Incidental Mutation 'R0650:Chd8'
ID 62227
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Name chromodomain helicase DNA binding protein 8
Synonyms 5830451P18Rik, Duplin
MMRRC Submission 038835-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0650 (G1)
Quality Score 200
Status Validated
Chromosome 14
Chromosomal Location 52435608-52495237 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52439761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 964 (E964G)
Ref Sequence ENSEMBL: ENSMUSP00000122995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709] [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]
AlphaFold Q09XV5
Predicted Effect probably benign
Transcript: ENSMUST00000046709
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: E2304G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: E2304G

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147827
Predicted Effect probably benign
Transcript: ENSMUST00000149975
AA Change: E964G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: E964G

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: E2304G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: E2304G

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Predicted Effect probably benign
Transcript: ENSMUST00000227897
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 68,989,391 (GRCm39) S96G unknown Het
4930447C04Rik T C 12: 72,956,830 (GRCm39) D120G probably damaging Het
Actmap A T 7: 26,902,072 (GRCm39) H233L probably damaging Het
Adgrg5 T A 8: 95,660,785 (GRCm39) probably null Het
Afg3l2 G T 18: 67,548,627 (GRCm39) H534Q possibly damaging Het
Ankar G A 1: 72,695,380 (GRCm39) probably benign Het
Arid2 T A 15: 96,299,930 (GRCm39) F1814L possibly damaging Het
Asb15 C T 6: 24,566,163 (GRCm39) A372V probably damaging Het
Atg16l1 A T 1: 87,709,421 (GRCm39) D403V possibly damaging Het
Bnc2 T C 4: 84,211,433 (GRCm39) D407G probably benign Het
Ccdc121 T C 5: 31,643,312 (GRCm39) probably benign Het
Cdan1 A G 2: 120,556,526 (GRCm39) V633A probably benign Het
Cfap46 T C 7: 139,185,571 (GRCm39) Y2482C unknown Het
Cyp2s1 A G 7: 25,508,683 (GRCm39) V253A probably damaging Het
Depdc1b A G 13: 108,460,443 (GRCm39) N18D probably damaging Het
Fis1 T A 5: 136,991,048 (GRCm39) V4E probably damaging Het
Gba2 T A 4: 43,570,424 (GRCm39) probably null Het
Gm2381 C T 7: 42,469,504 (GRCm39) G207R probably damaging Het
Gpr89 T A 3: 96,804,640 (GRCm39) probably benign Het
Gtf2i A G 5: 134,290,691 (GRCm39) probably benign Het
Herc2 T G 7: 55,762,958 (GRCm39) S896A probably damaging Het
Huwe1 T C X: 150,659,309 (GRCm39) S921P probably damaging Het
Iqgap1 T A 7: 80,386,143 (GRCm39) K936I probably damaging Het
Kcna4 T A 2: 107,125,927 (GRCm39) Y220* probably null Het
Krt18 A G 15: 101,937,920 (GRCm39) D139G possibly damaging Het
Krt87 T C 15: 101,384,921 (GRCm39) N392D probably damaging Het
L3mbtl4 G A 17: 69,081,286 (GRCm39) C558Y probably damaging Het
Lamc2 T A 1: 153,019,622 (GRCm39) I440F possibly damaging Het
Lrrc28 T C 7: 67,267,833 (GRCm39) N98S probably damaging Het
Lrrk1 G A 7: 65,942,084 (GRCm39) A718V probably damaging Het
Mrgprx2 T C 7: 48,132,666 (GRCm39) I51V probably damaging Het
Myt1 A T 2: 181,424,408 (GRCm39) R25* probably null Het
Npdc1 C T 2: 25,298,021 (GRCm39) T199I probably benign Het
Nup98 T A 7: 101,801,660 (GRCm39) Y755F probably damaging Het
Or51q1c A G 7: 103,652,446 (GRCm39) probably null Het
Or5p69 T A 7: 107,966,996 (GRCm39) C100S probably damaging Het
Or5p76 G T 7: 108,122,289 (GRCm39) N289K probably damaging Het
Or8g22 T A 9: 38,957,996 (GRCm39) M240L probably benign Het
Osgin1 A T 8: 120,172,211 (GRCm39) Y335F probably damaging Het
Pde10a A T 17: 9,161,797 (GRCm39) I493F probably damaging Het
Pdgfrb A G 18: 61,212,780 (GRCm39) I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 (GRCm39) probably benign Het
Pidd1 A T 7: 141,020,726 (GRCm39) L457* probably null Het
Pik3c2a A G 7: 115,945,482 (GRCm39) probably benign Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Plcg1 C T 2: 160,595,283 (GRCm39) probably benign Het
Prr13 A C 15: 102,370,650 (GRCm39) *138C probably null Het
Prrc2b T C 2: 32,119,267 (GRCm39) probably benign Het
Psph T C 5: 129,868,633 (GRCm39) probably benign Het
Ripor1 A G 8: 106,344,746 (GRCm39) probably benign Het
Scg3 A G 9: 75,576,617 (GRCm39) S253P probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Sgk1 A G 10: 21,758,556 (GRCm39) N7D probably damaging Het
Skor2 T C 18: 76,964,255 (GRCm39) F940L probably benign Het
Slbp T C 5: 33,802,833 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Susd5 A T 9: 113,911,603 (GRCm39) H171L possibly damaging Het
Sybu T C 15: 44,536,664 (GRCm39) E354G probably benign Het
Synpo T C 18: 60,735,412 (GRCm39) N845D possibly damaging Het
Tdrd6 A T 17: 43,939,050 (GRCm39) I666N probably damaging Het
Tm9sf4 T C 2: 153,029,285 (GRCm39) I111T probably benign Het
Tnc T C 4: 63,926,971 (GRCm39) T852A probably benign Het
Tnfrsf10b T A 14: 70,013,625 (GRCm39) I185K probably damaging Het
Tnks1bp1 A G 2: 84,892,974 (GRCm39) E305G possibly damaging Het
Tnrc6b T C 15: 80,668,959 (GRCm39) V22A probably benign Het
Ttn A T 2: 76,598,956 (GRCm39) F19319Y probably damaging Het
Ubr5 T C 15: 38,031,051 (GRCm39) probably benign Het
Ugt2b5 T A 5: 87,287,627 (GRCm39) Q191L probably benign Het
Urod T C 4: 116,848,473 (GRCm39) T300A probably benign Het
Vmn1r213 A G 13: 23,195,564 (GRCm39) probably benign Het
Znfx1 G A 2: 166,889,574 (GRCm39) Q723* probably null Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52,463,595 (GRCm39) missense probably damaging 0.99
IGL00694:Chd8 APN 14 52,455,427 (GRCm39) missense probably damaging 1.00
IGL01011:Chd8 APN 14 52,468,989 (GRCm39) missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52,474,450 (GRCm39) missense probably benign
IGL01066:Chd8 APN 14 52,455,223 (GRCm39) missense probably damaging 1.00
IGL01083:Chd8 APN 14 52,458,877 (GRCm39) missense probably damaging 1.00
IGL01313:Chd8 APN 14 52,448,032 (GRCm39) missense probably damaging 1.00
IGL01396:Chd8 APN 14 52,442,044 (GRCm39) unclassified probably benign
IGL01476:Chd8 APN 14 52,442,947 (GRCm39) missense probably benign 0.32
IGL01731:Chd8 APN 14 52,450,111 (GRCm39) missense probably benign 0.12
IGL01895:Chd8 APN 14 52,436,551 (GRCm39) missense probably benign 0.00
IGL02090:Chd8 APN 14 52,464,691 (GRCm39) critical splice donor site probably null
IGL02344:Chd8 APN 14 52,439,107 (GRCm39) missense probably damaging 1.00
IGL02573:Chd8 APN 14 52,457,191 (GRCm39) missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52,451,757 (GRCm39) missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52,472,648 (GRCm39) missense probably benign 0.34
IGL02873:Chd8 APN 14 52,459,970 (GRCm39) missense probably damaging 0.99
IGL02974:Chd8 APN 14 52,439,158 (GRCm39) splice site probably null
IGL03058:Chd8 APN 14 52,455,730 (GRCm39) missense probably damaging 1.00
IGL03076:Chd8 APN 14 52,463,619 (GRCm39) splice site probably benign
IGL03239:Chd8 APN 14 52,465,005 (GRCm39) missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52,455,706 (GRCm39) missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52,455,338 (GRCm39) missense possibly damaging 0.95
PIT4468001:Chd8 UTSW 14 52,445,453 (GRCm39) missense probably benign
R0006:Chd8 UTSW 14 52,472,750 (GRCm39) missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52,472,750 (GRCm39) missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52,470,312 (GRCm39) missense probably benign 0.00
R0115:Chd8 UTSW 14 52,474,663 (GRCm39) missense probably benign 0.00
R0131:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0131:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0132:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0419:Chd8 UTSW 14 52,441,517 (GRCm39) missense probably benign 0.24
R0440:Chd8 UTSW 14 52,442,283 (GRCm39) missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52,452,044 (GRCm39) missense probably damaging 1.00
R0481:Chd8 UTSW 14 52,474,663 (GRCm39) missense probably benign 0.00
R0624:Chd8 UTSW 14 52,457,214 (GRCm39) missense possibly damaging 0.65
R0691:Chd8 UTSW 14 52,450,890 (GRCm39) missense probably damaging 0.96
R0790:Chd8 UTSW 14 52,441,482 (GRCm39) missense probably benign 0.07
R0835:Chd8 UTSW 14 52,441,482 (GRCm39) missense probably benign 0.07
R1180:Chd8 UTSW 14 52,458,565 (GRCm39) missense probably damaging 1.00
R1411:Chd8 UTSW 14 52,462,103 (GRCm39) missense probably benign
R1725:Chd8 UTSW 14 52,470,030 (GRCm39) missense probably benign 0.08
R1838:Chd8 UTSW 14 52,442,340 (GRCm39) missense probably benign 0.11
R1839:Chd8 UTSW 14 52,442,340 (GRCm39) missense probably benign 0.11
R1968:Chd8 UTSW 14 52,458,450 (GRCm39) missense probably damaging 0.98
R2020:Chd8 UTSW 14 52,452,698 (GRCm39) missense probably damaging 1.00
R2024:Chd8 UTSW 14 52,468,950 (GRCm39) missense probably benign 0.23
R2139:Chd8 UTSW 14 52,474,428 (GRCm39) missense probably benign 0.32
R2163:Chd8 UTSW 14 52,436,275 (GRCm39) missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52,442,674 (GRCm39) missense probably benign 0.25
R2844:Chd8 UTSW 14 52,441,952 (GRCm39) missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52,443,110 (GRCm39) missense probably benign 0.00
R3861:Chd8 UTSW 14 52,474,578 (GRCm39) missense probably benign 0.13
R4154:Chd8 UTSW 14 52,444,668 (GRCm39) unclassified probably benign
R4445:Chd8 UTSW 14 52,441,984 (GRCm39) splice site probably null
R4628:Chd8 UTSW 14 52,444,372 (GRCm39) missense probably benign 0.03
R4779:Chd8 UTSW 14 52,468,963 (GRCm39) missense probably damaging 1.00
R4783:Chd8 UTSW 14 52,442,825 (GRCm39) missense probably damaging 1.00
R4784:Chd8 UTSW 14 52,442,825 (GRCm39) missense probably damaging 1.00
R5001:Chd8 UTSW 14 52,441,372 (GRCm39) missense probably benign 0.09
R5280:Chd8 UTSW 14 52,442,582 (GRCm39) missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52,439,571 (GRCm39) intron probably benign
R5348:Chd8 UTSW 14 52,470,155 (GRCm39) missense probably damaging 1.00
R5375:Chd8 UTSW 14 52,441,611 (GRCm39) missense probably damaging 1.00
R5470:Chd8 UTSW 14 52,450,066 (GRCm39) missense probably damaging 1.00
R5479:Chd8 UTSW 14 52,452,652 (GRCm39) missense probably benign 0.15
R5488:Chd8 UTSW 14 52,450,505 (GRCm39) intron probably benign
R5489:Chd8 UTSW 14 52,450,505 (GRCm39) intron probably benign
R5499:Chd8 UTSW 14 52,441,888 (GRCm39) critical splice donor site probably null
R5988:Chd8 UTSW 14 52,455,395 (GRCm39) missense probably damaging 1.00
R6046:Chd8 UTSW 14 52,458,528 (GRCm39) missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52,444,491 (GRCm39) missense probably benign 0.16
R6212:Chd8 UTSW 14 52,439,155 (GRCm39) missense probably damaging 1.00
R6337:Chd8 UTSW 14 52,441,566 (GRCm39) missense probably damaging 1.00
R6394:Chd8 UTSW 14 52,440,042 (GRCm39) missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52,453,533 (GRCm39) missense probably damaging 1.00
R6590:Chd8 UTSW 14 52,464,694 (GRCm39) missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52,464,694 (GRCm39) missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52,464,125 (GRCm39) missense probably benign 0.33
R6913:Chd8 UTSW 14 52,451,951 (GRCm39) missense probably damaging 0.99
R7090:Chd8 UTSW 14 52,452,677 (GRCm39) missense probably damaging 0.99
R7107:Chd8 UTSW 14 52,450,129 (GRCm39) missense probably benign 0.07
R7138:Chd8 UTSW 14 52,451,955 (GRCm39) missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52,452,776 (GRCm39) missense probably damaging 1.00
R7392:Chd8 UTSW 14 52,470,312 (GRCm39) missense probably benign
R7471:Chd8 UTSW 14 52,441,569 (GRCm39) missense probably benign
R7625:Chd8 UTSW 14 52,474,534 (GRCm39) missense probably benign 0.04
R7790:Chd8 UTSW 14 52,463,539 (GRCm39) missense probably damaging 1.00
R7862:Chd8 UTSW 14 52,451,734 (GRCm39) missense probably damaging 1.00
R7937:Chd8 UTSW 14 52,464,963 (GRCm39) missense probably benign 0.02
R8092:Chd8 UTSW 14 52,455,184 (GRCm39) missense probably damaging 1.00
R8237:Chd8 UTSW 14 52,450,809 (GRCm39) missense probably damaging 1.00
R8321:Chd8 UTSW 14 52,470,024 (GRCm39) missense probably benign 0.01
R8371:Chd8 UTSW 14 52,470,275 (GRCm39) missense probably benign
R8425:Chd8 UTSW 14 52,448,012 (GRCm39) missense probably damaging 1.00
R8674:Chd8 UTSW 14 52,450,463 (GRCm39) missense probably damaging 0.98
R8794:Chd8 UTSW 14 52,441,904 (GRCm39) missense probably damaging 0.98
R8828:Chd8 UTSW 14 52,448,037 (GRCm39) frame shift probably null
R8909:Chd8 UTSW 14 52,450,389 (GRCm39) missense possibly damaging 0.82
R9194:Chd8 UTSW 14 52,439,650 (GRCm39) missense probably benign 0.01
R9278:Chd8 UTSW 14 52,472,627 (GRCm39) missense probably benign 0.01
R9489:Chd8 UTSW 14 52,457,055 (GRCm39) missense probably damaging 0.98
R9501:Chd8 UTSW 14 52,452,045 (GRCm39) missense probably benign 0.04
R9546:Chd8 UTSW 14 52,453,408 (GRCm39) missense probably damaging 1.00
R9605:Chd8 UTSW 14 52,457,055 (GRCm39) missense probably damaging 0.98
R9694:Chd8 UTSW 14 52,441,341 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGCTAGAAATCGGGGATCAACAGC -3'
(R):5'- GTCAGACAGCCAAAGTTCTCCCAG -3'

Sequencing Primer
(F):5'- GCAAACTCTGGATGACCCTG -3'
(R):5'- CATTCCAGAAGCATAGATTGATGGC -3'
Posted On 2013-07-30