Incidental Mutation 'R0650:Scg3'
ID 62221
Institutional Source Beutler Lab
Gene Symbol Scg3
Ensembl Gene ENSMUSG00000032181
Gene Name secretogranin III
Synonyms SgIII, Chgd, 1B1075
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0650 (G1)
Quality Score 149
Status Validated
Chromosome 9
Chromosomal Location 75643189-75684056 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75669335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000149561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]
AlphaFold P47867
Predicted Effect probably damaging
Transcript: ENSMUST00000034699
AA Change: S253P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181
AA Change: S253P

DomainStartEndE-ValueType
Pfam:SGIII 20 471 1.3e-215 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194973
Predicted Effect probably damaging
Transcript: ENSMUST00000213324
AA Change: S253P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215603
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Scg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Scg3 APN 9 75663237 missense probably damaging 1.00
IGL02221:Scg3 APN 9 75683657 missense probably damaging 0.99
IGL03391:Scg3 APN 9 75661251 critical splice donor site probably null
R0137:Scg3 UTSW 9 75663180 unclassified probably benign
R0366:Scg3 UTSW 9 75675338 splice site probably benign
R0654:Scg3 UTSW 9 75665735 missense probably damaging 1.00
R0666:Scg3 UTSW 9 75643940 nonsense probably null
R0827:Scg3 UTSW 9 75683697 missense possibly damaging 0.81
R1317:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1553:Scg3 UTSW 9 75669304 missense probably null 1.00
R1751:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1761:Scg3 UTSW 9 75676758 missense probably damaging 1.00
R1850:Scg3 UTSW 9 75682167 missense possibly damaging 0.56
R2059:Scg3 UTSW 9 75665716 missense probably damaging 1.00
R2137:Scg3 UTSW 9 75676810 missense probably damaging 0.96
R2384:Scg3 UTSW 9 75665726 missense probably damaging 1.00
R3870:Scg3 UTSW 9 75675499 splice site probably benign
R4260:Scg3 UTSW 9 75651697 missense probably damaging 1.00
R5371:Scg3 UTSW 9 75661301 missense probably damaging 1.00
R5417:Scg3 UTSW 9 75669256 missense probably benign 0.02
R6013:Scg3 UTSW 9 75676808 missense probably damaging 1.00
R7052:Scg3 UTSW 9 75661382 nonsense probably null
R7202:Scg3 UTSW 9 75683710 missense probably benign 0.06
R7211:Scg3 UTSW 9 75682084 missense probably benign 0.00
R7471:Scg3 UTSW 9 75682092 missense probably damaging 1.00
R7490:Scg3 UTSW 9 75669277 missense possibly damaging 0.94
R7651:Scg3 UTSW 9 75682050 missense probably benign 0.03
R7904:Scg3 UTSW 9 75643867 missense probably damaging 1.00
R9045:Scg3 UTSW 9 75663240 missense probably damaging 1.00
R9228:Scg3 UTSW 9 75651673 missense probably damaging 1.00
Z1176:Scg3 UTSW 9 75669316 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGCCGTTGGGAACCATGAACAG -3'
(R):5'- TCGTCCAGACACAAATGCTGCC -3'

Sequencing Primer
(F):5'- ACACACTTTCAAGAATTTCCGTC -3'
(R):5'- CTGCCTGAAAGTTCCAAAGTGTG -3'
Posted On 2013-07-30