Incidental Mutation 'R0650:Sgk1'
ID 62223
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Name serum/glucocorticoid regulated kinase 1
Synonyms Sgk, Sgk1
MMRRC Submission 038835-MU
Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0650 (G1)
Quality Score 190
Status Validated
Chromosome 10
Chromosomal Location 21882184-21999903 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21882657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 7 (N7D)
Ref Sequence ENSEMBL: ENSMUSP00000114074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120509]
AlphaFold Q9WVC6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116957
Predicted Effect probably damaging
Transcript: ENSMUST00000120509
AA Change: N7D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: N7D

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143094
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21995541 missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21928546 missense probably benign
IGL03220:Sgk1 APN 10 21997391 missense probably null 1.00
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0467:Sgk1 UTSW 10 21996358 splice site probably benign
R0479:Sgk1 UTSW 10 21996310 missense probably benign 0.00
R0652:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21998160 missense probably benign
R0990:Sgk1 UTSW 10 21997086 missense probably damaging 1.00
R1769:Sgk1 UTSW 10 21997108 splice site probably benign
R2009:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2314:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21994816 missense probably benign
R2915:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3176:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21997412 missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21996249 missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21882694 missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21994073 missense probably benign 0.01
R7425:Sgk1 UTSW 10 21994110 missense probably damaging 0.97
R7665:Sgk1 UTSW 10 21996662 missense probably damaging 1.00
R7973:Sgk1 UTSW 10 21994155 missense probably benign 0.01
R8252:Sgk1 UTSW 10 21997399 missense probably damaging 1.00
R8855:Sgk1 UTSW 10 21995827 missense probably benign 0.12
R9199:Sgk1 UTSW 10 21882659 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGATAGATTTGCTGTATCCCGCC -3'
(R):5'- TGACACCAGAAGCTCTGCTTTCAC -3'

Sequencing Primer
(F):5'- ATTGCCAGTGGCCTCTGAAAG -3'
(R):5'- TTTCACGAAGGGCTCAGTAAC -3'
Posted On 2013-07-30