Mutagenetix > Incidental Mutations

Incidental Mutation 'R0650:Ubr5'

62229

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

038835-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0650 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 38030807 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

Predicted Effect

probably benign
Transcript: ENSMUST00000110336

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226414

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N15Rik	A	G	X: 69,945,785	S96G	unknown	Het
4930447C04Rik	T	C	12: 72,910,056	D120G	probably damaging	Het
4930548H24Rik	T	C	5: 31,485,968		probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Afg3l2	G	T	18: 67,415,557	H534Q	possibly damaging	Het
Ankar	G	A	1: 72,656,221		probably benign	Het
Arid2	T	A	15: 96,402,049	F1814L	possibly damaging	Het
Asb15	C	T	6: 24,566,164	A372V	probably damaging	Het
Atg16l1	A	T	1: 87,781,699	D403V	possibly damaging	Het
BC024978	A	T	7: 27,202,647	H233L	probably damaging	Het
Bnc2	T	C	4: 84,293,196	D407G	probably benign	Het
Cdan1	A	G	2: 120,726,045	V633A	probably benign	Het
Cfap46	T	C	7: 139,605,655	Y2482C	unknown	Het
Chd8	T	C	14: 52,202,304	E964G	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Depdc1b	A	G	13: 108,323,909	N18D	probably damaging	Het
Fis1	T	A	5: 136,962,194	V4E	probably damaging	Het
Gba2	T	A	4: 43,570,424		probably null	Het
Gm2381	C	T	7: 42,820,080	G207R	probably damaging	Het
Gpr89	T	A	3: 96,897,324		probably benign	Het
Gtf2i	A	G	5: 134,261,837		probably benign	Het
Herc2	T	G	7: 56,113,210	S896A	probably damaging	Het
Huwe1	T	C	X: 151,876,313	S921P	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kcna4	T	A	2: 107,295,582	Y220*	probably null	Het
Krt18	A	G	15: 102,029,485	D139G	possibly damaging	Het
Krt83	T	C	15: 101,487,040	N392D	probably damaging	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lamc2	T	A	1: 153,143,876	I440F	possibly damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Lrrk1	G	A	7: 66,292,336	A718V	probably damaging	Het
Mrgprx2	T	C	7: 48,482,918	I51V	probably damaging	Het
Myt1	A	T	2: 181,782,615	R25*	probably null	Het
Npdc1	C	T	2: 25,408,009	T199I	probably benign	Het
Nup98	T	A	7: 102,152,453	Y755F	probably damaging	Het
Olfr494	T	A	7: 108,367,789	C100S	probably damaging	Het
Olfr502	G	T	7: 108,523,082	N289K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr936	T	A	9: 39,046,700	M240L	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pde10a	A	T	17: 8,942,965	I493F	probably damaging	Het
Pdgfrb	A	G	18: 61,079,708	I895V	probably benign	Het
Peg10	T	TCCCCANNANNNN	6: 4,756,475		probably benign	Het
Pidd1	A	T	7: 141,440,813	L457*	probably null	Het
Pik3c2a	A	G	7: 116,346,247		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plcg1	C	T	2: 160,753,363		probably benign	Het
Prr13	A	C	15: 102,462,215	*138C	probably null	Het
Prrc2b	T	C	2: 32,229,255		probably benign	Het
Psph	T	C	5: 129,791,570		probably benign	Het
Ripor1	A	G	8: 105,618,114		probably benign	Het
Scg3	A	G	9: 75,669,335	S253P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Skor2	T	C	18: 76,876,560	F940L	probably benign	Het
Slbp	T	C	5: 33,645,489		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Susd5	A	T	9: 114,082,535	H171L	possibly damaging	Het
Sybu	T	C	15: 44,673,268	E354G	probably benign	Het
Synpo	T	C	18: 60,602,340	N845D	possibly damaging	Het
Tdrd6	A	T	17: 43,628,159	I666N	probably damaging	Het
Tm9sf4	T	C	2: 153,187,365	I111T	probably benign	Het
Tnc	T	C	4: 64,008,734	T852A	probably benign	Het
Tnfrsf10b	T	A	14: 69,776,176	I185K	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,630	E305G	possibly damaging	Het
Tnrc6b	T	C	15: 80,784,758	V22A	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ugt2b5	T	A	5: 87,139,768	Q191L	probably benign	Het
Urod	T	C	4: 116,991,276	T300A	probably benign	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Znfx1	G	A	2: 167,047,654	Q723*	probably null	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense	probably damaging	0.98
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense	probably benign	0.22
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R7924:Ubr5	UTSW	15	37980906	missense
R7952:Ubr5	UTSW	15	37979832	missense	probably null
R7979:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- CAGCTTTAAGCGTGAAACGTCCATC -3'
(R):5'- TCTGTCTGGAAAGAGGAAGCAGCC -3'

Sequencing Primer
(F):5'- GATGCAAAAATGGTCCCTACCTTG -3'
(R):5'- TTACAAGCAGTGTCCAAATCAAGG -3'

Posted On

2013-07-30