Mutagenetix > Incidental Mutations

Incidental Mutation 'R0650:Chd8'

62227

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

038835-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0650 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52202304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 964 (E964G)

Ref Sequence

ENSEMBL: ENSMUSP00000122995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046709] [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

AlphaFold

Q09XV5

Predicted Effect

probably benign
Transcript: ENSMUST00000046709

SMART Domains

Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726

Domain	Start	End	E-Value	Type
FACT-Spt16_Nlob	5	168	2.95e-87	SMART
Pfam:Peptidase_M24	181	411	2.9e-35	PFAM
low complexity region	435	449	N/A	INTRINSIC
coiled coil region	462	493	N/A	INTRINSIC
SPT16	529	689	3.38e-96	SMART
Rtt106	806	896	1.61e-38	SMART
low complexity region	926	946	N/A	INTRINSIC
low complexity region	951	988	N/A	INTRINSIC
coiled coil region	994	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: E2304G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: E2304G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: E964G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: E964G

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: E2304G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: E2304G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
Atg16l1	A	T	1: 87,781,699	D403V	possibly damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lamc2	T	A	1: 153,143,876	I440F	possibly damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Lrrk1	G	A	7: 66,292,336	A718V	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pik3c2a	A	G	7: 116,346,247		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr5	T	C	15: 38,030,807		probably benign	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGCTAGAAATCGGGGATCAACAGC -3'
(R):5'- GTCAGACAGCCAAAGTTCTCCCAG -3'

Sequencing Primer
(F):5'- GCAAACTCTGGATGACCCTG -3'
(R):5'- CATTCCAGAAGCATAGATTGATGGC -3'

Posted On

2013-07-30