) A92P probably damaging Het
Gm973 T G 1: 59,563,761 (GRCm39) probably benign Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9887 C A 12: 69,418,715 (GRCm39) W173L not run Het
Gm9964 T C 11: 79,187,226 (GRCm39) R74G unknown Het
Gmip C T 8: 70,268,942 (GRCm39) R496W probably damaging Het
Gmpr2 T G 14: 55,910,200 (GRCm39) L10R probably benign Het
Gna12 C A 5: 140,748,362 (GRCm39) D185Y probably damaging Het
Gna12 T A 5: 140,746,308 (GRCm39) Q379L probably damaging Het
Gnas C A 2: 174,140,399 (GRCm39) P249T unknown Het
Gnptab G T 10: 88,267,230 (GRCm39) E440D probably damaging Het
Gpa33 C A 1: 165,992,240 (GRCm39) C261* probably null Het
Gpat2 C A 2: 127,272,802 (GRCm39) F171L probably benign Het
Gpat2 G C 2: 127,275,728 (GRCm39) G502A probably damaging Het
Gpat4 C G 8: 23,669,814 (GRCm39) S313T probably benign Het
Gpatch1 C A 7: 35,009,910 (GRCm39) G55C probably damaging Het
Gpc5 T A 14: 115,607,376 (GRCm39) L326Q probably damaging Het
Gpd1l C A 9: 114,733,848 (GRCm39) G283W probably damaging Het
Gpnmb C A 6: 49,028,766 (GRCm39) A428D possibly damaging Het
Gpr101 T G X: 56,546,634 (GRCm39) H172P probably benign Het
Gpr158 G T 2: 21,815,501 (GRCm39) probably null Het
Gpr179 G C 11: 97,227,474 (GRCm39) S1560R probably benign Het
Gpr26 C G 7: 131,568,954 (GRCm39) L100V probably damaging Het
Gpr26 C A 7: 131,568,777 (GRCm39) P41T probably damaging Het
Gpr39 G T 1: 125,800,580 (GRCm39) G444W probably damaging Het
Gprasp2 G T X: 134,743,642 (GRCm39) G334W probably damaging Het
Gprin1 C A 13: 54,888,210 (GRCm39) Q21H probably benign Het
Gpsm1 G T 2: 26,217,357 (GRCm39) Q408H possibly damaging Het
Grb10 C A 11: 11,894,845 (GRCm39) A359S possibly damaging Het
Grb7 G T 11: 98,344,797 (GRCm39) probably null Het
Grb7 G C 11: 98,345,310 (GRCm39) G456R probably damaging Het
Greb1 C A 12: 16,746,757 (GRCm39) C1171F probably benign Het
Greb1l G C 18: 10,515,305 (GRCm39) G699A probably damaging Het
Grep1 G C 17: 23,934,737 (GRCm39) A96G possibly damaging Het
Gria3 C A X: 40,567,524 (GRCm39) A113D probably benign Het
Grid2 G A 6: 63,885,863 (GRCm39) M86I possibly damaging Het
Grid2 A G 6: 64,640,212 (GRCm39) Q810R probably benign Het
Grik5 T A 7: 24,713,229 (GRCm39) D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,187,919 (GRCm39) probably null Het
Grin3a A G 4: 49,770,622 (GRCm39) S717P probably damaging Het
Grip1 C A 10: 119,655,388 (GRCm39) probably benign Het
Grip2 G C 6: 91,740,491 (GRCm39) P1023A possibly damaging Het
Grk2 C G 19: 4,337,673 (GRCm39) M568I probably benign Het
Grk3 C A 5: 113,105,180 (GRCm39) probably null Het
Grm5 G T 7: 87,251,923 (GRCm39) G58W probably damaging Het
Grm6 C A 11: 50,750,364 (GRCm39) P509H probably benign Het
Grm7 A G 6: 111,335,110 (GRCm39) E507G probably benign Het
Grm7 G T 6: 111,335,451 (GRCm39) V621F probably damaging Het
Grm8 G C 6: 28,126,026 (GRCm39) S33R probably benign Het
Grpr A G X: 162,298,030 (GRCm39) L338P probably damaging Het
Grtp1 T G 8: 13,250,199 (GRCm39) I17L probably benign Het
Gsdma C A 11: 98,560,585 (GRCm39) P179H probably damaging Het
Gsk3b A T 16: 38,028,432 (GRCm39) K297* probably null Het
Gspt2 GC G X: 93,681,074 (GRCm39) probably null Het
Gsta13 T A 9: 78,166,045 (GRCm39) C18S probably benign Het
Gtf2h3 G T 5: 124,717,238 (GRCm39) probably benign Het
Gtf2i C A 5: 134,292,499 (GRCm39) G415V probably null Het
Gtf2ird1 T G 5: 134,438,166 (GRCm39) probably null Het
Gtf3a G A 5: 146,888,014 (GRCm39) C105Y probably damaging Het
Gtf3c1 T A 7: 125,303,136 (GRCm39) I100F probably damaging Het
Gtse1 A G 15: 85,752,947 (GRCm39) K354R possibly damaging Het
Guca1a T C 17: 47,711,335 (GRCm39) I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 (GRCm39) K400T probably damaging Het
Gulp1 C A 1: 44,827,639 (GRCm39) D260E probably damaging Het
Gxylt2 T G 6: 100,760,152 (GRCm39) L229R probably damaging Het
Gykl1 A G 18: 52,827,619 (GRCm39) K276E probably damaging Het
H1f5 T C 13: 21,964,264 (GRCm39) K154R unknown Het
H2ac21 G T 3: 96,127,367 (GRCm39) A46S probably benign Het
H2-Eb2 A C 17: 34,553,283 (GRCm39) E156D possibly damaging Het
H2-M11 A C 17: 36,859,662 (GRCm39) R218S possibly damaging Het
H2-Q2 A C 17: 35,564,651 (GRCm39) Q351P probably damaging Het
H2-T3 C G 17: 36,497,472 (GRCm39) L382F possibly damaging Het
H2-T3 A T 17: 36,497,474 (GRCm39) L382M possibly damaging Het
H4c9 C A 13: 22,225,384 (GRCm39) R37L probably damaging Het
Habp2 T C 19: 56,306,192 (GRCm39) V426A probably damaging Het
Hacd1 C A 2: 14,040,606 (GRCm39) M216I probably damaging Het
Hacd2 G T 16: 34,926,695 (GRCm39) Q231H probably damaging Het
Hace1 A T 10: 45,562,758 (GRCm39) N758Y probably damaging Het
Hal G A 10: 93,325,755 (GRCm39) M89I probably benign Het
Hbb-bt A G 7: 103,463,099 (GRCm39) probably benign Het
Hc T A 2: 34,896,285 (GRCm39) probably null Het
Hcar1 T A 5: 124,017,804 (GRCm39) probably benign Het
Hcfc2 G C 10: 82,535,006 (GRCm39) R10T probably damaging Het
Hcls1 G T 16: 36,781,854 (GRCm39) R321M possibly damaging Het
Hcn4 G T 9: 58,765,431 (GRCm39) G638C unknown Het
Hdac1 T A 4: 129,436,409 (GRCm39) Q5L probably benign Het
Hdac9 G T 12: 34,423,986 (GRCm39) T536K probably benign Het
Hdgfl2 G T 17: 56,386,825 (GRCm39) R24L possibly damaging Het
Hdgfl2 G T 17: 56,404,016 (GRCm39) A281S probably null Het
Heatr1 T G 13: 12,413,889 (GRCm39) N155K possibly damaging Het
Hecw1 G A 13: 14,474,918 (GRCm39) A540V possibly damaging Het
Hells G T 19: 38,953,851 (GRCm39) R765S possibly damaging Het
Helq C A 5: 100,914,632 (GRCm39) L953F possibly damaging Het
Helz2 G C 2: 180,879,357 (GRCm39) P754A probably benign Het
Heph G C X: 95,598,528 (GRCm39) E919Q probably damaging Het
Herc1 A C 9: 66,341,858 (GRCm39) E1882D probably benign Het
Herc2 G A 7: 55,781,040 (GRCm39) G1235D probably benign Het
Herc2 G A 7: 55,747,281 (GRCm39) V473I possibly damaging Het
Herc2 G T 7: 55,782,246 (GRCm39) G1311V probably damaging Het
Herc3 G T 6: 58,820,843 (GRCm39) E76* probably null Het
Herc4 T G 10: 63,143,528 (GRCm39) I686S probably benign Het
Herc6 G T 6: 57,577,016 (GRCm39) G243V probably damaging Het
Herpud2 C G 9: 25,041,918 (GRCm39) V85L not run Het
Hexd C A 11: 121,106,063 (GRCm39) P117T probably damaging Het
Hip1r A G 5: 124,135,073 (GRCm39) Q403R probably damaging Het
Hivep3 C T 4: 119,990,979 (GRCm39) R2160W probably damaging Het
Hlcs A C 16: 94,063,518 (GRCm39) L367R probably damaging Het
Hmcn1 A G 1: 150,539,668 (GRCm39) V2941A probably benign Het
Hmcn1 G T 1: 150,462,196 (GRCm39) Q5161K probably null Het
Hmcn1 A G 1: 150,531,672 (GRCm39) V3199A possibly damaging Het
Hmcn2 C A 2: 31,315,428 (GRCm39) L3726M probably damaging Het
Hmcn2 G T 2: 31,319,103 (GRCm39) R3934S probably damaging Het
Hmcn2 G C 2: 31,234,041 (GRCm39) D269H possibly damaging Het
Hmga2 G C 10: 120,206,576 (GRCm39) P113A unknown Het
Hmgcs2 G A 3: 98,198,261 (GRCm39) G55S probably damaging Het
Hmx2 A T 7: 131,156,196 (GRCm39) E54V probably damaging Het
Hnf1a CA C 5: 115,088,183 (GRCm39) probably null Het
Hnrnpa2b1 G T 6: 51,444,223 (GRCm39) T20N probably damaging Het
Hnrnpf G A 6: 117,900,745 (GRCm39) G10S probably benign Het
Hnrnph2 G T X: 133,505,882 (GRCm39) E76* probably null Het
Hnrnpu T G 1: 178,159,780 (GRCm39) N434H unknown Het
Hnrnpul1 C A 7: 25,424,089 (GRCm39) S721I probably benign Het
Hnrnpul1 G C 7: 25,424,123 (GRCm39) P710A unknown Het
Hoxb1 C A 11: 96,257,877 (GRCm39) P269Q probably benign Het
Hoxd9 G C 2: 74,528,472 (GRCm39) A25P probably damaging Het
Hp1bp3 C T 4: 137,948,984 (GRCm39) L16F not run Het
Hpd C A 5: 123,319,538 (GRCm39) G49V probably damaging Het
Hps1 C A 19: 42,755,125 (GRCm39) R272S probably null Het
Hsd17b13 G T 5: 104,116,571 (GRCm39) P184T probably benign Het
Hsd17b3 C T 13: 64,210,952 (GRCm39) G182S possibly damaging Het
Hsd3b1 T G 3: 98,760,202 (GRCm39) Q263P probably damaging Het
Hsd3b2 C T 3: 98,619,538 (GRCm39) E136K probably benign Het
Hsd3b3 A G 3: 98,651,276 (GRCm39) V58A probably benign Het
Hsd3b9 G T 3: 98,363,771 (GRCm39) Q25K probably benign Het
Hsdl2 A T 4: 59,617,706 (GRCm39) K478* probably null Het
Hspa1l G C 17: 35,197,468 (GRCm39) K502N possibly damaging Het
Htr1f G T 16: 64,746,440 (GRCm39) S284* probably null Het
Htr1f G T 16: 64,747,237 (GRCm39) N18K probably benign Het
Htr7 G T 19: 35,946,823 (GRCm39) T397N probably damaging Het
Htra2 C A 6: 83,031,364 (GRCm39) R15L probably benign Het
Hunk C A 16: 90,269,461 (GRCm39) P335H probably damaging Het
Huwe1 A C X: 150,711,377 (GRCm39) K3958T unknown Het
Huwe1 C A X: 150,639,571 (GRCm39) H356N probably damaging Het
Hyal4 G A 6: 24,756,627 (GRCm39) V282M probably damaging Het
Hydin T G 8: 111,268,232 (GRCm39) F2904V possibly damaging Het
Hyou1 G T 9: 44,299,039 (GRCm39) E621* probably null Het
Ice1 C A 13: 70,753,320 (GRCm39) C922F probably damaging Het
Ide C T 19: 37,292,890 (GRCm39) V238M Het
Idh3b T A 2: 130,123,462 (GRCm39) probably null Het
Ifi204 C A 1: 173,579,194 (GRCm39) K550N probably null Het
Ifi206 T G 1: 173,309,614 (GRCm39) K127N Het
Ifi27l2b C A 12: 103,423,292 (GRCm39) G7C unknown Het
Ifi44 A G 3: 151,438,090 (GRCm39) L399P probably damaging Het
Ifih1 T G 2: 62,447,813 (GRCm39) Q297P probably benign Het
Ifitm1 C A 7: 140,549,430 (GRCm39) T71K probably benign Het
Ifna5 C T 4: 88,754,236 (GRCm39) H159Y probably damaging Het
Ifnab T G 4: 88,608,955 (GRCm39) E170D probably damaging Het
Ift122 A C 6: 115,892,955 (GRCm39) D854A probably damaging Het
Ift172 C A 5: 31,434,268 (GRCm39) W490L probably damaging Het
Igfbp4 C G 11: 98,942,341 (GRCm39) P234R probably damaging Het
Igfn1 G T 1: 135,899,738 (GRCm39) H524Q probably damaging Het
Ighv1-12 C A 12: 114,579,633 (GRCm39) G63V possibly damaging Het
Ighv14-4 C G 12: 114,140,292 (GRCm39) L39F probably damaging Het
Ighv14-4 C A 12: 114,140,287 (GRCm39) C41F probably damaging Het
Ighv1-52 C A 12: 115,109,397 (GRCm39) V21F probably damaging Het
Ighv1-63 C T 12: 115,459,265 (GRCm39) A111T possibly damaging Het
Ighv1-69 A C 12: 115,586,873 (GRCm39) S87A probably benign Het
Ighv1-9 T G 12: 114,547,454 (GRCm39) E29A probably benign Het
Igkv1-35 C T 6: 69,988,018 (GRCm39) G93R possibly damaging Het
Igkv1-99 T A 6: 68,519,246 (GRCm39) S68T Het
Igkv3-12 A T 6: 70,495,595 (GRCm39) I41F probably benign Het
Igkv4-74 T C 6: 69,162,329 (GRCm39) Q6R possibly damaging Het
Igkv6-32 T A 6: 70,051,570 (GRCm39) probably benign Het
Igsf21 A T 4: 139,794,526 (GRCm39) C116S probably damaging Het
Igsf5 C G 16: 96,192,223 (GRCm39) S274C probably damaging Het
Igsf8 G T 1: 172,145,921 (GRCm39) A406S probably damaging Het
Igsf9 G C 1: 172,319,716 (GRCm39) G337A probably damaging Het
Igsf9 G T 1: 172,322,793 (GRCm39) A586S probably benign Het
Igsf9b A G 9: 27,228,649 (GRCm39) probably null Het
Ihh T G 1: 74,985,253 (GRCm39) S411R probably damaging Het
Ik G T 18: 36,886,568 (GRCm39) D347Y possibly damaging Het
Ikzf1 G T 11: 11,708,194 (GRCm39) probably null Het
Ikzf3 T G 11: 98,358,007 (GRCm39) E443D probably benign Het
Ikzf4 G A 10: 128,470,099 (GRCm39) P527S possibly damaging Het
Il10ra A C 9: 45,177,930 (GRCm39) S67A possibly damaging Het
Il16 C G 7: 83,302,035 (GRCm39) S727T probably benign Het
Il17rc G T 6: 113,453,756 (GRCm39) probably null Het
Il1rap G T 16: 26,541,149 (GRCm39) R463S probably damaging Het
Il27ra C A 8: 84,767,619 (GRCm39) W101C probably damaging Het
Il2ra C A 2: 11,686,742 (GRCm39) A191D probably damaging Het
Il6st A G 13: 112,630,152 (GRCm39) K333E probably benign Het
Impg1 C G 9: 80,285,749 (GRCm39) R418S probably benign Het
Inava C A 1: 136,147,521 (GRCm39) R399L possibly damaging Het
Incenp C A 19: 9,855,051 (GRCm39) W620L unknown Het
Inhbb C A 1: 119,345,528 (GRCm39) V254L probably benign Het
Inpp4b C G 8: 82,795,630 (GRCm39) A818G possibly damaging Het
Inpp5b CA C 4: 124,691,633 (GRCm39) probably null Het
Inpp5d T G 1: 87,597,431 (GRCm39) F201V probably benign Het
Inpp5d T G 1: 87,630,853 (GRCm39) L671W probably damaging Het
Inpp5j G T 11: 3,452,484 (GRCm39) Y255* probably null Het
Insc C T 7: 114,410,874 (GRCm39) Q244* probably null Het
Insm1 C T 2: 146,065,476 (GRCm39) Q431* probably null Het
Insyn2a G T 7: 134,520,435 (GRCm39) L32I probably damaging Het
Ints12 A C 3: 132,808,225 (GRCm39) D201A probably damaging Het
Ints6l G A X: 55,543,295 (GRCm39) M527I probably damaging Het
Ints9 G A 14: 65,274,903 (GRCm39) V620I probably benign Het
Ipo13 C A 4: 117,761,827 (GRCm39) E458* probably null Het
Ipp G T 4: 116,395,082 (GRCm39) G539V probably null Het
Iqca1 A T 1: 89,973,447 (GRCm39) V775E probably benign Het
Iqcf3 G T 9: 106,438,187 (GRCm39) P12Q unknown Het
Iqck C A 7: 118,540,877 (GRCm39) R259S probably benign Het
Iqgap1 C A 7: 80,418,057 (GRCm39) K104N probably benign Het
Iqgap2 A G 13: 95,867,951 (GRCm39) I219T possibly damaging Het
Irag1 C T 7: 110,523,206 (GRCm39) R79H probably benign Het
Irgq G T 7: 24,231,226 (GRCm39) G139V probably damaging Het
Irs2 T G 8: 11,056,185 (GRCm39) D749A probably damaging Het
Irx6 C A 8: 93,404,999 (GRCm39) P289H possibly damaging Het
Isl2 C A 9: 55,449,499 (GRCm39) C58* probably null Het
Ism1 A C 2: 139,573,794 (GRCm39) N48T probably benign Het
Itga7 A C 10: 128,789,696 (GRCm39) K1012T probably benign Het
Itga8 C A 2: 12,266,947 (GRCm39) A163S probably benign Het
Itga8 C A 2: 12,306,643 (GRCm39) probably benign Het
Itga8 A C 2: 12,252,329 (GRCm39) F294V probably damaging Het
Itga9 G A 9: 118,716,907 (GRCm39) V990M probably damaging Het
Itga9 A C 9: 118,672,598 (GRCm39) D790A probably benign Het
Itgad T A 7: 127,789,259 (GRCm39) N574K probably damaging Het
Itgax G C 7: 127,744,044 (GRCm39) R909T probably benign Het
Itgb2 A T 10: 77,393,796 (GRCm39) Q412L probably benign Het
Itgb3 G T 11: 104,534,449 (GRCm39) K435N possibly damaging Het
Itgb4 G A 11: 115,897,346 (GRCm39) G1536R probably damaging Het
Itgb6 G C 2: 60,441,812 (GRCm39) S666C possibly damaging Het
Itgbl1 G T 14: 124,192,084 (GRCm39) G373C probably damaging Het
Itih4 GAA G 14: 30,621,419 (GRCm39) probably null Het
Itm2c G A 1: 85,834,248 (GRCm39) V188M possibly damaging Het
Itpka G C 2: 119,573,281 (GRCm39) S141T probably damaging Het
Itpkc C A 7: 26,927,063 (GRCm39) D284Y probably benign Het
Itpr1 T A 6: 108,476,110 (GRCm39) W2275R probably damaging Het
Ivd G T 2: 118,706,825 (GRCm39) K272N possibly damaging Het
Ivns1abp A G 1: 151,226,784 (GRCm39) E12G probably damaging Het
Jak1 C T 4: 101,020,919 (GRCm39) M640I probably benign Het
Jak1 C A 4: 101,020,878 (GRCm39) G654V probably damaging Het
Jak2 G A 19: 29,248,798 (GRCm39) E92K possibly damaging Het
Jak3 C G 8: 72,133,327 (GRCm39) A340G possibly damaging Het
Jakmip3 G T 7: 138,621,862 (GRCm39) R254L probably benign Het
Jmjd1c T C 10: 67,073,953 (GRCm39) L1896P probably benign Het
Jph1 C T 1: 17,167,576 (GRCm39) E85K possibly damaging Het
Jph4 G A 14: 55,351,105 (GRCm39) R304C probably benign Het
Jun T A 4: 94,939,615 (GRCm39) probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,666,531 (GRCm39) probably null Het
Kash5 C G 7: 44,833,678 (GRCm39) probably null Het
Kat6a C G 8: 23,400,170 (GRCm39) C310W probably damaging Het
Katna1 G T 10: 7,635,549 (GRCm39) S328I probably damaging Het
Katnal2 T C 18: 77,099,753 (GRCm39) K127R probably benign Het
Kbtbd2 T G 6: 56,757,294 (GRCm39) E147D probably damaging Het
Kcna3 A T 3: 106,944,582 (GRCm39) N282Y probably damaging Het
Kcna5 T A 6: 126,510,679 (GRCm39) K483M probably damaging Het
Kcnb1 G T 2: 167,030,322 (GRCm39) D74E probably damaging Het
Kcne2 C T 16: 92,093,479 (GRCm39) A2V probably benign Het
Kcnh1 C A 1: 192,101,045 (GRCm39) R573S probably damaging Het
Kcnh8 C A 17: 53,201,089 (GRCm39) L508I probably damaging Het
Kcnj2 G T 11: 110,962,961 (GRCm39) V118L probably benign Het
Kcnk18 G T 19: 59,223,391 (GRCm39) A179S probably benign Het
Kcnq4 A C 4: 120,555,694 (GRCm39) probably null Het
Kcns1 G A 2: 164,010,553 (GRCm39) H69Y probably benign Het
Kcnt1 G C 2: 25,796,808 (GRCm39) R809P probably benign Het
Kcnt2 G C 1: 140,304,099 (GRCm39) W156C probably damaging Het
Kcnv2 G T 19: 27,300,838 (GRCm39) A230S probably benign Het
Kcp T A 6: 29,485,011 (GRCm39) E1247V probably benign Het
Kctd1 C T 18: 15,196,182 (GRCm39) S147N unknown Het
Kctd12 C G 14: 103,219,354 (GRCm39) G175R not run Het
Kctd19 A C 8: 106,111,768 (GRCm39) F842V probably damaging Het
Kdm3b G T 18: 34,942,122 (GRCm39) E738* probably null Het
Kdm4a T A 4: 118,034,699 (GRCm39) S11C probably benign Het
Kdm4a C T 4: 118,010,387 (GRCm39) E619K probably benign Het
Kdm5b G A 1: 134,552,773 (GRCm39) D1250N probably damaging Het
Kel G T 6: 41,664,506 (GRCm39) P644T probably damaging Het
Khdc1c G T 1: 21,439,787 (GRCm39) E113* probably null Het
Khdrbs2 G T 1: 32,372,743 (GRCm39) W139L unknown Het
Khdrbs3 T C 15: 68,889,316 (GRCm39) L155P probably damaging Het
Kif12 T G 4: 63,090,234 (GRCm39) E3D possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif13b C G 14: 65,040,793 (GRCm39) P1627R probably benign Het
Kif14 A T 1: 136,424,391 (GRCm39) Q1002L probably damaging Het
Kif14 G T 1: 136,427,754 (GRCm39) probably null Het
Kif18a G A 2: 109,148,398 (GRCm39) G631R possibly damaging Het
Kif19a A T 11: 114,677,416 (GRCm39) E600V probably damaging Het
Kif19a C A 11: 114,680,655 (GRCm39) A925E probably benign Het
Kif1a G A 1: 92,983,419 (GRCm39) P693S probably benign Het
Kif1a G A 1: 92,950,213 (GRCm39) R1405W probably damaging Het
Kif1a G C 1: 92,949,038 (GRCm39) L1495V probably damaging Het
Kif1b T G 4: 149,350,755 (GRCm39) K273T possibly damaging Het
Kif20b C G 19: 34,930,275 (GRCm39) S1260C probably benign Het
Kif21b C A 1: 136,081,875 (GRCm39) T641K probably benign Het
Kif26a G C 12: 112,144,052 (GRCm39) E1435D probably damaging Het
Kif28 T G 1: 179,560,699 (GRCm39) K202T probably benign Het
Kif2b C A 11: 91,467,090 (GRCm39) E398* probably null Het
Kirrel2 T C 7: 30,152,882 (GRCm39) T379A probably benign Het
Klf17 G T 4: 117,617,548 (GRCm39) R270S probably benign Het
Klhdc7a G T 4: 139,695,108 (GRCm39) probably benign Het
Klhdc8b T A 9: 108,325,576 (GRCm39) Q326L probably benign Het
Klhl18 C G 9: 110,266,415 (GRCm39) A300P probably null Het
Klhl2 C A 8: 65,211,160 (GRCm39) R296L probably damaging Het
Klhl22 G A 16: 17,594,560 (GRCm39) D230N probably benign Het
Klhl30 C G 1: 91,287,187 (GRCm39) A491G probably damaging Het
Klhl6 G T 16: 19,772,424 (GRCm39) T307N probably damaging Het
Klk1b8 C A 7: 43,453,149 (GRCm39) R247S possibly damaging Het
Klkb1 G T 8: 45,726,666 (GRCm39) R446S probably damaging Het
Klra1 C G 6: 130,349,814 (GRCm39) W208S probably damaging Het
Klra3 C A 6: 130,312,684 (GRCm39) E27* probably null Het
Klra5 G C 6: 129,888,415 (GRCm39) P4A not run Het
Klrb1a GT G 6: 128,595,548 (GRCm39) probably null Het
Kmt2a C A 9: 44,759,276 (GRCm39) D858Y probably damaging Het
Kmt2b C A 7: 30,276,795 (GRCm39) R1674L probably damaging Het
Kmt2c G C 5: 25,559,411 (GRCm39) A1076G probably damaging Het
Kmt5b G T 19: 3,843,118 (GRCm39) G72* probably null Het
Kng1 G T 16: 22,898,366 (GRCm39) V589L probably benign Het
Kplce T C 3: 92,776,581 (GRCm39) Q34R probably benign Het
Kpna6 T A 4: 129,541,871 (GRCm39) S509C possibly damaging Het
Kpna6 C A 4: 129,549,341 (GRCm39) W147L probably damaging Het
Krt12 C A 11: 99,311,587 (GRCm39) E205* probably null Het
Krt17 T G 11: 100,151,749 (GRCm39) K15Q probably benign Het
Krt222 A T 11: 99,129,378 (GRCm39) L143Q probably damaging Het
Krt24 C G 11: 99,175,712 (GRCm39) G108R unknown Het
Krt25 C G 11: 99,213,648 (GRCm39) A24P probably benign Het
Krt27 C A 11: 99,239,804 (GRCm39) E253D probably damaging Het
Krt33a C A 11: 99,902,740 (GRCm39) E361D probably benign Het
Krt34 G T 11: 99,932,260 (GRCm39) C21* probably null Het
Krt82 C T 15: 101,450,287 (GRCm39) V470I probably benign Het
Krtap1-3 A G 11: 99,481,821 (GRCm39) C109R possibly damaging Het
Krtap16-1 C T 11: 99,876,423 (GRCm39) R327Q possibly damaging Het
Krtap21-1 C A 16: 89,200,469 (GRCm39) G58C unknown Het
Krtap28-13 G T 1: 83,038,811 (GRCm39) C32F unknown Het
Krtap3-1 G C 11: 99,457,393 (GRCm39) A6G probably benign Het
Krtap4-2 C A 11: 99,525,802 (GRCm39) G17C unknown Het
Krtap6-1 G C 16: 88,828,697 (GRCm39) C31S unknown Het
Krtap7-1 C A 16: 89,305,148 (GRCm39) M1I probably null Het
Ksr1 C A 11: 78,911,577 (GRCm39) R735L possibly damaging Het
Ksr1 C A 11: 78,918,426 (GRCm39) R576L probably benign Het
Kyat1 G T 2: 30,077,744 (GRCm39) T175N probably damaging Het
L2hgdh C T 12: 69,753,906 (GRCm39) S233N probably benign Het
L3mbtl4 G T 17: 68,732,682 (GRCm39) W54L probably damaging Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Lamb1 A T 12: 31,377,701 (GRCm39) S1697C possibly damaging Het
Lamb2 G T 9: 108,360,100 (GRCm39) G419C probably damaging Het
Lamc2 C A 1: 153,009,367 (GRCm39) V813L probably benign Het
Lamp2 T C X: 37,513,258 (GRCm39) S332G probably damaging Het
Lao1 C A 4: 118,825,637 (GRCm39) H486N probably damaging Het
Large2 G C 2: 92,200,543 (GRCm39) T87R probably benign Het
Lats1 G T 10: 7,581,573 (GRCm39) G786V probably damaging Het
Lbp T A 2: 158,167,682 (GRCm39) L402Q probably damaging Het
Lcn11 G T 2: 25,667,736 (GRCm39) K41N probably benign Het
Lct C A 1: 128,215,348 (GRCm39) E1743* probably null Het
Ldaf1 T G 7: 119,714,714 (GRCm39) F68V probably damaging Het
Ldb3 C G 14: 34,277,322 (GRCm39) A351P probably benign Het
Ldc1 T A 4: 130,115,497 (GRCm39) H17L probably benign Het
Ldhd G T 8: 112,354,152 (GRCm39) T382N probably damaging Het
Lect2 A T 13: 56,696,174 (GRCm39) M1K probably null Het
Lef1 C A 3: 130,993,972 (GRCm39) A344D probably damaging Het
Lep G C 6: 29,070,969 (GRCm39) A98P possibly damaging Het
Lepr C A 4: 101,602,811 (GRCm39) P200T probably damaging Het
Lgr5 C A 10: 115,296,781 (GRCm39) R382M probably damaging Het
Lhcgr T G 17: 89,049,698 (GRCm39) K609N probably damaging Het
Lhx3 G T 2: 26,093,999 (GRCm39) R77S probably damaging Het
Lhx4 C A 1: 155,581,001 (GRCm39) A175S probably damaging Het
Lilra6 C T 7: 3,918,073 (GRCm39) probably null Het
Lingo3 G C 10: 80,670,689 (GRCm39) Q414E possibly damaging Het
Lins1 C G 7: 66,360,012 (GRCm39) A263G possibly damaging Het
Lipf T A 19: 33,942,995 (GRCm39) L101Q probably damaging Het
Lipo3 A C 19: 33,562,328 (GRCm39) L14R probably null Het
Lipo4 C A 19: 33,480,584 (GRCm39) M261I probably benign Het
Lipt1 G A 1: 37,914,984 (GRCm39) V347I probably benign Het
Llgl2 G T 11: 115,740,380 (GRCm39) E359* probably null Het
Lman2l C A 1: 36,467,457 (GRCm39) G197V probably damaging Het
Lmnb2 C G 10: 80,739,072 (GRCm39) G594R probably damaging Het
Lmo7 C A 14: 102,121,742 (GRCm39) P269Q probably damaging Het
Lmo7 T C 14: 102,166,664 (GRCm39) S1548P unknown Het
Lmo7 G A 14: 102,156,879 (GRCm39) E1350K unknown Het
Lmo7 A T 14: 102,156,717 (GRCm39) T1296S probably benign Het
Lmx1a A T 1: 167,519,568 (GRCm39) K32M possibly damaging Het
Lnp1 C T 16: 56,748,266 (GRCm39) D9N possibly damaging Het
Lox T G 18: 52,653,906 (GRCm39) T397P probably damaging Het
Lpar5 C A 6: 125,058,342 (GRCm39) T21K possibly damaging Het
Lpar5 T G 6: 125,059,035 (GRCm39) L252R probably damaging Het
Lpgat1 T G 1: 191,510,587 (GRCm39) F391V probably benign Het
Lpin2 C G 17: 71,532,206 (GRCm39) S225* probably null Het
Lpin3 C G 2: 160,741,705 (GRCm39) P492A probably damaging Het
Lpp G C 16: 24,580,353 (GRCm39) S148T probably benign Het
Lpxn C A 19: 12,802,311 (GRCm39) A212D probably damaging Het
Lrba G T 3: 86,658,839 (GRCm39) G2569C possibly damaging Het
Lrba G C 3: 86,622,845 (GRCm39) C2409S probably benign Het
Lrch3 A C 16: 32,734,686 (GRCm39) T59P possibly damaging Het
Lrfn1 A G 7: 28,158,540 (GRCm39) E153G possibly damaging Het
Lrig1 G T 6: 94,586,007 (GRCm39) T727N possibly damaging Het
Lrp1 C G 10: 127,390,831 (GRCm39) C3022S probably damaging Het
Lrp12 A T 15: 39,741,519 (GRCm39) F418I probably damaging Het
Lrp1b T A 2: 40,587,594 (GRCm39) D3887V Het
Lrp1b A C 2: 40,567,518 (GRCm39) L4070V Het
Lrp1b G T 2: 41,618,722 (GRCm39) N231K Het
Lrp1b C A 2: 40,812,395 (GRCm39) E2517D Het
Lrp2 A T 2: 69,338,225 (GRCm39) V1185E possibly damaging Het
Lrp2 C G 2: 69,310,386 (GRCm39) G2729A possibly damaging Het
Lrp6 C T 6: 134,433,120 (GRCm39) G1404R possibly damaging Het
Lrpprc C G 17: 85,077,859 (GRCm39) A359P possibly damaging Het
Lrrc15 C G 16: 30,093,070 (GRCm39) A90P probably benign Het
Lrrc18 C G 14: 32,731,157 (GRCm39) P232R probably benign Het
Lrrc20 A G 10: 61,362,944 (GRCm39) K63R probably damaging Het
Lrrc27 C A 7: 138,822,636 (GRCm39) P509Q probably damaging Het
Lrrc30 C T 17: 67,939,431 (GRCm39) V50I probably benign Het
Lrrc37 C T 11: 103,504,507 (GRCm39) G2487D probably benign Het
Lrrc37a G T 11: 103,389,860 (GRCm39) A1855D possibly damaging Het
Lrrc37a T G 11: 103,391,920 (GRCm39) E1168D probably benign Het
Lrrc37a C A 11: 103,347,312 (GRCm39) D3128Y probably damaging Het
Lrrc49 T A 9: 60,584,504 (GRCm39) Q186L probably damaging Het
Lrrc4b G A 7: 44,094,547 (GRCm39) V72M probably damaging Het
Lrrc4b GC G 7: 44,110,736 (GRCm39) probably null Het
Lrrc59 A C 11: 94,534,147 (GRCm39) K235T probably benign Het
Lrrc8e A T 8: 4,284,822 (GRCm39) E349V probably damaging Het
Lrrc9 A G 12: 72,524,167 (GRCm39) K791R probably damaging Het
Lrrd1 C T 5: 3,900,025 (GRCm39) P110L probably benign Het
Lrrfip1 G T 1: 91,028,921 (GRCm39) M68I possibly damaging Het
Lrrfip2 C A 9: 110,990,408 (GRCm39) A43E probably damaging Het
Lrriq1 G T 10: 103,069,946 (GRCm39) S23R probably damaging Het
Lrriq1 T A 10: 103,038,220 (GRCm39) Q861L probably damaging Het
Lrriq1 G T 10: 103,038,221 (GRCm39) Q861K probably damaging Het
Lrrtm2 T C 18: 35,347,712 (GRCm39) probably benign Het
Lrrtm3 C A 10: 63,925,134 (GRCm39) G11V probably damaging Het
Lrsam1 C G 2: 32,831,826 (GRCm39) R383P probably damaging Het
Lrwd1 G A 5: 136,162,862 (GRCm39) R120C probably damaging Het
Ltbp2 G C 12: 84,922,627 (GRCm39) R147G probably benign Het
Luc7l2 G T 6: 38,528,843 (GRCm39) G21* probably null Het
Ly9 G T 1: 171,421,628 (GRCm39) T541K probably damaging Het
Lyg1 C A 1: 37,986,258 (GRCm39) G159C probably null Het
Lyg2 C A 1: 37,950,208 (GRCm39) C40F probably damaging Het
Lyst C G 13: 13,951,664 (GRCm39) A3755G probably benign Het
Lyst T C 13: 13,814,692 (GRCm39) L1149S probably damaging Het
M1ap A T 6: 82,945,023 (GRCm39) R106* probably null Het
Macrod2 T A 2: 140,866,010 (GRCm39) C123S probably damaging Het
Macrod2 G T 2: 140,548,128 (GRCm39) G93V probably damaging Het
Madd C A 2: 90,989,617 (GRCm39) G1129V probably damaging Het
Mafg T G 11: 120,520,354 (GRCm39) Q82P probably damaging Het
Mageb18 G A X: 91,163,502 (GRCm39) P247S probably damaging Het
Magi2 C A 5: 20,907,107 (GRCm39) Q1094K probably benign Het
Magohb C A 6: 131,265,026 (GRCm39) W79C probably damaging Het
Malrd1 C A 2: 16,222,656 (GRCm39) Q2015K unknown Het
Mamdc2 A C 19: 23,311,421 (GRCm39) F478V possibly damaging Het
Man1a G T 10: 53,795,411 (GRCm39) P523Q probably damaging Het
Man1b1 G C 2: 25,234,995 (GRCm39) R270T possibly damaging Het
Man2b1 A C 8: 85,820,567 (GRCm39) D618A probably damaging Het
Manba G T 3: 135,269,035 (GRCm39) G647* probably null Het
Map1a G T 2: 121,133,719 (GRCm39) G1512C possibly damaging Het
Map2k5 C A 9: 63,265,320 (GRCm39) R69S probably damaging Het
Map3k13 G T 16: 21,723,912 (GRCm39) G298V probably damaging Het
Map3k14 T G 11: 103,121,899 (GRCm39) E506A probably benign Het
Map3k14 G T 11: 103,116,322 (GRCm39) T702K probably benign Het
Map3k7 T G 4: 32,015,963 (GRCm39) I496S probably damaging Het
Map3k9 C A 12: 81,819,556 (GRCm39) D233Y possibly damaging Het
Map4k3 C G 17: 80,925,766 (GRCm39) A410P possibly damaging Het
Map6 G C 7: 98,966,867 (GRCm39) E565D probably damaging Het
Mapk10 A T 5: 103,139,753 (GRCm39) L166Q probably damaging Het
Mapk4 A G 18: 74,070,255 (GRCm39) W213R probably damaging Het
Mapk8 G T 14: 33,132,843 (GRCm39) P31H probably damaging Het
Marchf4 C T 1: 72,491,659 (GRCm39) C204Y probably damaging Het
Marf1 C A 16: 13,933,641 (GRCm39) Q1582H probably benign Het
Mast1 G C 8: 85,645,310 (GRCm39) R712G probably damaging Het
Mast1 T G 8: 85,639,088 (GRCm39) S1414R probably damaging Het
Mast4 C G 13: 102,874,968 (GRCm39) E1467Q probably damaging Het
Mat1a A T 14: 40,827,467 (GRCm39) probably benign Het
Mat2b C G 11: 40,573,312 (GRCm39) Q233H probably damaging Het
Mat2b T A 11: 40,578,604 (GRCm39) S28C probably benign Het
Matn1 T A 4: 130,673,416 (GRCm39) L128Q probably damaging Het
Mavs G T 2: 131,082,321 (GRCm39) W68C probably damaging Het
Mbd5 A C 2: 49,169,320 (GRCm39) N1497T probably benign Het
Mbip T G 12: 56,387,170 (GRCm39) E156D probably damaging Het
Mbnl2 G C 14: 120,640,771 (GRCm39) A346P probably benign Het
Mboat2 G T 12: 24,998,343 (GRCm39) A282S possibly damaging Het
Mcm3 C A 1: 20,890,405 (GRCm39) V10L probably benign Het
Mcm8 G T 2: 132,669,487 (GRCm39) G319* probably null Het
Mcm9 C A 10: 53,413,603 (GRCm39) R492S unknown Het
Mcm9 CCGCGCGGCGTTGGAGGGGGCGGGGCGTGCGCGCGGC CCGCGCGGC 10: 53,505,884 (GRCm39) probably null Het
Mcoln3 C G 3: 145,846,221 (GRCm39) H510Q probably benign Het
Mcts1 A C X: 37,690,818 (GRCm39) K8N possibly damaging Het
Mdga2 C A 12: 66,736,217 (GRCm39) G337V probably damaging Het
Mdh1b G T 1: 63,750,690 (GRCm39) T426K probably benign Het
Mdh2 C A 5: 135,818,483 (GRCm39) S246Y probably damaging Het
Mdn1 A G 4: 32,667,102 (GRCm39) N189S probably benign Het
Mdn1 G T 4: 32,668,944 (GRCm39) G334V probably damaging Het
Mdn1 A C 4: 32,696,244 (GRCm39) N1209T probably damaging Het
Med1 C A 11: 98,052,009 (GRCm39) V452L possibly damaging Het
Med12 G T X: 100,324,831 (GRCm39) D679Y probably damaging Het
Med12 G T X: 100,337,179 (GRCm39) Q1902H possibly damaging Het
Med12l C A 3: 59,203,538 (GRCm39) P2020Q probably benign Het
Med12l C A 3: 58,998,838 (GRCm39) N599K probably damaging Het
Med12l C A 3: 59,152,364 (GRCm39) L1050I probably damaging Het
Med13 T G 11: 86,246,249 (GRCm39) D51A probably damaging Het
Med13 T A 11: 86,236,688 (GRCm39) K156N probably benign Het
Med13 T A 11: 86,219,370 (GRCm39) S359C possibly damaging Het
Medag G T 5: 149,350,972 (GRCm39) probably null Het
Mef2b G C 8: 70,619,025 (GRCm39) R202S probably damaging Het
Mefv C A 16: 3,533,319 (GRCm39) E317D possibly damaging Het
Megf10 C G 18: 57,410,766 (GRCm39) P692A probably damaging Het
Meis1 C A 11: 18,964,317 (GRCm39) G105V probably damaging Het
Mep1a C G 17: 43,788,211 (GRCm39) R628T probably benign Het
Mepce C A 5: 137,784,104 (GRCm39) G74V probably damaging Het
Mettl25 C A 10: 105,661,959 (GRCm39) R337I possibly damaging Het
Mettl4 T G 17: 95,040,991 (GRCm39) T388P probably benign Het
Mex3d C G 10: 80,222,547 (GRCm39) E236D Het
Mfsd11 G C 11: 116,754,766 (GRCm39) A226P probably damaging Het
Mfsd13b G A 7: 120,590,900 (GRCm39) V214I probably benign Het
Mfsd2a G C 4: 122,845,632 (GRCm39) T173S probably benign Het
Mfsd2a G T 4: 122,853,104 (GRCm39) L62M possibly damaging Het
Mfsd2b C A 12: 4,916,530 (GRCm39) probably null Het
Mfsd4b2 C T 10: 39,797,596 (GRCm39) S253N probably benign Het
Mfsd4b4 G T 10: 39,768,595 (GRCm39) P212H possibly damaging Het
Mfsd4b5 G C 10: 39,862,386 (GRCm39) L46V probably damaging Het
Mgam G T 6: 40,706,000 (GRCm39) R23L probably damaging Het
Mgam G T 6: 40,654,578 (GRCm39) probably null Het
Mgat4d G C 8: 84,075,150 (GRCm39) V13L probably benign Het
Mgat4d A C 8: 84,094,741 (GRCm39) K259N probably benign Het
Mia2 C G 12: 59,155,587 (GRCm39) D433E probably damaging Het
Mia2 G T 12: 59,154,910 (GRCm39) D208Y probably benign Het
Mib2 G C 4: 155,745,598 (GRCm39) A71G probably benign Het
Mideas T A 12: 84,220,273 (GRCm39) Q227L probably damaging Het
Mideas G T 12: 84,220,275 (GRCm39) H226Q probably damaging Het
Midn G A 10: 79,989,462 (GRCm39) G142E probably benign Het
Mier2 C A 10: 79,376,335 (GRCm39) V197L unknown Het
Mill1 A T 7: 17,979,424 (GRCm39) probably benign Het
Mkln1 A C 6: 31,375,856 (GRCm39) K22T possibly damaging Het
Mkln1 G T 6: 31,428,489 (GRCm39) G273C probably damaging Het
Mkrn1 T A 6: 39,377,390 (GRCm39) N282Y probably null Het
Mkrn3 C T 7: 62,069,558 (GRCm39) G78R probably benign Het
Mmel1 C T 4: 154,979,665 (GRCm39) R762* probably null Het
Mmp10 G T 9: 7,508,206 (GRCm39) probably null Het
Mmp24 G A 2: 155,652,312 (GRCm39) G340E probably damaging Het
Mmp25 C G 17: 23,849,633 (GRCm39) C586S probably damaging Het
Mmp7 G C 9: 7,695,603 (GRCm39) G160A probably damaging Het
Mmrn1 C G 6: 60,922,018 (GRCm39) D158E probably benign Het
Mn1 C G 5: 111,568,245 (GRCm39) S738R probably benign Het
Mn1 A C 5: 111,602,572 (GRCm39) K1270T possibly damaging Het
Mnt C T 11: 74,727,501 (GRCm39) P129L probably damaging Het
Mnx1 C A 5: 29,679,172 (GRCm39) E304* probably null Het
Mnx1 C A 5: 29,679,086 (GRCm39) E332D unknown Het
Moap1 C G 12: 102,709,334 (GRCm39) E72Q probably damaging Het
Mocos A T 18: 24,803,690 (GRCm39) H337L probably benign Het
Mogs G T 6: 83,093,194 (GRCm39) G181W probably damaging Het
Mon1b G C 8: 114,364,441 (GRCm39) E73Q probably benign Het
Morc1 G T 16: 48,407,421 (GRCm39) V646L probably benign Het
Mpig6b C A 17: 35,284,316 (GRCm39) G158V probably damaging Het
Mpp3 G T 11: 101,899,182 (GRCm39) H419N probably damaging Het
Mprip A T 11: 59,650,310 (GRCm39) Q1338L probably benign Het
Mprip G T 11: 59,628,230 (GRCm39) G226W possibly damaging Het
Mpv17l G T 16: 13,758,693 (GRCm39) R39L probably benign Het
Mrc2 G C 11: 105,232,202 (GRCm39) W886S possibly damaging Het
Mrc2 G T 11: 105,238,186 (GRCm39) E1153* probably null Het
Mrgprd T A 7: 144,875,690 (GRCm39) L187H probably damaging Het
Mrgprx2 A C 7: 48,132,090 (GRCm39) F243V probably damaging Het
Mrpl37 C A 4: 106,914,623 (GRCm39) Q380H probably damaging Het
Mrpl39 C T 16: 84,520,860 (GRCm39) V260I probably benign Het
Mrpl45 G T 11: 97,212,385 (GRCm39) A121S probably benign Het
Mrps14 A C 1: 160,024,597 (GRCm39) M43L probably benign Het
Mrps24 T A 11: 5,654,538 (GRCm39) S139C possibly damaging Het
Ms4a6b A T 19: 11,506,850 (GRCm39) probably null Het
Ms4a8a G A 19: 11,048,124 (GRCm39) S202L possibly damaging Het
Msc A T 1: 14,825,463 (GRCm39) C39S unknown Het
Msi2 C A 11: 88,239,618 (GRCm39) G331C probably damaging Het
Msln G T 17: 25,972,768 (GRCm39) Q38K possibly damaging Het
Mss51 C T 14: 20,536,214 (GRCm39) probably null Het
Mtcl1 T C 17: 66,686,455 (GRCm39) E817G probably benign Het
Mtf2 G C 5: 108,235,810 (GRCm39) G163R probably damaging Het
Mtfr1l C G 4: 134,257,990 (GRCm39) probably null Het
Mthfd1 G A 12: 76,350,741 (GRCm39) G708R possibly damaging Het
Mtmr2 A C 9: 13,710,577 (GRCm39) E375D probably benign Het
Mtmr3 G C 11: 4,435,913 (GRCm39) A1098G probably damaging Het
Mtor G C 4: 148,634,587 (GRCm39) V2403L possibly damaging Het
Mtor A T 4: 148,634,582 (GRCm39) H2401L probably benign Het
Mttp C A 3: 137,810,540 (GRCm39) R625L probably benign Het
Mtus2 A G 5: 148,013,552 (GRCm39) K115R probably benign Het
Mtus2 G T 5: 148,014,068 (GRCm39) R287L probably benign Het
Muc13 A C 16: 33,619,457 (GRCm39) Q68H unknown Het
Muc13 T C 16: 33,636,220 (GRCm39) M568T possibly damaging Het
Muc2 T G 7: 141,300,451 (GRCm39) I258S Het
Muc21 G T 17: 35,932,137 (GRCm39) S683Y unknown Het
Muc4 G A 16: 32,589,104 (GRCm39) V754I possibly damaging Het
Muc5b C A 7: 141,396,442 (GRCm39) L185I unknown Het
Mug1 T G 6: 121,857,452 (GRCm39) F1059V probably damaging Het
Mug1 G A 6: 121,818,253 (GRCm39) M151I probably benign Het
Mup11 C A 4: 60,616,214 (GRCm39) M121I probably benign Het
Mup8 T C 4: 60,222,378 (GRCm39) E31G probably benign Het
Mup8 C A 4: 60,222,542 (GRCm39) probably benign Het
Mvb12b A T 2: 33,764,382 (GRCm39) S56T probably damaging Het
Mybl1 C A 1: 9,755,994 (GRCm39) R185L probably damaging Het
Mybpc1 G T 10: 88,396,189 (GRCm39) N205K probably benign Het
Mybpc2 A C 7: 44,171,120 (GRCm39) S144A probably benign Het
Mybpc3 C A 2: 90,950,748 (GRCm39) P192Q possibly damaging Het
Mycbp2 T A 14: 103,583,685 (GRCm39) Q90L probably benign Het
Mycbp2 C A 14: 103,394,073 (GRCm39) K2829N probably benign Het
Myf6 G T 10: 107,330,121 (GRCm39) H149N probably benign Het
Myh11 T A 16: 14,095,639 (GRCm39) E41V Het
Myh11 C A 16: 14,057,260 (GRCm39) A345S probably null Het
Myh13 T A 11: 67,220,121 (GRCm39) S157T possibly damaging Het
Myh14 A G 7: 44,287,733 (GRCm39) V592A probably damaging Het
Myh14 G T 7: 44,257,939 (GRCm39) R1858S probably damaging Het
Myh15 A C 16: 48,916,894 (GRCm39) S405R probably damaging Het
Myh3 G C 11: 66,973,241 (GRCm39) W113S possibly damaging Het
Myh4 G T 11: 67,139,467 (GRCm39) G595C probably damaging Het
Myh4 G A 11: 67,147,097 (GRCm39) A1581T probably benign Het
Myh4 G T 11: 67,144,331 (GRCm39) D1234Y probably damaging Het
Myh8 A C 11: 67,194,500 (GRCm39) Q1570H probably damaging Het
Mylk3 A T 8: 86,091,808 (GRCm39) Het
Myo15a G C 11: 60,379,084 (GRCm39) A232P Het
Myo15a G T 11: 60,415,267 (GRCm39) V3410L probably damaging Het
Myo15a G C 11: 60,389,229 (GRCm39) R873P Het
Myo15b A T 11: 115,778,751 (GRCm39) T2582S unknown Het
Myo15b C T 11: 115,774,278 (GRCm39) P339S possibly damaging Het
Myo18b A T 5: 112,957,604 (GRCm39) L1453Q possibly damaging Het
Myo18b C A 5: 112,979,056 (GRCm39) G1186W probably damaging Het
Myo18b C T 5: 112,910,587 (GRCm39) R1935H not run Het
Myo19 GCACACAC GCACAC 11: 84,800,176 (GRCm39) probably null Het
Myo19 G A 11: 84,776,104 (GRCm39) G30E probably benign Het
Myo1g C G 11: 6,469,045 (GRCm39) A86P probably damaging Het
Myo7a C G 7: 97,744,934 (GRCm39) R291P probably damaging Het
Myo7b C A 18: 32,114,051 (GRCm39) R1100L possibly damaging Het
Myo9a A C 9: 59,802,542 (GRCm39) T2010P probably damaging Het
Myoc G C 1: 162,476,723 (GRCm39) D476H probably damaging Het
Myoc G T 1: 162,467,205 (GRCm39) E125* probably null Het
Myom3 G T 4: 135,492,131 (GRCm39) V92L probably benign Het
Myot G T 18: 44,479,152 (GRCm39) M296I probably damaging Het
N4bp2l2 C A 5: 150,585,785 (GRCm39) R65L probably benign Het
Nab2 C A 10: 127,499,001 (GRCm39) E426* probably null Het
Nabp1 T A 1: 51,516,884 (GRCm39) probably benign Het
Nacad G T 11: 6,552,297 (GRCm39) S298Y probably damaging Het
Nagpa C G 16: 5,021,797 (GRCm39) G17A probably damaging Het
Naip2 T G 13: 100,298,101 (GRCm39) E645A probably benign Het
Naip2 A T 13: 100,298,417 (GRCm39) Y540N probably benign Het
Nanog G A 6: 122,690,190 (GRCm39) W198* probably null Het
Nars2 G T 7: 96,601,104 (GRCm39) D32Y probably benign Het
Nat2 A G 8: 67,953,916 (GRCm39) R9G probably damaging Het
Nat3 G T 8: 68,000,466 (GRCm39) S115I possibly damaging Het
Nat8f2 T C 6: 85,845,026 (GRCm39) E112G probably damaging Het
Nat8f5 T C 6: 85,794,667 (GRCm39) T98A probably benign Het
Nat8l C T 5: 34,154,155 (GRCm39) probably benign Het
Nav1 T A 1: 135,400,158 (GRCm39) S471C probably damaging Het
Nav1 C A 1: 135,380,624 (GRCm39) V1432L unknown Het
Nbas G T 12: 13,533,877 (GRCm39) Q1837H probably benign Het
Nbeal2 C A 9: 110,467,903 (GRCm39) M455I probably benign Het
Nbeal2 G C 9: 110,454,884 (GRCm39) Q2645E probably benign Het
Nbr1 G C 11: 101,463,380 (GRCm39) G616R probably benign Het
Ncdn C A 4: 126,643,944 (GRCm39) G293C probably damaging Het
Ncdn C A 4: 126,643,946 (GRCm39) C292F probably benign Het
Nckap1 A C 2: 80,370,852 (GRCm39) probably null Het
Nckap5 C T 1: 126,456,418 (GRCm39) probably null Het
Ncoa6 T A 2: 155,263,222 (GRCm39) Q404L probably damaging Het
Ncor1 C A 11: 62,329,342 (GRCm39) probably null Het
Ndc1 G C 4: 107,243,799 (GRCm39) A332P probably damaging Het
Ndfip2 G T 14: 105,496,144 (GRCm39) A13S probably benign Het
Ndn C A 7: 61,998,292 (GRCm39) P46Q probably benign Het
Ndst3 A C 3: 123,346,279 (GRCm39) F665C probably damaging Het
Ndst3 C A 3: 123,465,143 (GRCm39) L276F probably damaging Het
Ndst3 T G 3: 123,421,618 (GRCm39) K405T possibly damaging Het
Ndufa9 C A 6: 126,821,778 (GRCm39) G66C probably damaging Het
Ndufs1 C A 1: 63,202,995 (GRCm39) A190S probably damaging Het
Ndufs6 A G 13: 73,476,555 (GRCm39) V4A probably benign Het
Neb C G 2: 52,157,794 (GRCm39) W2271S probably benign Het
Neb C T 2: 52,169,643 (GRCm39) probably null Het
Nectin2 C A 7: 19,472,288 (GRCm39) V34L probably benign Het
Neil2 A C 14: 63,425,945 (GRCm39) F142V probably damaging Het
Nek11 G C 9: 105,170,868 (GRCm39) A389G probably benign Het
Nek2 G T 1: 191,559,351 (GRCm39) R285S probably benign Het
Nell1 C G 7: 50,210,630 (GRCm39) S377C unknown Het
Neu4 G T 1: 93,952,972 (GRCm39) G447V probably benign Het
Neurl1a C A 19: 47,228,312 (GRCm39) L53M probably damaging Het
Nfasc C A 1: 132,562,376 (GRCm39) R133L probably benign Het
Nfatc2 G A 2: 168,413,269 (GRCm39) Q139* probably null Het
Nfe2l2 T A 2: 75,509,508 (GRCm39) Q104L probably null Het
Nfkbil1 C A 17: 35,453,938 (GRCm39) Q109H probably benign Het
Nfkbil1 C A 17: 35,453,937 (GRCm39) G110C probably damaging Het
Nfxl1 T G 5: 72,695,493 (GRCm39) Q450H probably null Het
Nfyc C A 4: 120,647,684 (GRCm39) probably benign Het
Ngb C A 12: 87,145,203 (GRCm39) G151C probably damaging Het
Nhlrc4 C A 17: 26,162,718 (GRCm39) A10S possibly damaging Het
Nhsl3 G T 4: 129,117,497 (GRCm39) S434Y probably damaging Het
Nin T A 12: 70,095,938 (GRCm39) probably null Het
Nipbl G C 15: 8,368,183 (GRCm39) P1180A possibly damaging Het
Nipsnap3a G T 4: 52,997,216 (GRCm39) E161* probably null Het
Nkain2 C A 10: 32,278,267 (GRCm39) G53* probably null Het
Nkapl C G 13: 21,652,473 (GRCm39) G47R unknown Het
Nkx2-1 C A 12: 56,581,749 (GRCm39) G33C probably damaging Het
Nkx2-1 G T 12: 56,580,469 (GRCm39) P157H probably benign Het
Nle1 C A 11: 82,795,138 (GRCm39) D298Y probably damaging Het
Nlgn1 G T 3: 25,490,768 (GRCm39) L320I probably benign Het
Nlgn3 G T X: 100,361,588 (GRCm39) V300L probably benign Het
Nlgn3 T C X: 100,363,483 (GRCm39) L698P probably damaging Het
Nlk C G 11: 78,474,225 (GRCm39) G358A probably damaging Het
Nlrp12 T C 7: 3,271,211 (GRCm39) K1034R probably benign Het
Nlrp14 A G 7: 106,781,921 (GRCm39) T373A probably benign Het
Nlrp1b T G 11: 71,073,096 (GRCm39) K249T probably damaging Het
Nlrp6 T A 7: 140,502,634 (GRCm39) W247R probably damaging Het
Nlrp9a G T 7: 26,257,654 (GRCm39) W424L probably damaging Het
Nlrx1 A C 9: 44,168,220 (GRCm39) V559G possibly damaging Het
Nme9 G A 9: 99,352,848 (GRCm39) R266Q possibly damaging Het
Nmur2 T G 11: 55,917,927 (GRCm39) K354T probably benign Het
Nos3 C A 5: 24,582,652 (GRCm39) R627S probably benign Het
Notch3 A T 17: 32,370,344 (GRCm39) C739S probably damaging Het
Notch3 A T 17: 32,360,490 (GRCm39) F1480L probably benign Het
Nova2 G T 7: 18,692,374 (GRCm39) G501V unknown Het
Noxa1 T A 2: 24,980,285 (GRCm39) Q170L possibly damaging Het
Noxred1 A C 12: 87,269,831 (GRCm39) L300W probably damaging Het
Npas2 T A 1: 39,375,091 (GRCm39) S470T probably benign Het
Npas3 T C 12: 53,547,963 (GRCm39) L103P probably damaging Het
Npm1 C A 11: 33,110,831 (GRCm39) V117L probably benign Het
Npr2 A T 4: 43,650,720 (GRCm39) H1000L probably damaging Het
Nr1h4 G C 10: 89,334,212 (GRCm39) Y59* probably null Het
Nr2f2 C A 7: 70,007,526 (GRCm39) V319F probably damaging Het
Nr3c2 G A 8: 77,636,329 (GRCm39) V477M probably damaging Het
Nrap CTGTGTGT CTGTGT 19: 56,333,949 (GRCm39) probably null Het
Nrcam G T 12: 44,618,353 (GRCm39) R781L probably damaging Het
Nrg2 G T 18: 36,151,523 (GRCm39) P673H probably damaging Het
Nrg3 C G 14: 39,194,490 (GRCm39) V90L possibly damaging Het
Nrn1l G T 8: 106,621,048 (GRCm39) A47S probably damaging Het
Nrxn3 C A 12: 89,153,825 (GRCm39) S264* probably null Het
Nrxn3 C A 12: 89,484,679 (GRCm39) A676E possibly damaging Het
Nsd1 A T 13: 55,393,338 (GRCm39) Q416L probably damaging Het
Nsf C G 11: 103,801,380 (GRCm39) D212H probably damaging Het
Nsrp1 C A 11: 76,941,521 (GRCm39) Q62H probably damaging Het
Nt5el G A 13: 105,247,652 (GRCm39) G324D probably damaging Het
Ntmt1 G C 2: 30,712,440 (GRCm39) G161A probably damaging Het
Ntn4 G C 10: 93,577,015 (GRCm39) R561P probably damaging Het
Ntrk2 A G 13: 59,022,147 (GRCm39) T401A probably benign Het
Nudt8 G T 19: 4,051,690 (GRCm39) R130S not run Het
Nufip2 G C 11: 77,632,617 (GRCm39) *711S probably null Het
Nup214 G T 2: 31,900,270 (GRCm39) R866S possibly damaging Het
Nup214 G T 2: 31,924,237 (GRCm39) E1589* probably null Het
Nwd1 T G 8: 73,398,928 (GRCm39) L696R not run Het
Nwd2 C A 5: 63,963,500 (GRCm39) T1028K probably damaging Het
Nwd2 A G 5: 63,882,540 (GRCm39) Y64C probably damaging Het
Oas1d T C 5: 121,052,977 (GRCm39) W11R probably benign Het
Obox2 C T 7: 15,131,121 (GRCm39) P76S possibly damaging Het
Obox3 C A 7: 15,360,149 (GRCm39) E173D probably benign Het
Obscn G C 11: 59,027,112 (GRCm39) C30W probably benign Het
Obscn A G 11: 58,973,649 (GRCm39) I1894T probably benign Het
Obscn G T 11: 58,940,551 (GRCm39) N4614K probably benign Het
Obscn G T 11: 58,931,173 (GRCm39) A5018E probably benign Het
Obscn T G 11: 58,929,633 (GRCm39) D5194A probably damaging Het
Obscn A T 11: 58,886,356 (GRCm39) Y7835N unknown Het
Obscn G T 11: 58,885,198 (GRCm39) A8020E unknown Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Odad2 C A 18: 7,216,973 (GRCm39) E680* probably null Het
Odad2 G C 18: 7,129,487 (GRCm39) A897G probably damaging Het
Odad3 C A 9: 21,901,720 (GRCm39) V547F possibly damaging Het
Olfm4 T G 14: 80,258,659 (GRCm39) D302E probably benign Het
Omt2b T A 9: 78,236,612 (GRCm39) W113R probably damaging Het
Oog1 G C 12: 87,655,134 (GRCm39) E427D probably damaging Het
Opn1sw C G 6: 29,379,455 (GRCm39) G183A probably damaging Het
Oprk1 G A 1: 5,672,925 (GRCm39) R354H probably benign Het
Or10ab5 T A 7: 108,244,974 (GRCm39) T270S possibly damaging Het
Or10ag60 C T 2: 87,438,098 (GRCm39) A122V probably benign Het
Or10ak11 G T 4: 118,687,247 (GRCm39) P129Q probably damaging Het
Or10ak7 T G 4: 118,791,115 (GRCm39) H310P probably benign Het
Or10ak8 C T 4: 118,774,224 (GRCm39) G147R probably benign Het
Or10ak8 T G 4: 118,774,332 (GRCm39) T111P probably damaging Het
Or10al5 G T 17: 38,063,658 (GRCm39) K304N probably damaging Het
Or10j3 C A 1: 173,031,364 (GRCm39) S147Y probably benign Het
Or10p1 G T 10: 129,443,972 (GRCm39) A126D probably damaging Het
Or10q1b C G 19: 13,682,567 (GRCm39) D125E probably damaging Het
Or10w1 C A 19: 13,631,827 (GRCm39) H11Q probably benign Het
Or11g26 C G 14: 50,753,522 (GRCm39) P287R probably damaging Het
Or11i1 C G 3: 106,729,359 (GRCm39) C172S probably damaging Het
Or12d17 T A 17: 37,777,552 (GRCm39) F152I possibly damaging Het
Or12k8 C G 2: 36,975,648 (GRCm39) M37I probably benign Het
Or13a1 T C 6: 116,471,337 (GRCm39) Y256H probably damaging Het
Or13c7d A C 4: 43,770,267 (GRCm39) V248G probably damaging Het
Or13p10 A C 4: 118,523,023 (GRCm39) Q103P probably damaging Het
Or13p4 G T 4: 118,547,469 (GRCm39) T60K probably benign Het
Or13p8 A G 4: 118,584,338 (GRCm39) K298R probably damaging Het
Or14c44 T G 7: 86,061,906 (GRCm39) F112C probably benign Het
Or14c46 G A 7: 85,918,155 (GRCm39) P281S probably damaging Het
Or1b1 G A 2: 36,995,648 (GRCm39) P5S probably benign Het
Or1e1f TC T 11: 73,856,123 (GRCm39) probably null Het
Or1e27-ps1 C A 11: 73,555,600 (GRCm39) T55K not run Het
Or1f19 T A 16: 3,410,404 (GRCm39) L48Q probably damaging Het
Or1f19 G A 16: 3,410,997 (GRCm39) A246T probably benign Het
Or1i2 T G 10: 78,447,890 (GRCm39) N195T probably damaging Het
Or1n2 C A 2: 36,797,713 (GRCm39) L252I possibly damaging Het
Or1o4 A T 17: 37,590,565 (GRCm39) Y249N probably damaging Het
Or1p1b G A 11: 74,130,946 (GRCm39) M185I possibly damaging Het
Or1p1b T A 11: 74,130,573 (GRCm39) F61Y probably damaging Het
Or1p1b T G 11: 74,131,029 (GRCm39) L213R probably damaging Het
Or1x6 T G 11: 50,939,662 (GRCm39) C243G probably damaging Het
Or2a56 A C 6: 42,932,624 (GRCm39) H64P probably damaging Het
Or2a56 G C 6: 42,933,232 (GRCm39) E267Q probably benign Het
Or2ah1 G A 2: 85,653,365 (GRCm39) G17R probably damaging Het
Or2d36 G T 7: 106,747,362 (GRCm39) V280L probably benign Het
Or2m13 T A 16: 19,226,485 (GRCm39) M94L probably benign Het
Or2n1d A C 17: 38,646,243 (GRCm39) N65T probably damaging Het
Or2t35 G T 14: 14,407,732 (GRCm38) C168F probably damaging Het
Or2w1b A T 13: 21,300,771 (GRCm39) K303I probably damaging Het
Or2y1 G C 11: 49,385,894 (GRCm39) C178S probably damaging Het
Or2y12 C G 11: 49,426,080 (GRCm39) L23V probably damaging Het
Or4c104 T G 2: 88,586,141 (GRCm39) K293Q probably damaging Het
Or4c112 T G 2: 88,854,240 (GRCm39) T36P probably damaging Het
Or4c112 A T 2: 88,854,139 (GRCm39) D69E possibly damaging Het
Or4c114 C A 2: 88,904,782 (GRCm39) G218C probably benign Het
Or4c119 A G 2: 88,986,811 (GRCm39) L236P probably damaging Het
Or4c11c T A 2: 88,661,922 (GRCm39) S154T probably damaging Het
Or4c123 C T 2: 89,127,297 (GRCm39) G106S probably damaging Het
Or4c127 T A 2: 89,833,392 (GRCm39) V214E probably damaging Het
Or4c15b TGGG TGGGG 2: 89,113,241 (GRCm39) probably null Het
Or4c15b C A 2: 89,112,881 (GRCm39) V199F probably benign Het
Or4c31 C A 2: 88,292,458 (GRCm39) P277Q probably damaging Het
Or4c3d G T 2: 89,882,609 (GRCm39) Q20K probably benign Het
Or4d10 G T 19: 12,051,274 (GRCm39) H241N probably damaging Het
Or4d10 G T 19: 12,051,204 (GRCm39) P264H probably damaging Het
Or4f15 A C 2: 111,814,098 (GRCm39) V107G probably benign Het
Or4f6 T A 2: 111,838,802 (GRCm39) H243L probably damaging Het
Or4f7 C A 2: 111,644,379 (GRCm39) G231C probably benign Het
Or4k41 C A 2: 111,280,129 (GRCm39) L215M probably damaging Het
Or4k42 A G 2: 111,320,222 (GRCm39) F94L probably damaging Het
Or4k44 C A 2: 111,368,630 (GRCm39) M1I probably null Het
Or4k47 A G 2: 111,451,606 (GRCm39) L271P probably damaging Het
Or4k50-ps1 T A 2: 111,522,774 (GRCm39) F304I unknown Het
Or4p18 G C 2: 88,232,466 (GRCm39) L271V probably damaging Het
Or4p19 G T 2: 88,242,330 (GRCm39) P224H probably damaging Het
Or4p7 C A 2: 88,222,377 (GRCm39) T262K probably damaging Het
Or4p8 A T 2: 88,727,405 (GRCm39) F179I probably damaging Het
Or51a10 T A 7: 103,699,480 (GRCm39) H27L probably benign Het
Or51f23b T A 7: 102,402,621 (GRCm39) S172C probably benign Het
Or51f23b C G 7: 102,402,623 (GRCm39) C171S possibly damaging Het
Or51g2 C T 7: 102,622,516 (GRCm39) V228I not run Het
Or51m1 G A 7: 103,578,984 (GRCm39) W318* probably null Het
Or52a24 T C 7: 103,381,988 (GRCm39) L285P probably damaging Het
Or52e8b G T 7: 104,673,306 (GRCm39) P294T probably damaging Het
Or52z1 C A 7: 103,436,660 (GRCm39) V275F probably benign Het
Or52z15 A T 7: 103,332,312 (GRCm39) Y129F probably benign Het
Or56a3b C A 7: 104,771,327 (GRCm39) S221Y probably damaging Het
Or56a3b T A 7: 104,771,329 (GRCm39) Y222N probably damaging Het
Or56b34 T A 7: 104,937,929 (GRCm39) W210R probably damaging Het
Or5ac21 G T 16: 59,123,532 (GRCm39) R5S probably benign Het
Or5ak23 C G 2: 85,245,007 (GRCm39) C72S probably damaging Het
Or5ak23 G C 2: 85,245,029 (GRCm39) H65D possibly damaging Het
Or5ak4 C T 2: 85,162,237 (GRCm39) E2K probably benign Het
Or5an1b T G 19: 12,299,631 (GRCm39) N187H possibly damaging Het
Or5aq6 G T 2: 86,923,568 (GRCm39) P58T possibly damaging Het
Or5b102 A T 19: 13,041,010 (GRCm39) K78N probably benign Het
Or5b113 G C 19: 13,342,280 (GRCm39) C96S probably damaging Het
Or5b113 T G 19: 13,342,279 (GRCm39) C96G probably damaging Het
Or5b123 T G 19: 13,597,026 (GRCm39) F124V probably damaging Het
Or5b94 C A 19: 12,651,674 (GRCm39) T35N probably benign Het
Or5be3 G T 2: 86,863,831 (GRCm39) L245I probably damaging Het
Or5bw2 C A 7: 6,573,047 (GRCm39) P19H probably damaging Het
Or5d16 T G 2: 87,773,811 (GRCm39) N54H probably damaging Het
Or5d16 G T 2: 87,773,553 (GRCm39) Q140K possibly damaging Het
Or5d37 A T 2: 87,923,678 (GRCm39) C201S probably damaging Het
Or5d40 T C 2: 88,015,415 (GRCm39) S65P probably damaging Het
Or5h27 C A 16: 59,006,848 (GRCm39) probably benign Het
Or5i1 C A 2: 87,613,368 (GRCm39) H161Q probably damaging Het
Or5j3 T C 2: 86,128,570 (GRCm39) S137P probably damaging Het
Or5k1 C A 16: 58,617,786 (GRCm39) C141F probably damaging Het
Or5k1 G C 16: 58,618,036 (GRCm39) P58A probably damaging Het
Or5k8 GT GTT 16: 58,644,670 (GRCm39) probably null Het
Or5m13 C A 2: 85,748,845 (GRCm39) T192N probably damaging Het
Or5p50 C T 7: 107,422,200 (GRCm39) A159T probably benign Het
Or5p52 T G 7: 107,502,265 (GRCm39) L114V probably damaging Het
Or5p58 C A 7: 107,694,201 (GRCm39) C192F probably damaging Het
Or5p6 T C 7: 107,630,653 (GRCm39) E299G probably damaging Het
Or5p60 G T 7: 107,724,086 (GRCm39) A128E probably damaging Het
Or5p73 T A 7: 108,064,578 (GRCm39) F16I probably benign Het
Or5t15 T G 2: 86,681,284 (GRCm39) S253R Het
Or5t17 T A 2: 86,832,954 (GRCm39) C214S probably benign Het
Or5t17 G T 2: 86,832,955 (GRCm39) C214F probably benign Het
Or5w10 A C 2: 87,374,965 (GRCm39) L308V probably benign Het
Or5w11 T A 2: 87,459,659 (GRCm39) L168Q probably damaging Het
Or5w13 G T 2: 87,523,495 (GRCm39) H244N probably damaging Het
Or6b1 T C 6: 42,814,911 (GRCm39) L32P probably damaging Het
Or6c214 A G 10: 129,590,557 (GRCm39) F254S probably damaging Het
Or6c214 C A 10: 129,590,693 (GRCm39) A209S possibly damaging Het
Or6c3 T A 10: 129,309,484 (GRCm39) S308T probably benign Het
Or6c68 G A 10: 129,158,088 (GRCm39) G199S probably benign Het
Or6c69c G T 10: 129,910,973 (GRCm39) Q231H probably benign Het
Or6c76 A T 10: 129,611,911 (GRCm39) I43F probably damaging Het
Or6c88 G T 10: 129,407,105 (GRCm39) E194* probably null Het
Or6n2 A T 1: 173,896,897 (GRCm39) E11V probably damaging Het
Or6n2 G T 1: 173,897,080 (GRCm39) W72L probably damaging Het
Or6p1 C G 1: 174,258,157 (GRCm39) S54R probably benign Het
Or6z6 G T 7: 6,491,697 (GRCm39) L52I probably damaging Het
Or6z6 A T 7: 6,491,691 (GRCm39) C54S probably benign Het
Or7a35 G C 10: 78,854,039 (GRCm39) R294S probably damaging Het
Or7a42 A T 10: 78,791,053 (GRCm39) N5Y probably damaging Het
Or7c70 T A 10: 78,682,855 (GRCm39) Q298L possibly damaging Het
Or7g16 AGG AG 9: 18,727,276 (GRCm39) probably null Het
Or7g34 T A 9: 19,477,822 (GRCm39) Q286L probably damaging Het
Or7h8 G T 9: 20,124,140 (GRCm39) R165L possibly damaging Het
Or8b41 G A 9: 38,054,727 (GRCm39) A94T probably benign Het
Or8b48 G T 9: 38,493,181 (GRCm39) G203W probably damaging Het
Or8c8 G T 9: 38,165,148 (GRCm39) C142F probably benign Het
Or8g22 T G 9: 38,958,215 (GRCm39) T167P probably damaging Het
Or8g37 A T 9: 39,731,651 (GRCm39) S239C probably damaging Het
Or8g51 C T 9: 38,609,224 (GRCm39) G146D possibly damaging Het
Or8g54 C A 9: 39,707,225 (GRCm39) L185M possibly damaging Het
Or8j3b G C 2: 86,205,459 (GRCm39) T99R possibly damaging Het
Or8j3c G C 2: 86,253,718 (GRCm39) L101V probably benign Het
Or8k17 C T 2: 86,066,802 (GRCm39) A119T probably damaging Het
Or8k22 A T 2: 86,163,050 (GRCm39) Y217N probably damaging Het
Or8k25 T A 2: 86,243,872 (GRCm39) S175C probably damaging Het
Or8k53 G T 2: 86,177,227 (GRCm39) N294K possibly damaging Het
Or9g4b T C 2: 85,616,464 (GRCm39) V203A probably damaging Het
Or9k2b A C 10: 130,015,834 (GRCm39) L305R possibly damaging Het
Or9m1b A C 2: 87,836,781 (GRCm39) C105G probably damaging Het
Or9q1 G T 19: 13,805,263 (GRCm39) L166I probably damaging Het
Or9s14 G T 1: 92,535,473 (GRCm39) probably benign Het
Osbpl7 G A 11: 96,950,979 (GRCm39) G609S probably damaging Het
Otof G T 5: 30,528,930 (GRCm39) A1826E probably damaging Het
Otogl A T 10: 107,614,734 (GRCm39) C1973S probably damaging Het
Otogl G T 10: 107,624,893 (GRCm39) H1582N probably benign Het
Otogl C T 10: 107,613,074 (GRCm39) R2046H probably benign Het
Otop3 T A 11: 115,230,670 (GRCm39) L147Q probably damaging Het
Otop3 C G 11: 115,231,838 (GRCm39) H234Q probably damaging Het
Otud4 C T 8: 80,385,558 (GRCm39) T217I probably benign Het
Otud6a C A X: 99,472,997 (GRCm39) R127S possibly damaging Het
Otud7a G T 7: 63,408,448 (GRCm39) R917L unknown Het
Oxct2a G T 4: 123,216,331 (GRCm39) P350Q probably damaging Het
Oxtr T A 6: 112,466,656 (GRCm39) N35Y probably damaging Het
P2rx6 G C 16: 17,385,919 (GRCm39) D223H probably damaging Het
P2ry14 A C 3: 59,023,158 (GRCm39) F101V probably damaging Het
P2ry4 G A X: 99,636,927 (GRCm39) R324C probably benign Het
Pabpc4 G A 4: 123,189,067 (GRCm39) G469D probably benign Het
Padi3 G T 4: 140,522,982 (GRCm39) A330E possibly damaging Het
Padi3 A G 4: 140,525,434 (GRCm39) L193P not run Het
Pafah1b1 T G 11: 74,581,067 (GRCm39) K54T probably damaging Het
Pafah1b1 C A 11: 74,579,945 (GRCm39) G86V probably benign Het
Pak5 A C 2: 135,925,166 (GRCm39) L712R probably damaging Het
Pam C A 1: 97,862,448 (GRCm39) R99L probably benign Het
Pam16 C A 16: 4,442,770 (GRCm39) probably benign Het
Pappa2 C G 1: 158,642,384 (GRCm39) G1287A probably damaging Het
Pappa2 A C 1: 158,784,503 (GRCm39) I169S probably benign Het
Pappa2 A T 1: 158,642,386 (GRCm39) D1286E probably damaging Het
Paqr8 G T 1: 21,005,022 (GRCm39) G59W probably damaging Het
Paqr9 G C 9: 95,442,359 (GRCm39) W116C possibly damaging Het
Pard3b G T 1: 62,278,051 (GRCm39) V694L probably benign Het
Pate11 A C 9: 36,387,807 (GRCm39) N31T probably damaging Het
Patj C T 4: 98,499,367 (GRCm39) S1347L probably benign Het
Patj A T 4: 98,564,555 (GRCm39) K1636* probably null Het
Pax3 C A 1: 78,099,227 (GRCm39) probably null Het
Pax5 C A 4: 44,697,678 (GRCm39) G19V probably damaging Het
Paxip1 C T 5: 27,988,727 (GRCm39) probably null Het
Pcdh1 C A 18: 38,331,741 (GRCm39) V560L possibly damaging Het
Pcdh15 G A 10: 74,466,533 (GRCm39) D1517N probably benign Het
Pcdh19 C T X: 132,582,841 (GRCm39) R763K probably null Het
Pcdh8 G A 14: 80,006,517 (GRCm39) P682L probably benign Het
Pcdha7 G C 18: 37,108,893 (GRCm39) E639D probably benign Het
Pcdhb10 AC A 18: 37,546,448 (GRCm39) probably null Het
Pcdhb13 C A 18: 37,576,288 (GRCm39) S222* probably null Het
Pcdhb16 C A 18: 37,612,213 (GRCm39) P391H probably damaging Het
Pcdhgb1 A T 18: 37,814,893 (GRCm39) Q461H probably benign Het
Pcgf2 T G 11: 97,580,847 (GRCm39) K332T probably damaging Het
Pck2 G T 14: 55,782,726 (GRCm39) A387S probably benign Het
Pclo G C 5: 14,731,793 (GRCm39) E306Q Het
Pclo C A 5: 14,762,662 (GRCm39) Q427K probably damaging Het
Pclo C A 5: 14,731,530 (GRCm39) S218Y possibly damaging Het
Pcna-ps2 G T 19: 9,261,476 (GRCm39) G245V probably damaging Het
Pcnt C A 10: 76,217,991 (GRCm39) E2095* probably null Het
Pcnx2 A C 8: 126,564,753 (GRCm39) L1047V probably benign Het
Pcnx2 G A 8: 126,488,393 (GRCm39) P1717L probably damaging Het
Pcnx3 T A 19: 5,737,248 (GRCm39) probably null Het
Pcolce2 G C 9: 95,519,889 (GRCm39) A15P possibly damaging Het
Pcsk1 A T 13: 75,246,161 (GRCm39) N180Y probably damaging Het
Pcsk4 G T 10: 80,158,560 (GRCm39) T564K possibly damaging Het
Pcsk9 G T 4: 106,316,138 (GRCm39) Q102K probably damaging Het
Pcx G T 19: 4,669,101 (GRCm39) V701L possibly damaging Het
Pcyt2 C G 11: 120,505,199 (GRCm39) G122A probably damaging Het
Pde11a C T 2: 76,025,249 (GRCm39) A451T probably benign Het
Pde1a G T 2: 79,736,372 (GRCm39) S87R probably damaging Het
Pde6c G T 19: 38,121,329 (GRCm39) probably benign Het
Pdk2 A C 11: 94,918,744 (GRCm39) L344V probably damaging Het
Pdk4 G T 6: 5,487,170 (GRCm39) S292Y probably damaging Het
Pds5a G C 5: 65,817,070 (GRCm39) S177R possibly damaging Het
Pdxdc1 C A 16: 13,720,907 (GRCm39) probably benign Het
Pdxk T G 10: 78,277,022 (GRCm39) T259P probably damaging Het
Pdzk1 A G 3: 96,761,873 (GRCm39) N162D probably benign Het
Pdzrn3 T A 6: 101,128,960 (GRCm39) S569C probably damaging Het
Pdzrn4 G A 15: 92,294,838 (GRCm39) A15T probably benign Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Peli3 C A 19: 4,984,995 (GRCm39) R172L probably benign Het
Penk G T 4: 4,138,106 (GRCm39) A13E probably damaging Het
Per2 T A 1: 91,349,215 (GRCm39) N1052I possibly damaging Het
Pfas C T 11: 68,893,313 (GRCm39) G91R probably damaging Het
Pfas T C 11: 68,880,896 (GRCm39) M198V Het
Pfkl C A 10: 77,835,970 (GRCm39) G213W probably damaging Het
Pfpl G T 19: 12,407,305 (GRCm39) E519* probably null Het
Pga5 T C 19: 10,646,523 (GRCm39) T372A probably damaging Het
Pgc C G 17: 48,039,793 (GRCm39) Y62* probably null Het
Pgd C A 4: 149,251,136 (GRCm39) probably benign Het
Pglyrp3 A T 3: 91,935,392 (GRCm39) H214L probably damaging Het
Pglyrp4 A G 3: 90,646,312 (GRCm39) Q282R probably damaging Het
Pgm1 C T 4: 99,836,194 (GRCm39) T444I probably damaging Het
Pgm2l1 G T 7: 99,919,662 (GRCm39) G586V possibly damaging Het
Phactr3 C A 2: 177,911,167 (GRCm39) P139Q probably damaging Het
Phax G T 18: 56,720,024 (GRCm39) G322W probably damaging Het
Phc3 C G 3: 30,990,746 (GRCm39) M478I probably benign Het
Pheta1 G C 5: 121,990,970 (GRCm39) A111P probably damaging Het
Phf2 T A 13: 48,961,183 (GRCm39) T836S unknown Het
Phf8-ps C A 17: 33,284,631 (GRCm39) D724Y possibly damaging Het
Phldb2 T A 16: 45,773,871 (GRCm39) probably benign Het
Phldb2 C A 16: 45,646,189 (GRCm39) A86S probably benign Het
Phldb2 C A 16: 45,646,190 (GRCm39) L85F probably benign Het
Phrf1 G C 7: 140,823,796 (GRCm39) G46R unknown Het
Phrf1 G T 7: 140,838,731 (GRCm39) R642L unknown Het
Picalm A T 7: 89,846,175 (GRCm39) S639C probably damaging Het
Pidd1 T A 7: 141,020,274 (GRCm39) S551C probably benign Het
Pigb C G 9: 72,941,854 (GRCm39) G135A probably benign Het
Pigr A C 1: 130,778,552 (GRCm39) E745D possibly damaging Het
Pigx T G 16: 31,906,243 (GRCm39) Q130P probably benign Het
Pik3c2b C A 1: 132,994,291 (GRCm39) S85Y probably damaging Het
Pik3c2b G T 1: 133,027,424 (GRCm39) E1308* probably null Het
Pik3cd TG T 4: 149,739,304 (GRCm39) probably null Het
Pik3cg T C 12: 32,254,794 (GRCm39) R398G probably damaging Het
Pik3r6 G A 11: 68,411,026 (GRCm39) probably benign Het
Pik3r6 G T 11: 68,435,591 (GRCm39) A614S probably benign Het
Pja2 C A 17: 64,599,864 (GRCm39) S540I probably damaging Het
Pkd1l1 C A 11: 8,776,801 (GRCm39) G2513C Het
Pkd1l2 G C 8: 117,781,653 (GRCm39) C797W probably damaging Het
Pkd1l3 C A 8: 110,349,874 (GRCm39) P240T unknown Het
Pkd2 G A 5: 104,607,915 (GRCm39) G138E probably benign Het
Pkd2l1 G T 19: 44,137,710 (GRCm39) T708K probably benign Het
Pkhd1 A C 1: 20,593,971 (GRCm39) F1381V possibly damaging Het
Pklr C G 3: 89,052,162 (GRCm39) P489R probably damaging Het
Pkn1 C T 8: 84,400,126 (GRCm39) R632Q probably damaging Het
Pkp2 T C 16: 16,048,564 (GRCm39) V323A probably benign Het
Pkp4 G C 2: 59,172,588 (GRCm39) probably null Het
Pla2g7 C G 17: 43,913,810 (GRCm39) A251G probably benign Het
Plagl1 A G 10: 13,004,460 (GRCm39) Q576R unknown Het
Plau A C 14: 20,889,549 (GRCm39) S205R probably damaging Het
Plcb2 T A 2: 118,553,609 (GRCm39) K171N probably damaging Het
Plcd4 T A 1: 74,587,285 (GRCm39) L15Q probably benign Het
Plcd4 C A 1: 74,596,951 (GRCm39) H398N probably damaging Het
Plce1 G T 19: 38,713,424 (GRCm39) E1231* probably null Het
Plce1 C T 19: 38,690,338 (GRCm39) A674V probably damaging Het
Plce1 A G 19: 38,757,904 (GRCm39) H1959R probably damaging Het
Plcg1 A T 2: 160,600,047 (GRCm39) R936W probably damaging Het
Plcl1 G A 1: 55,735,199 (GRCm39) G180D probably benign Het
Plcl1 C T 1: 55,790,443 (GRCm39) Q1038* probably null Het
Plcl2 T G 17: 50,915,484 (GRCm39) V831G probably damaging Het
Plcz1 C G 6: 139,959,402 (GRCm39) V252L possibly damaging Het
Pld1 T C 3: 28,130,682 (GRCm39) L494P probably damaging Het
Pld1 A T 3: 28,185,726 (GRCm39) K984* probably null Het
Pld6 G C 11: 59,678,264 (GRCm39) C66W probably damaging Het
Plekha6 G T 1: 133,200,209 (GRCm39) G263W probably damaging Het
Plekha6 G T 1: 133,191,551 (GRCm39) R40L probably benign Het
Plekhg3 G T 12: 76,622,630 (GRCm39) probably null Het
Plekhn1 C G 4: 156,307,888 (GRCm39) G346A possibly damaging Het
Plekho1 C G 3: 95,903,027 (GRCm39) G3A unknown Het
Plg A C 17: 12,633,072 (GRCm39) T678P probably benign Het
Plk1 C T 7: 121,766,873 (GRCm39) R364W not run Het
Plod1 C A 4: 148,007,657 (GRCm39) G342C probably damaging Het
Plppr4 T C 3: 117,116,498 (GRCm39) K453R probably damaging Het
Plxdc2 G A 2: 16,570,214 (GRCm39) G180E possibly damaging Het
Plxna1 C A 6: 89,298,034 (GRCm39) W1748L probably damaging Het
Plxna3 G T X: 73,379,626 (GRCm39) W788C probably damaging Het
Plxnb3 T A X: 72,802,771 (GRCm39) V213E probably damaging Het
Plxnc1 G T 10: 94,700,891 (GRCm39) P598T probably benign Het
Pm20d1 G T 1: 131,725,296 (GRCm39) E47D possibly damaging Het
Pmch T C 10: 87,927,695 (GRCm39) I132T not run Het
Pmfbp1 T A 8: 110,258,383 (GRCm39) L649Q probably damaging Het
Pnisr C G 4: 21,873,684 (GRCm39) R476G probably benign Het
Pnma8b C A 7: 16,680,735 (GRCm39) A573D possibly damaging Het
Pnpla8 CAGA CA 12: 44,342,773 (GRCm39) probably null Het
Pnpt1 C T 11: 29,095,475 (GRCm39) S408L probably benign Het
Pnpt1 G A 11: 29,095,477 (GRCm39) D409N possibly damaging Het
Poc5 G T 13: 96,538,230 (GRCm39) Q298H probably benign Het
Podxl T A 6: 31,505,569 (GRCm39) K158M probably damaging Het
Pola1 T G X: 92,524,210 (GRCm39) T1144P probably damaging Het
Pold1 G A 7: 44,191,656 (GRCm39) P110L probably benign Het
Pold1 C A 7: 44,191,204 (GRCm39) R209L probably benign Het
Pold4 G T 19: 4,282,226 (GRCm39) E27D probably benign Het
Polg G T 7: 79,103,489 (GRCm39) A960D probably damaging Het
Polg2 C A 11: 106,664,255 (GRCm39) V357F probably damaging Het
Polq G T 16: 36,862,619 (GRCm39) probably null Het
Polr2b A C 5: 77,479,818 (GRCm39) K524Q probably damaging Het
Pom121l12 C A 11: 14,549,681 (GRCm39) T129K probably damaging Het
Pom121l12 C A 11: 14,549,639 (GRCm39) A115E probably damaging Het
Pop7 C A 5: 137,500,449 (GRCm39) probably benign Het
Poteg G T 8: 27,937,982 (GRCm39) R46I possibly damaging Het
Pou2af2 G T 9: 51,202,864 (GRCm39) P97T probably benign Het
Pou5f2 G C 13: 78,173,216 (GRCm39) V53L probably benign Het
Pou6f2 T C 13: 18,553,220 (GRCm39) Q38R unknown Het
Ppfia2 A T 10: 106,310,506 (GRCm39) E4D probably damaging Het
Ppfia4 C A 1: 134,255,117 (GRCm39) R246L probably benign Het
Ppia G T 11: 6,369,600 (GRCm39) G162V possibly damaging Het
Ppip5k1 A C 2: 121,168,347 (GRCm39) L685R probably damaging Het
Ppl A T 16: 4,924,642 (GRCm39) L141Q probably damaging Het
Ppm1b G T 17: 85,301,693 (GRCm39) R191L probably damaging Het
Ppm1d G C 11: 85,230,399 (GRCm39) C339S probably benign Het
Ppm1g T A 5: 31,377,780 (GRCm39) probably benign Het
Ppm1n C A 7: 19,013,170 (GRCm39) E260D probably damaging Het
Ppp1r26 G T 2: 28,342,859 (GRCm39) G830W probably damaging Het
Ppp1r7 C A 1: 93,282,076 (GRCm39) T209N possibly damaging Het
Ppp2r1b AGGG AGG 9: 50,784,945 (GRCm39) probably null Het
Ppp2r2c C G 5: 37,088,621 (GRCm39) S163R probably benign Het
Ppp2r3d C G 9: 101,003,588 (GRCm39) A427P possibly damaging Het
Ppp4r1 G A 17: 66,145,921 (GRCm39) A887T probably damaging Het
Ppp4r3c1 A C X: 88,973,847 (GRCm39) N783K unknown Het
Pramel11 T A 4: 143,622,254 (GRCm39) Q367L probably damaging Het
Pramel16 C A 4: 143,676,693 (GRCm39) G137V probably benign Het
Pramel20 T C 4: 143,298,822 (GRCm39) I255T probably benign Het
Pramel23 G C 4: 143,423,515 (GRCm39) H425D probably benign Het
Pramel27 A G 4: 143,579,680 (GRCm39) S422G probably benign Het
Pramel29 A G 4: 143,934,031 (GRCm39) F359L probably benign Het
Pramel4 G T 4: 143,795,091 (GRCm39) G496W unknown Het
Pramel5 G T 4: 144,000,430 (GRCm39) R49S probably benign Het
Pramel6 G T 2: 87,339,066 (GRCm39) V89L probably benign Het
Prc1 C G 7: 79,956,233 (GRCm39) S311R probably damaging Het
Prcd C A 11: 116,550,194 (GRCm39) A74D probably damaging Het
Prdm1 A C 10: 44,322,829 (GRCm39) L207R probably damaging Het
Prdm10 A T 9: 31,227,464 (GRCm39) Q19L possibly damaging Het
Prdm10 G T 9: 31,227,589 (GRCm39) E65* probably null Het
Prdm13 A T 4: 21,679,518 (GRCm39) L324Q unknown Het
Prdm16 C A 4: 154,426,243 (GRCm39) G514V probably damaging Het
Prdx1 C G 4: 116,544,678 (GRCm39) P22A probably benign Het
Prelp G C 1: 133,842,619 (GRCm39) S175R probably damaging Het
Prep G T 10: 45,026,564 (GRCm39) G496V probably damaging Het
Prex1 C A 2: 166,414,890 (GRCm39) E1490* probably null Het
Prkar1a G C 11: 109,550,839 (GRCm39) Q64H probably benign Het
Prkcd T G 14: 30,332,206 (GRCm39) Q18H possibly damaging Het
Prkcsh A C 9: 21,924,351 (GRCm39) T494P probably damaging Het
Prkcz C T 4: 155,440,925 (GRCm39) R81H probably damaging Het
Prkcz G C 4: 155,439,137 (GRCm39) P103R probably damaging Het
Prkdc G T 16: 15,505,286 (GRCm39) G863* probably null Het
Prlr A G 15: 10,314,341 (GRCm39) S13G probably benign Het
Prmt6 C A 3: 110,157,446 (GRCm39) S281I probably benign Het
Proc C A 18: 32,268,032 (GRCm39) Q35H probably benign Het
Prom2 C A 2: 127,374,695 (GRCm39) G614W probably damaging Het
Prp2 A T 6: 132,577,200 (GRCm39) Q162H unknown Het
Prpf40a C G 2: 53,034,887 (GRCm39) R767P probably damaging Het
Prpsap1 G T 11: 116,370,594 (GRCm39) A116D possibly damaging Het
Prpsap1 C A 11: 11