Incidental Mutation 'R0650:Susd5'
ID 62222
Institutional Source Beutler Lab
Gene Symbol Susd5
Ensembl Gene ENSMUSG00000086596
Gene Name sushi domain containing 5
Synonyms LOC382111
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R0650 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 114057140-114098728 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114082535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 171 (H171L)
Ref Sequence ENSEMBL: ENSMUSP00000128826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135338]
AlphaFold G3UW60
Predicted Effect possibly damaging
Transcript: ENSMUST00000135338
AA Change: H171L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128826
Gene: ENSMUSG00000086596
AA Change: H171L

signal peptide 1 32 N/A INTRINSIC
LINK 33 130 7.42e-26 SMART
CCP 136 193 9.65e-1 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 485 496 N/A INTRINSIC
transmembrane domain 566 588 N/A INTRINSIC
Meta Mutation Damage Score 0.2477 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Susd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Susd5 APN 9 114068879 splice site probably benign
IGL01720:Susd5 APN 9 114063984 missense possibly damaging 0.85
IGL02739:Susd5 APN 9 114096033 missense possibly damaging 0.72
H8441:Susd5 UTSW 9 114096185 nonsense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0666:Susd5 UTSW 9 114095784 missense possibly damaging 0.53
R1478:Susd5 UTSW 9 114096684 missense probably benign
R1672:Susd5 UTSW 9 114068822 missense probably damaging 0.99
R3416:Susd5 UTSW 9 114095658 missense possibly damaging 0.85
R3965:Susd5 UTSW 9 114096192 missense possibly damaging 0.72
R4182:Susd5 UTSW 9 114095985 missense probably benign 0.12
R4514:Susd5 UTSW 9 114095924 missense probably benign 0.18
R5373:Susd5 UTSW 9 114082585 missense probably damaging 1.00
R5947:Susd5 UTSW 9 114057591 missense possibly damaging 0.96
R6189:Susd5 UTSW 9 114095658 missense probably damaging 0.98
R6349:Susd5 UTSW 9 114095802 missense probably benign 0.33
R7535:Susd5 UTSW 9 114064040 missense possibly damaging 0.92
R8973:Susd5 UTSW 9 114082504 missense possibly damaging 0.86
R9143:Susd5 UTSW 9 114095811 missense possibly damaging 0.86
R9145:Susd5 UTSW 9 114096221 missense probably damaging 1.00
Z1176:Susd5 UTSW 9 114096140 missense probably damaging 0.98
Z1177:Susd5 UTSW 9 114064067 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtctctgtgtctctgtctgtc -3'
Posted On 2013-07-30