Incidental Mutation 'R0650:Depdc1b'
ID 62226
Institutional Source Beutler Lab
Gene Symbol Depdc1b
Ensembl Gene ENSMUSG00000021697
Gene Name DEP domain containing 1B
Synonyms XTP1
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0650 (G1)
Quality Score 148
Status Validated
Chromosome 13
Chromosomal Location 108316332-108407782 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108323909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 18 (N18D)
Ref Sequence ENSEMBL: ENSMUSP00000132972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051594] [ENSMUST00000163307] [ENSMUST00000171178]
AlphaFold Q8BH88
Predicted Effect probably damaging
Transcript: ENSMUST00000051594
AA Change: N18D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059291
Gene: ENSMUSG00000021697
AA Change: N18D

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 267 347 8.3e-10 PFAM
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163307
AA Change: N18D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131707
Gene: ENSMUSG00000021697
AA Change: N18D

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 264 347 7.9e-10 PFAM
low complexity region 464 480 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168037
Predicted Effect probably damaging
Transcript: ENSMUST00000171178
AA Change: N18D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132972
Gene: ENSMUSG00000021697
AA Change: N18D

DomainStartEndE-ValueType
DEP 24 108 4.36e-20 SMART
Pfam:RhoGAP 264 347 9.1e-10 PFAM
Meta Mutation Damage Score 0.9001 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Depdc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Depdc1b APN 13 108357440 missense probably benign
IGL01071:Depdc1b APN 13 108357441 missense probably benign
IGL01778:Depdc1b APN 13 108362327 missense probably benign 0.02
IGL02368:Depdc1b APN 13 108363579 missense probably benign
R0310:Depdc1b UTSW 13 108373841 missense possibly damaging 0.88
R0483:Depdc1b UTSW 13 108373848 missense probably benign 0.03
R0900:Depdc1b UTSW 13 108362260 missense possibly damaging 0.68
R0932:Depdc1b UTSW 13 108386835 missense probably benign 0.23
R1757:Depdc1b UTSW 13 108323948 missense probably damaging 1.00
R2174:Depdc1b UTSW 13 108362253 nonsense probably null
R2308:Depdc1b UTSW 13 108373841 missense possibly damaging 0.88
R3941:Depdc1b UTSW 13 108368836 missense probably damaging 1.00
R4213:Depdc1b UTSW 13 108388691 missense probably damaging 1.00
R4613:Depdc1b UTSW 13 108363643 missense probably damaging 1.00
R4771:Depdc1b UTSW 13 108382900 missense probably benign 0.14
R5224:Depdc1b UTSW 13 108384820 missense probably damaging 1.00
R5292:Depdc1b UTSW 13 108373842 missense probably damaging 0.99
R6241:Depdc1b UTSW 13 108324119 missense possibly damaging 0.78
R6399:Depdc1b UTSW 13 108324046 missense probably damaging 1.00
R6418:Depdc1b UTSW 13 108357422 missense probably damaging 0.97
R7078:Depdc1b UTSW 13 108386971 missense possibly damaging 0.93
R7120:Depdc1b UTSW 13 108362247 missense probably benign 0.01
R7127:Depdc1b UTSW 13 108323928 missense probably damaging 1.00
R7209:Depdc1b UTSW 13 108382855 missense possibly damaging 0.55
R7385:Depdc1b UTSW 13 108363632 missense probably damaging 1.00
R8098:Depdc1b UTSW 13 108324059 missense probably damaging 0.97
R8552:Depdc1b UTSW 13 108357425 missense probably damaging 1.00
R8825:Depdc1b UTSW 13 108384782 missense possibly damaging 0.56
R8975:Depdc1b UTSW 13 108388560 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTTGCATTACTTGCAGTCACC -3'
(R):5'- ACACCCTGCCATTACCTGTAGAGG -3'

Sequencing Primer
(F):5'- tccatctacctatttacccacttac -3'
(R):5'- CCATTACCTGTAGAGGTGACG -3'
Posted On 2013-07-30