Incidental Mutation 'Z1176:Prtg'
ID 622292
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Name protogenin
Synonyms Igdcc5, A230098A12Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.721) question?
Stock # Z1176 ()
Quality Score 147.008
Status Not validated
Chromosome 9
Chromosomal Location 72806874-72917291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72893968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 860 (G860E)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
AlphaFold Q2EY15
Predicted Effect probably damaging
Transcript: ENSMUST00000055535
AA Change: G860E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: G860E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 3316 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C A 2: 32,381,764 (GRCm38) G3C possibly damaging Het
1110032A03Rik C A 9: 50,768,219 (GRCm38) probably benign Het
1520401A03Rik G C 17: 23,715,763 (GRCm38) A96G possibly damaging Het
1600015I10Rik A C 6: 48,932,468 (GRCm38) K549T probably benign Het
1700001C19Rik T G 17: 47,413,734 (GRCm38) N154T probably benign Het
1700003E16Rik A C 6: 83,161,115 (GRCm38) K74N probably damaging Het
1700013G24Rik C A 4: 137,454,992 (GRCm38) P153T probably damaging Het
1700016C15Rik A T 1: 177,741,017 (GRCm38) R27W possibly damaging Het
1700017N19Rik T G 10: 100,612,429 (GRCm38) M274R probably damaging Het
1700019N19Rik T G 19: 58,787,706 (GRCm38) K105T probably damaging Het
1700030J22Rik G T 8: 116,973,597 (GRCm38) T22K probably benign Het
1700123K08Rik G T 5: 138,563,553 (GRCm38) Q124K probably damaging Het
1810046K07Rik G T 9: 51,291,564 (GRCm38) P97T probably benign Het
2310035C23Rik G T 1: 105,719,615 (GRCm38) R734M probably benign Het
2310050C09Rik T C 3: 92,869,274 (GRCm38) Q34R probably benign Het
2610021A01Rik G C 7: 41,625,342 (GRCm38) L156F probably benign Het
2610028H24Rik C A 10: 76,452,863 (GRCm38) P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 (GRCm38) E10G probably damaging Het
2700081O15Rik C G 19: 7,422,747 (GRCm38) P193A unknown Het
2900011O08Rik C A 16: 14,049,481 (GRCm38) R68S probably damaging Het
3100002H09Rik T A 4: 124,610,705 (GRCm38) D18V unknown Het
3110018I06Rik C G 12: 107,488,855 (GRCm38) R67G unknown Het
3110082J24Rik G C 5: 30,105,067 (GRCm38) A98G unknown Het
4833420G17Rik C A 13: 119,477,808 (GRCm38) T484K not run Het
4833423E24Rik C T 2: 85,518,462 (GRCm38) R102Q probably benign Het
4921501E09Rik C A 17: 33,065,657 (GRCm38) D724Y possibly damaging Het
4921507P07Rik G T 6: 50,574,021 (GRCm38) L483I possibly damaging Het
4921511C20Rik A G X: 127,394,842 (GRCm38) K135E probably damaging Het
4930415L06Rik A C X: 89,930,241 (GRCm38) N783K unknown Het
4930447C04Rik G C 12: 72,916,726 (GRCm38) F18L probably benign Het
4930503B20Rik C T 3: 146,650,956 (GRCm38) D66N probably damaging Het
4930516K23Rik A T 7: 104,059,288 (GRCm38) F105I probably damaging Het
4930562C15Rik G A 16: 4,866,248 (GRCm38) V236M possibly damaging Het
4930595M18Rik C T X: 81,420,272 (GRCm38) G610R probably damaging Het
4932415D10Rik A G 10: 82,293,228 (GRCm38) I1316T probably benign Het
4932415D10Rik A C 10: 82,289,896 (GRCm38) L2427V possibly damaging Het
4932415D10Rik G T 10: 82,282,537 (GRCm38) L4880I unknown Het
4933402D24Rik T A 1: 63,756,335 (GRCm38) K90* probably null Het
4933402J07Rik G T 8: 87,568,574 (GRCm38) M113I probably benign Het
4933403O08Rik C A X: 112,241,313 (GRCm38) R213S probably benign Het
4933425L06Rik G A 13: 105,111,144 (GRCm38) G324D probably damaging Het
4933427D14Rik C T 11: 72,159,000 (GRCm38) V852I probably benign Het
4933427I04Rik T C 4: 123,860,875 (GRCm38) L194P probably damaging Het
5330417C22Rik C A 3: 108,471,435 (GRCm38) W349L probably damaging Het
5330417C22Rik C A 3: 108,471,978 (GRCm38) G345C probably damaging Het
5730559C18Rik C A 1: 136,219,783 (GRCm38) R399L possibly damaging Het
6430571L13Rik G T 9: 107,342,527 (GRCm38) G60C probably damaging Het
9430015G10Rik G C 4: 156,122,011 (GRCm38) G76A probably benign Het
9530053A07Rik G A 7: 28,154,762 (GRCm38) G1717D probably benign Het
9530053A07Rik G A 7: 28,142,386 (GRCm38) S582N probably benign Het
A1cf A C 19: 31,918,017 (GRCm38) I167L probably benign Het
A2ml1 A G 6: 128,571,977 (GRCm38) F281L probably benign Het
A430005L14Rik CG C 4: 153,960,665 (GRCm38) probably null Het
A730049H05Rik C A 6: 92,828,066 (GRCm38) S69* probably null Het
A830018L16Rik C G 1: 11,518,625 (GRCm38) Q89E probably damaging Het
AA986860 A C 1: 130,742,991 (GRCm38) S317R probably benign Het
Aasdh C G 5: 76,891,796 (GRCm38) probably null Het
Aass T C 6: 23,078,857 (GRCm38) T719A probably damaging Het
Aatf C T 11: 84,442,585 (GRCm38) A500T probably benign Het
Abca12 A C 1: 71,284,070 (GRCm38) Y1618D probably damaging Het
Abca13 G T 11: 9,251,376 (GRCm38) G153C possibly damaging Het
Abca13 C A 11: 9,335,182 (GRCm38) A3272E probably damaging Het
Abca13 C A 11: 9,267,461 (GRCm38) P301H probably damaging Het
Abca13 G T 11: 9,294,342 (GRCm38) W2068C probably benign Het
Abca13 G T 11: 9,335,181 (GRCm38) A3272S probably damaging Het
Abca14 G T 7: 120,246,923 (GRCm38) G599V probably damaging Het
Abca15 T G 7: 120,346,026 (GRCm38) F442V probably benign Het
Abca15 G T 7: 120,382,505 (GRCm38) G1061W probably damaging Het
Abca2 G T 2: 25,444,110 (GRCm38) V1800L probably benign Het
Abca4 G T 3: 122,103,488 (GRCm38) W605C probably damaging Het
Abca4 C A 3: 122,156,443 (GRCm38) S1805R probably damaging Het
Abca7 T C 10: 80,006,559 (GRCm38) L1109P probably damaging Het
Abca7 C T 10: 79,999,432 (GRCm38) R208* probably null Het
Abca8b A T 11: 109,961,908 (GRCm38) C761S possibly damaging Het
Abca8b G A 11: 109,974,644 (GRCm38) T329I possibly damaging Het
Abca9 G A 11: 110,135,375 (GRCm38) A953V probably benign Het
Abcb10 C A 8: 123,982,663 (GRCm38) G51C possibly damaging Het
Abcb11 C A 2: 69,291,981 (GRCm38) G386V probably damaging Het
Abcb1b A G 5: 8,827,441 (GRCm38) Y667C probably benign Het
Abcb4 C A 5: 8,959,005 (GRCm38) R1221S probably damaging Het
Abcb5 C A 12: 118,918,272 (GRCm38) G574V probably damaging Het
Abcb8 A T 5: 24,400,995 (GRCm38) D226V probably damaging Het
Abcc10 G A 17: 46,313,700 (GRCm38) H784Y probably damaging Het
Abcc10 C T 17: 46,324,262 (GRCm38) A272T probably benign Het
Abcc12 T G 8: 86,550,601 (GRCm38) K389T probably damaging Het
Abcc3 C G 11: 94,361,275 (GRCm38) Q827H probably benign Het
Abcc6 C T 7: 45,979,734 (GRCm38) D1363N probably damaging Het
Abcc6 A T 7: 45,992,306 (GRCm38) probably null Het
Abcc8 T C 7: 46,106,965 (GRCm38) S1439G possibly damaging Het
Abhd12b G A 12: 70,163,451 (GRCm38) D134N probably damaging Het
Abhd13 A C 8: 9,987,413 (GRCm38) K3N probably damaging Het
Abl1 A C 2: 31,689,827 (GRCm38) K7N probably damaging Het
Ablim2 C T 5: 35,848,858 (GRCm38) P409L possibly damaging Het
Abo C G 2: 26,848,258 (GRCm38) V45L probably benign Het
Abtb2 G T 2: 103,708,172 (GRCm38) E649* probably null Het
Acaca G C 11: 84,260,720 (GRCm38) A815P probably damaging Het
Acacb G T 5: 114,248,948 (GRCm38) R2386L probably benign Het
Acan A C 7: 79,111,354 (GRCm38) H1938P probably benign Het
Acap3 C G 4: 155,905,179 (GRCm38) N693K probably damaging Het
Acmsd G T 1: 127,745,802 (GRCm38) V76F probably damaging Het
Actc1 C A 2: 114,051,997 (GRCm38) C12F probably benign Het
Actl11 T G 9: 107,931,700 (GRCm38) V1074G probably benign Het
Actl6a A C 3: 32,726,543 (GRCm38) I411L probably benign Het
Actl9 C A 17: 33,433,101 (GRCm38) P45Q possibly damaging Het
Actr10 C A 12: 70,962,029 (GRCm38) A412E probably damaging Het
Actr1b T A 1: 36,701,208 (GRCm38) H284L probably benign Het
Actrt2 G T 4: 154,666,832 (GRCm38) N282K probably benign Het
Acvr1 C A 2: 58,479,868 (GRCm38) G43V probably benign Het
Acy3 G T 19: 3,987,107 (GRCm38) R13L probably damaging Het
Adam17 T G 12: 21,361,737 (GRCm38) Q51P possibly damaging Het
Adam21 T G 12: 81,559,743 (GRCm38) N415T probably damaging Het
Adam30 A G 3: 98,162,360 (GRCm38) Y503C possibly damaging Het
Adam32 C A 8: 24,948,750 (GRCm38) E16* probably null Het
Adam6a A G 12: 113,545,321 (GRCm38) K438R possibly damaging Het
Adam7 A T 14: 68,527,701 (GRCm38) S82R probably benign Het
Adamts10 G T 17: 33,528,788 (GRCm38) R66L probably damaging Het
Adamts10 C T 17: 33,528,787 (GRCm38) R66W probably damaging Het
Adamts12 G T 15: 11,336,383 (GRCm38) C1518F not run Het
Adamts15 G C 9: 30,910,700 (GRCm38) C480W probably damaging Het
Adamts16 C T 13: 70,761,773 (GRCm38) R887K probably benign Het
Adamts18 A T 8: 113,743,168 (GRCm38) I634N possibly damaging Het
Adamts2 G T 11: 50,792,708 (GRCm38) R939L probably damaging Het
Adamts3 C T 5: 89,775,351 (GRCm38) V199I not run Het
Adamts4 G A 1: 171,258,783 (GRCm38) A715T probably benign Het
Adamts4 C G 1: 171,258,784 (GRCm38) A715G probably benign Het
Adamtsl1 T G 4: 86,342,693 (GRCm38) M1055R probably benign Het
Adamtsl1 C T 4: 86,342,177 (GRCm38) P883L probably damaging Het
Adamtsl2 C A 2: 27,081,720 (GRCm38) Q6K probably benign Het
Adcy1 G T 11: 7,150,858 (GRCm38) R802S possibly damaging Het
Adcy1 G A 11: 7,150,857 (GRCm38) R802K probably damaging Het
Adcy1 C A 11: 7,149,536 (GRCm38) T672N probably damaging Het
Adcy1 G A 11: 7,109,098 (GRCm38) D335N probably damaging Het
Adcy5 G T 16: 35,156,321 (GRCm38) G75C unknown Het
Adcy5 G A 16: 35,291,544 (GRCm38) V924M not run Het
Adcy5 C G 16: 35,290,185 (GRCm38) F907L probably benign Het
Adcy8 T C 15: 64,725,518 (GRCm38) T895A probably benign Het
Adcy9 G T 16: 4,307,232 (GRCm38) P745Q probably damaging Het
Add2 G T 6: 86,098,590 (GRCm38) K240N probably damaging Het
Adgb G T 10: 10,378,742 (GRCm38) T1159N probably benign Het
Adgrb2 G T 4: 130,017,563 (GRCm38) C1126F probably damaging Het
Adgrb3 C T 1: 25,093,914 (GRCm38) D1364N probably benign Het
Adgre1 T G 17: 57,361,729 (GRCm38) L30R possibly damaging Het
Adgrg4 C A X: 56,914,259 (GRCm38) P601H probably benign Het
Adgrg4 G T X: 56,894,702 (GRCm38) V174L probably benign Het
Adgrg5 G C 8: 94,935,151 (GRCm38) W173C Het
Adgrv1 C A 13: 81,559,634 (GRCm38) A1218S possibly damaging Het
Adh7 G A 3: 138,223,731 (GRCm38) G87D probably benign Het
Adora2a C A 10: 75,333,328 (GRCm38) Q209K probably benign Het
Adprhl1 C G 8: 13,225,613 (GRCm38) A382P probably benign Het
Adprhl2 C G 4: 126,321,567 (GRCm38) G35A probably damaging Het
Adprhl2 C G 4: 126,321,661 (GRCm38) A4P unknown Het
Adra1a C A 14: 66,727,628 (GRCm38) L356M probably benign Het
Adra2b C A 2: 127,364,038 (GRCm38) D158E probably benign Het
Adra2c G C 5: 35,280,904 (GRCm38) R340P probably damaging Het
Adss C A 1: 177,776,493 (GRCm38) C182F probably damaging Het
Adss C A 1: 177,796,498 (GRCm38) probably benign Het
Aff3 T A 1: 38,329,872 (GRCm38) K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,478,353 (GRCm38) probably null Het
Afg3l2 C A 18: 67,431,707 (GRCm38) L232F probably benign Het
Afmid G A 11: 117,834,966 (GRCm38) D129N probably benign Het
Agap2 G C 10: 127,080,225 (GRCm38) G202R unknown Het
Agbl1 T G 7: 76,418,685 (GRCm38) L333R Het
Agbl4 T A 4: 110,660,839 (GRCm38) L109Q probably damaging Het
Agbl4 G T 4: 111,526,643 (GRCm38) G232W probably damaging Het
Ago4 C A 4: 126,520,190 (GRCm38) probably null Het
Ahnak G T 19: 9,008,856 (GRCm38) M2501I probably damaging Het
AI593442 C A 9: 52,677,945 (GRCm38) G111C probably damaging Het
AI597479 A G 1: 43,113,190 (GRCm38) H216R probably benign Het
Aipl1 G T 11: 72,030,533 (GRCm38) P179T possibly damaging Het
Ak9 G T 10: 41,423,023 (GRCm38) W1573C unknown Het
Ak9 G C 10: 41,348,251 (GRCm38) G524R Het
Akap1 G T 11: 88,837,167 (GRCm38) T663N probably benign Het
Akap13 G T 7: 75,730,552 (GRCm38) R491L probably damaging Het
Akap14 G T X: 37,163,245 (GRCm38) P279H unknown Het
Akap4 G T X: 7,078,360 (GRCm38) E831* probably null Het
Akap6 C G 12: 53,140,444 (GRCm38) T1547R possibly damaging Het
Akap8 C A 17: 32,306,549 (GRCm38) V519L probably damaging Het
Akap9 G T 5: 3,962,251 (GRCm38) G985W probably damaging Het
Akirin1 C T 4: 123,750,067 (GRCm38) G33D probably damaging Het
Akr1cl C A 1: 65,016,687 (GRCm38) G219C probably damaging Het
Alas1 G A 9: 106,238,769 (GRCm38) R349C probably benign Het
Alas1 C A 9: 106,243,367 (GRCm38) Q76H probably benign Het
Aldh1l1 G T 6: 90,583,173 (GRCm38) V601L probably benign Het
Aldh1l1 GAA GA 6: 90,557,284 (GRCm38) probably null Het
Aldh3a2 T G 11: 61,264,283 (GRCm38) K145T probably benign Het
Aldoart1 C A 4: 72,852,004 (GRCm38) R189L probably benign Het
Alg8 T G 7: 97,383,761 (GRCm38) F285V probably benign Het
Alkbh8 G C 9: 3,345,820 (GRCm38) G180A probably damaging Het
Alms1 C G 6: 85,678,418 (GRCm38) N2846K probably benign Het
Alox12b G C 11: 69,157,325 (GRCm38) V27L possibly damaging Het
Alox12b T A 11: 69,157,323 (GRCm38) I26N possibly damaging Het
Aloxe3 C A 11: 69,133,079 (GRCm38) L279M probably damaging Het
Alpi T C 1: 87,099,072 (GRCm38) N428S probably benign Het
Alpk1 T A 3: 127,673,438 (GRCm38) H1064L probably damaging Het
Alpk2 G C 18: 65,305,611 (GRCm38) L904V probably damaging Het
Alpk3 G T 7: 81,078,626 (GRCm38) L501F probably benign Het
Alpl G C 4: 137,754,010 (GRCm38) S110R probably damaging Het
Alppl2 G A 1: 87,087,666 (GRCm38) S391F probably damaging Het
Alppl2 G T 1: 87,087,704 (GRCm38) H378Q probably damaging Het
Amer3 G T 1: 34,589,013 (GRCm38) V778L probably benign Het
Ampd2 C A 3: 108,080,064 (GRCm38) G151V probably damaging Het
Amz1 G T 5: 140,744,073 (GRCm38) E121* probably null Het
Ang4 G T 14: 51,764,148 (GRCm38) C114* probably null Het
Ank3 C T 10: 69,951,010 (GRCm38) A968V possibly damaging Het
Ank3 G C 10: 69,991,215 (GRCm38) E1905Q Het
Ank3 T G 10: 69,932,474 (GRCm38) L941R possibly damaging Het
Ankar G T 1: 72,689,961 (GRCm38) L342I possibly damaging Het
Ankib1 G A 5: 3,692,763 (GRCm38) S1084L probably benign Het
Ankk1 T G 9: 49,421,911 (GRCm38) K91T probably damaging Het
Ankk1 T A 9: 49,416,643 (GRCm38) Q412L probably benign Het
Ankle2 G C 5: 110,234,499 (GRCm38) E114Q possibly damaging Het
Ankmy1 C T 1: 92,878,437 (GRCm38) G780E probably damaging Het
Ankmy2 T G 12: 36,186,859 (GRCm38) M222R probably damaging Het
Ankrd11 C T 8: 122,895,803 (GRCm38) V437M possibly damaging Het
Ankrd12 C A 17: 65,970,338 (GRCm38) probably null Het
Ankrd36 T A 11: 5,615,538 (GRCm38) F457L probably benign Het
Ankrd39 C G 1: 36,542,005 (GRCm38) A88P probably damaging Het
Ankrd45 C T 1: 161,163,283 (GRCm38) A202V possibly damaging Het
Ankrd49 C G 9: 14,781,428 (GRCm38) A147P probably damaging Het
Ankrd6 C T 4: 32,806,229 (GRCm38) E675K possibly damaging Het
Ankrd6 G C 4: 32,824,486 (GRCm38) N142K probably damaging Het
Ankrd6 G T 4: 32,806,326 (GRCm38) S642R probably benign Het
Anks3 T G 16: 4,950,714 (GRCm38) Q255P probably benign Het
Ano2 G T 6: 125,710,707 (GRCm38) Q58H probably benign Het
Ano2 T G 6: 125,863,453 (GRCm38) Y362* probably null Het
Ano4 A T 10: 89,112,945 (GRCm38) V101E probably benign Het
Ano5 T A 7: 51,574,703 (GRCm38) V469E probably damaging Het
Ano6 C A 15: 95,913,460 (GRCm38) P147Q probably damaging Het
Ano7 C A 1: 93,394,465 (GRCm38) D398E probably benign Het
Anpep G C 7: 79,827,639 (GRCm38) P727A possibly damaging Het
Anxa10 T G 8: 62,063,070 (GRCm38) probably null Het
Aoc2 G T 11: 101,326,420 (GRCm38) G443V probably benign Het
Aox4 G C 1: 58,246,351 (GRCm38) E665Q possibly damaging Het
Ap1m2 G A 9: 21,298,256 (GRCm38) R375* probably null Het
Ap1s1 G A 5: 137,037,470 (GRCm38) T126I probably damaging Het
Apba1 C A 19: 23,944,115 (GRCm38) S767R probably damaging Het
Apex2 C A X: 150,572,099 (GRCm38) G414V probably benign Het
Apoa4 C A 9: 46,242,589 (GRCm38) R163S possibly damaging Het
Apob G T 12: 8,004,978 (GRCm38) V1326L probably benign Het
Apob G C 12: 7,998,011 (GRCm38) G997R probably damaging Het
Apobr A T 7: 126,587,264 (GRCm38) E649V probably damaging Het
Apoh G T 11: 108,343,459 (GRCm38) probably benign Het
Apol11b A C 15: 77,638,007 (GRCm38) I30R probably benign Het
App A G 16: 85,024,917 (GRCm38) L390P probably damaging Het
Aqr C A 2: 114,108,122 (GRCm38) R1283M probably damaging Het
Aqr C G 2: 114,109,991 (GRCm38) A1225P probably benign Het
Ar G T X: 98,151,009 (GRCm38) G410W probably damaging Het
Arfgef2 G A 2: 166,894,712 (GRCm38) R1768Q probably damaging Het
Arfgef3 T A 10: 18,591,437 (GRCm38) K2005M probably damaging Het
Arfgef3 C A 10: 18,608,358 (GRCm38) C1383F probably damaging Het
Arfgef3 T A 10: 18,634,852 (GRCm38) H787L probably benign Het
Arhgap1 C T 2: 91,650,214 (GRCm38) A27V possibly damaging Het
Arhgap10 T G 8: 77,432,805 (GRCm38) S107R probably damaging Het
Arhgap10 C A 8: 77,277,175 (GRCm38) G667V probably benign Het
Arhgap11a C G 2: 113,833,758 (GRCm38) A727P probably benign Het
Arhgap22 A T 14: 33,362,522 (GRCm38) R253W probably damaging Het
Arhgap24 G T 5: 102,875,759 (GRCm38) V220F probably damaging Het
Arhgap24 G A 5: 102,880,807 (GRCm38) A283T probably benign Het
Arhgap25 G T 6: 87,476,186 (GRCm38) L211M probably damaging Het
Arhgap31 G C 16: 38,623,893 (GRCm38) Q201E possibly damaging Het
Arhgap33 C A 7: 30,522,717 (GRCm38) R1263S probably benign Het
Arhgap40 C A 2: 158,534,885 (GRCm38) P317T probably benign Het
Arhgap45 C A 10: 80,025,536 (GRCm38) T511N probably damaging Het
Arhgap45 C G 10: 80,029,052 (GRCm38) R950G probably damaging Het
Arhgap5 G A 12: 52,518,463 (GRCm38) R739H possibly damaging Het
Arhgap9 C A 10: 127,327,689 (GRCm38) T452N probably damaging Het
Arhgef11 C T 3: 87,735,462 (GRCm38) P1434L not run Het
Arhgef12 T A 9: 42,971,072 (GRCm38) Q1492L probably benign Het
Arhgef18 G T 8: 3,453,224 (GRCm38) V877L probably damaging Het
Arhgef4 G T 1: 34,723,729 (GRCm38) D689Y unknown Het
Arhgef4 G T 1: 34,804,926 (GRCm38) G1358C probably damaging Het
Arid1a C A 4: 133,720,550 (GRCm38) Q217H probably null Het
Arid4a A C 12: 71,039,920 (GRCm38) K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,319,355 (GRCm38) probably null Het
Arl10 C G 13: 54,580,724 (GRCm38) L188V probably benign Het
Arl14 C A 3: 69,222,648 (GRCm38) P43T probably damaging Het
Arl4c T C 1: 88,701,450 (GRCm38) Q72R possibly damaging Het
Arl6ip5 C A 6: 97,229,555 (GRCm38) N65K probably benign Het
Armc2 C A 10: 41,927,044 (GRCm38) Q544H probably damaging Het
Armc2 C G 10: 41,963,656 (GRCm38) G438R probably damaging Het
Armc4 C A 18: 7,216,973 (GRCm38) E680* probably null Het
Armc4 G C 18: 7,129,487 (GRCm38) A897G probably damaging Het
Armcx4 G A X: 134,694,091 (GRCm38) E1583K possibly damaging Het
Armcx4 C A X: 134,693,042 (GRCm38) A1233D not run Het
Arnt2 G A 7: 84,263,196 (GRCm38) P579S probably benign Het
Arpc3 C T 5: 122,404,230 (GRCm38) P120L probably damaging Het
Arrdc5 C G 17: 56,300,189 (GRCm38) A19P probably damaging Het
Arsi C A 18: 60,916,780 (GRCm38) P245H probably damaging Het
Art2b T A 7: 101,578,882 (GRCm38) Q283L not run Het
Arx G T X: 93,289,184 (GRCm38) A280S probably damaging Het
Asap3 TGGG TGG 4: 136,240,201 (GRCm38) probably benign Het
Asap3 C A 4: 136,241,503 (GRCm38) P753Q probably damaging Het
Asb15 G T 6: 24,566,331 (GRCm38) D428Y probably damaging Het
Ascc1 G T 10: 60,007,793 (GRCm38) R59L possibly damaging Het
Ascc2 G T 11: 4,646,653 (GRCm38) R58L probably benign Het
Ascc2 G C 11: 4,672,487 (GRCm38) G518R probably benign Het
Ash1l G A 3: 89,043,217 (GRCm38) R2139Q probably damaging Het
Asic2 T G 11: 81,967,670 (GRCm38) K172T probably benign Het
Asic2 A T 11: 80,889,832 (GRCm38) L417Q possibly damaging Het
Aspg C G 12: 112,113,081 (GRCm38) Q98E possibly damaging Het
Asphd1 A T 7: 126,948,636 (GRCm38) L165Q probably damaging Het
Astl C T 2: 127,356,545 (GRCm38) A360V probably benign Het
Asxl3 G T 18: 22,522,220 (GRCm38) G1096C probably damaging Het
Atad5 A C 11: 80,094,896 (GRCm38) S270R probably damaging Het
Ate1 C A 7: 130,504,714 (GRCm38) D306Y probably benign Het
Atg7 G T 6: 114,673,050 (GRCm38) V63F possibly damaging Het
Atg9a A T 1: 75,186,559 (GRCm38) L299Q probably damaging Het
Atl1 C G 12: 69,937,075 (GRCm38) L192V possibly damaging Het
Atl3 T G 19: 7,510,037 (GRCm38) F106V probably damaging Het
Atp10a G T 7: 58,788,447 (GRCm38) probably null Het
Atp12a G C 14: 56,372,706 (GRCm38) G221A probably damaging Het
Atp13a2 A T 4: 141,005,117 (GRCm38) S898C probably benign Het
Atp13a4 C A 16: 29,422,587 (GRCm38) Q754H probably null Het
Atp1a2 A T 1: 172,279,754 (GRCm38) I733N possibly damaging Het
Atp1a3 C A 7: 24,998,688 (GRCm38) A198S probably benign Het
Atp1a4 C G 1: 172,231,954 (GRCm38) R857P probably benign Het
Atp1b2 G T 11: 69,601,315 (GRCm38) A269D possibly damaging Het
Atp2a3 C A 11: 72,989,540 (GRCm38) H1016N probably benign Het
Atp2a3 G T 11: 72,980,622 (GRCm38) G650C possibly damaging Het
Atp2b3 G A X: 73,535,424 (GRCm38) E343K possibly damaging Het
Atp6v0a4 G A 6: 38,049,036 (GRCm38) S819F possibly damaging Het
Atp6v1e1 T A 6: 120,822,449 (GRCm38) probably benign Het
Atp6v1e1 T C 6: 120,804,119 (GRCm38) E97G probably benign Het
Atp6v1h G C 1: 5,095,628 (GRCm38) R107P probably damaging Het
Atp7b G T 8: 22,028,714 (GRCm38) P36H probably benign Het
Atp8b4 C A 2: 126,414,429 (GRCm38) E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 (GRCm38) R650W probably benign Het
Atp9b T A 18: 80,765,865 (GRCm38) Q613L Het
Atpaf2 C A 11: 60,416,775 (GRCm38) A46S probably benign Het
Atrn G T 2: 130,946,193 (GRCm38) G305V probably benign Het
Atxn2 A T 5: 121,777,990 (GRCm38) S420C probably damaging Het
Atxn7l1 G T 12: 33,367,645 (GRCm38) A602S probably benign Het
Atxn7l1 G C 12: 33,368,017 (GRCm38) A726P probably benign Het
Atxn7l2 A C 3: 108,205,666 (GRCm38) S309A probably benign Het
AU022751 T G X: 6,082,321 (GRCm38) E213D unknown Het
AU022751 G T X: 6,082,314 (GRCm38) P216T unknown Het
Aup1 G T 6: 83,056,633 (GRCm38) R306L probably benign Het
Aurkaip1 G T 4: 155,832,763 (GRCm38) R156L probably damaging Het
Aurkc TGG TG 7: 6,995,514 (GRCm38) probably null Het
Avl9 G C 6: 56,736,764 (GRCm38) D336H probably damaging Het
Avpr1b C A 1: 131,609,573 (GRCm38) S365Y probably damaging Het
Axdnd1 A T 1: 156,349,063 (GRCm38) L714Q probably damaging Het
Azin2 C A 4: 128,934,659 (GRCm38) D347Y possibly damaging Het
B3gnt5 A T 16: 19,769,810 (GRCm38) R260* probably null Het
B3gnt6 C G 7: 98,193,889 (GRCm38) R288P probably benign Het
Bag6 G T 17: 35,139,310 (GRCm38) probably null Het
Bahcc1 G T 11: 120,276,609 (GRCm38) G1279W possibly damaging Het
Bahcc1 G T 11: 120,284,394 (GRCm38) V1765L probably benign Het
Bahd1 G A 2: 118,922,403 (GRCm38) R717H probably damaging Het
Baiap3 C A 17: 25,244,768 (GRCm38) R934S probably benign Het
Bbs10 G C 10: 111,298,908 (GRCm38) probably null Het
Bbs10 G T 10: 111,301,124 (GRCm38) R699S probably damaging Het
Bbs10 G T 10: 111,299,657 (GRCm38) L210F probably benign Het
BC005561 T C 5: 104,520,192 (GRCm38) V860A possibly damaging Het
BC024063 G T 10: 82,109,050 (GRCm38) G168V probably damaging Het
BC080695 T C 4: 143,572,252 (GRCm38) I255T probably benign Het
Bcan C T 3: 87,995,650 (GRCm38) D274N probably benign Het
Bcan C A 3: 87,990,750 (GRCm38) G635W probably damaging Het
Bcan T G 3: 87,990,755 (GRCm38) N633T probably damaging Het
Bckdha T C 7: 25,631,143 (GRCm38) S343G probably damaging Het
Bcl10 T G 3: 145,930,513 (GRCm38) I55M probably damaging Het
Bcl11a G T 11: 24,165,010 (GRCm38) K784N probably damaging Het
Bcl6 C G 16: 23,969,958 (GRCm38) Q553H probably damaging Het
Bcorl1 T G X: 48,367,842 (GRCm38) L84R unknown Het
Bcorl1 GAAAA GAAA X: 48,375,090 (GRCm38) probably null Het
Bend6 C A 1: 33,864,523 (GRCm38) Q173H probably null Het
Best3 T G 10: 117,024,622 (GRCm38) L596V probably benign Het
Bmp4 A C 14: 46,384,628 (GRCm38) V153G possibly damaging Het
Bmpr1b C A 3: 141,842,954 (GRCm38) E438D probably benign Het
Bmpr2 G A 1: 59,847,167 (GRCm38) R321Q not run Het
Bnc1 T G 7: 81,974,542 (GRCm38) E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,694,045 (GRCm38) probably benign Het
Borcs5 A T 6: 134,710,123 (GRCm38) Q147L probably benign Het
Borcs8 C G 8: 70,141,971 (GRCm38) H49D probably damaging Het
Bpi G T 2: 158,272,102 (GRCm38) G307W possibly damaging Het
Bpifa3 A T 2: 154,130,471 (GRCm38) probably benign Het
Bpifb4 A C 2: 153,942,832 (GRCm38) E153D probably benign Het
Bpifc C A 10: 85,965,228 (GRCm38) A419S probably benign Het
Bptf C A 11: 107,058,684 (GRCm38) G2270W probably damaging Het
Braf C A 6: 39,643,182 (GRCm38) W487C probably damaging Het
Brap A G 5: 121,675,377 (GRCm38) T298A possibly damaging Het
Brd2 C A 17: 34,113,688 (GRCm38) G573W possibly damaging Het
Brd9 G C 13: 73,944,751 (GRCm38) A287P probably damaging Het
Brdt G T 5: 107,359,898 (GRCm38) S664I possibly damaging Het
Brinp1 C A 4: 68,798,751 (GRCm38) E287* probably null Het
Brinp2 C G 1: 158,247,039 (GRCm38) G504A probably damaging Het
Brinp2 A T 1: 158,247,171 (GRCm38) L460* probably null Het
Brinp3 C T 1: 146,902,076 (GRCm38) P754S probably damaging Het
Btg4 G A 9: 51,119,175 (GRCm38) D192N probably benign Het
Btla G T 16: 45,239,358 (GRCm38) V142L probably damaging Het
Bub1 C A 2: 127,829,565 (GRCm38) W33L probably damaging Het
C130026I21Rik G T 1: 85,113,523 (GRCm38) D71E probably damaging Het
C1qb C G 4: 136,882,145 (GRCm38) G55R probably damaging Het
C1ql2 C G 1: 120,341,624 (GRCm38) H169Q possibly damaging Het
C2cd4a C G 9: 67,831,413 (GRCm38) G116A probably damaging Het
C2cd4c G A 10: 79,612,465 (GRCm38) P283S possibly damaging Het
C4b A T 17: 34,731,147 (GRCm38) L1383Q probably damaging Het
C530008M17Rik C A 5: 76,857,246 (GRCm38) P485T unknown Het
C77080 G T 4: 129,223,704 (GRCm38) S434Y probably damaging Het
C87977 A G 4: 144,207,461 (GRCm38) F359L probably benign Het
C8a C A 4: 104,862,686 (GRCm38) G76C probably damaging Het
Cabp7 T G 11: 4,746,669 (GRCm38) N20T probably benign Het
Cacna1a G T 8: 84,415,676 (GRCm38) R11L unknown Het
Cacna1b A T 2: 24,626,884 (GRCm38) L54* probably null Het
Cacna1c T G 6: 118,697,737 (GRCm38) K547T Het
Cacna1d C T 14: 30,111,116 (GRCm38) A923T probably benign Het
Cacna1d A G 14: 30,179,188 (GRCm38) F325S probably benign Het
Cacna1e T A 1: 154,635,850 (GRCm38) T176S probably damaging Het
Cacna1g A T 11: 94,438,111 (GRCm38) L1020M probably benign Het
Cacna1h G C 17: 25,391,250 (GRCm38) P761A probably benign Het
Cacna1s G T 1: 136,107,084 (GRCm38) E1322* probably null Het
Cacna2d2 G C 9: 107,517,293 (GRCm38) A585P probably damaging Het
Cacna2d2 C A 9: 107,526,102 (GRCm38) L921M probably benign Het
Cacna2d4 G T 6: 119,312,450 (GRCm38) R815M probably benign Het
Cacnb1 C A 11: 98,022,555 (GRCm38) probably benign Het
Cacnb4 C A 2: 52,675,812 (GRCm38) probably null Het
Cacng5 C G 11: 107,884,346 (GRCm38) G66R probably null Het
Cacng5 G T 11: 107,877,546 (GRCm38) P212T probably damaging Het
Cadps2 A C 6: 23,321,801 (GRCm38) L1031V probably benign Het
Calcoco2 C A 11: 96,103,520 (GRCm38) W69L probably damaging Het
Calr C A 8: 84,844,064 (GRCm38) probably null Het
Camk1g C A 1: 193,362,100 (GRCm38) G2V probably damaging Het
Camk2b G C 11: 5,977,940 (GRCm38) S447C possibly damaging Het
Camk2g C A 14: 20,764,912 (GRCm38) W215C probably damaging Het
Camsap1 C T 2: 25,936,639 (GRCm38) A1260T probably damaging Het
Camsap1 G C 2: 25,940,881 (GRCm38) P461A probably benign Het
Camta1 G T 4: 151,144,385 (GRCm38) H663Q probably benign Het
Cand1 A C 10: 119,239,194 (GRCm38) I16S probably benign Het
Capg G T 6: 72,555,476 (GRCm38) probably null Het
Capn1 C G 19: 6,014,278 (GRCm38) V64L probably benign Het
Capn13 G T 17: 73,341,110 (GRCm38) S298R probably benign Het
Capn6 C G X: 143,810,907 (GRCm38) G79R probably damaging Het
Car5b G T X: 164,000,310 (GRCm38) A90D probably benign Het
Car7 G T 8: 104,548,959 (GRCm38) C180F possibly damaging Het
Card9 T A 2: 26,357,796 (GRCm38) E181V probably damaging Het
Carnmt1 G C 19: 18,704,090 (GRCm38) C391S probably benign Het
Carnmt1 C G 19: 18,679,213 (GRCm38) A170G possibly damaging Het
Cartpt C A 13: 99,899,983 (GRCm38) E86* probably null Het
Casc1 C A 6: 145,205,293 (GRCm38) E18* probably null Het
Cask C T X: 13,533,489 (GRCm38) V785I probably benign Het
Caskin1 C A 17: 24,505,038 (GRCm38) N933K probably damaging Het
Caskin2 C A 11: 115,803,620 (GRCm38) G385V probably benign Het
Caskin2 A G 11: 115,802,096 (GRCm38) L621P probably damaging Het
Caskin2 C G 11: 115,802,103 (GRCm38) A619P probably damaging Het
Casq1 G T 1: 172,215,914 (GRCm38) S191* probably null Het
Casz1 T C 4: 148,944,359 (GRCm38) L1087P probably benign Het
Catip A C 1: 74,367,789 (GRCm38) H240P probably damaging Het
Catsper2 C A 2: 121,407,385 (GRCm38) W171C probably damaging Het
Cav2 G T 6: 17,281,433 (GRCm38) V25F probably benign Het
Cavin2 G T 1: 51,301,156 (GRCm38) G331C probably damaging Het
Cbfa2t3 G C 8: 122,698,895 (GRCm38) probably benign Het
Cbx8 G A 11: 119,039,119 (GRCm38) A216V possibly damaging Het
Ccdc113 G T 8: 95,538,219 (GRCm38) R119L probably damaging Het
Ccdc121 C T 1: 181,510,875 (GRCm38) E171K possibly damaging Het
Ccdc14 G T 16: 34,706,498 (GRCm38) G306C probably damaging Het
Ccdc144b T C 3: 36,018,888 (GRCm38) Q415R possibly damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,420,813 (GRCm38) probably null Het
Ccdc151 C A 9: 21,990,424 (GRCm38) V547F possibly damaging Het
Ccdc155 C G 7: 45,184,254 (GRCm38) probably null Het
Ccdc158 T C 5: 92,608,491 (GRCm38) M1086V probably damaging Het
Ccdc162 C T 10: 41,605,108 (GRCm38) D1318N possibly damaging Het
Ccdc162 T G 10: 41,690,092 (GRCm38) K85T probably benign Het
Ccdc162 G A 10: 41,654,997 (GRCm38) T571I possibly damaging Het
Ccdc162 C T 10: 41,553,131 (GRCm38) R645H probably benign Het
Ccdc171 G A 4: 83,795,230 (GRCm38) A1169T probably damaging Het
Ccdc175 C A 12: 72,112,308 (GRCm38) R619L possibly damaging Het
Ccdc180 A C 4: 45,916,406 (GRCm38) K869T probably damaging Het
Ccdc180 A C 4: 45,920,910 (GRCm38) K952T probably damaging Het
Ccdc187 G T 2: 26,281,507 (GRCm38) Q320K probably benign Het
Ccdc28b C A 4: 129,621,104 (GRCm38) G71C probably damaging Het
Ccdc33 G A 9: 58,117,416 (GRCm38) P176S probably benign Het
Ccdc40 G A 11: 119,252,008 (GRCm38) R864H probably damaging Het
Ccdc51 G T 9: 109,092,148 (GRCm38) E368* probably null Het
Ccdc51 G C 9: 109,092,226 (GRCm38) A394P probably damaging Het
Ccdc57 C G 11: 120,860,488 (GRCm38) A919P possibly damaging Het
Ccdc57 C A 11: 120,861,138 (GRCm38) Q872H probably null Het
Ccdc7a G T 8: 129,026,663 (GRCm38) R196S probably benign Het
Ccdc80 G A 16: 45,096,207 (GRCm38) S442N probably benign Het
Ccdc80 G T 16: 45,095,786 (GRCm38) G302* probably null Het
Ccdc80 T C 16: 45,116,344 (GRCm38) F711L probably damaging Het
Ccdc87 G A 19: 4,841,923 (GRCm38) W814* probably null Het
Ccdc88b C A 19: 6,849,740 (GRCm38) A1020S possibly damaging Het
Ccdc88c T C 12: 100,945,770 (GRCm38) K602E possibly damaging Het
Ccdc94 T C 17: 55,960,732 (GRCm38) F15S probably damaging Het
Ccdc96 C G 5: 36,485,594 (GRCm38) R315G probably benign Het
Ccin A T 4: 43,985,018 (GRCm38) Q475L probably damaging Het
Ccnb1ip1 C A 14: 50,792,104 (GRCm38) R167L probably benign Het
Ccnb3 T C X: 7,009,375 (GRCm38) T322A possibly damaging Het
Ccr10 CG C 11: 101,174,340 (GRCm38) probably null Het
Ccr10 C G 11: 101,174,323 (GRCm38) G127A probably damaging Het
Ccr7 G T 11: 99,144,980 (GRCm38) T372N probably damaging Het
Cct6b C A 11: 82,764,065 (GRCm38) probably benign Het
Cct6b C T 11: 82,723,939 (GRCm38) V408I probably damaging Het
Cd163l1 A T 7: 140,224,857 (GRCm38) H591L probably benign Het
Cd164 G T 10: 41,519,565 (GRCm38) A11S probably damaging Het
Cd177 G T 7: 24,746,171 (GRCm38) Q616K probably benign Het
Cd180 C T 13: 102,705,766 (GRCm38) P440L probably damaging Het
Cd200r1 A T 16: 44,792,759 (GRCm38) I243F probably damaging Het
Cd209e C T 8: 3,849,196 (GRCm38) G172E probably benign Het
Cd22 G T 7: 30,869,530 (GRCm38) P693H probably damaging Het
Cd22 T G 7: 30,867,963 (GRCm38) K732T probably benign Het
Cd3d A G 9: 44,985,628 (GRCm38) D100G probably damaging Het
Cd59a C A 2: 104,104,198 (GRCm38) Q4K probably benign Het
Cd69 G T 6: 129,268,342 (GRCm38) C173* probably null Het
Cdc123 T G 2: 5,804,985 (GRCm38) Q205P probably damaging Het
Cdc14b C G 13: 64,274,669 (GRCm38) V28L possibly damaging Het
Cdc42bpa A G 1: 180,065,093 (GRCm38) E274G probably damaging Het
Cdc42ep2 A G 19: 5,918,492 (GRCm38) F62L probably benign Het
Cdc42ep5 A T 7: 4,151,726 (GRCm38) L21H probably damaging Het
Cdh15 G C 8: 122,864,259 (GRCm38) D416H probably damaging Het
Cdh16 G C 8: 104,615,185 (GRCm38) P783A probably damaging Het
Cdh19 C G 1: 110,932,214 (GRCm38) G179A probably damaging Het
Cdh19 A T 1: 110,895,387 (GRCm38) N522K probably damaging Het
Cdh19 T G 1: 110,893,306 (GRCm38) Q567H probably benign Het
Cdh22 G T 2: 165,116,184 (GRCm38) P621H probably damaging Het
Cdh23 T A 10: 60,310,770 (GRCm38) N2877Y probably damaging Het
Cdh23 T C 10: 60,428,321 (GRCm38) N683D probably benign Het
Cdh7 G T 1: 110,108,736 (GRCm38) G549C probably damaging Het
Cdh8 C A 8: 99,190,205 (GRCm38) R426M probably null Het
Cdh8 G A 8: 99,171,323 (GRCm38) P453S probably benign Het
Cdhr3 G T 12: 33,060,322 (GRCm38) P321H probably damaging Het
Cdhr3 C A 12: 33,080,324 (GRCm38) G171W probably benign Het
Cdk12 G T 11: 98,203,941 (GRCm38) G192* probably null Het
Cdk14 G T 5: 5,135,322 (GRCm38) Y212* probably null Het
Cdk5r2 C G 1: 74,855,350 (GRCm38) P85A probably damaging Het
Cdk5rap2 C T 4: 70,266,743 (GRCm38) G1157R probably damaging Het
Cdk6 T A 5: 3,390,694 (GRCm38) C83S possibly damaging Het
Cdsn T A 17: 35,556,071 (GRCm38) L499Q probably damaging Het
Cdsn T G 17: 35,555,825 (GRCm38) V417G possibly damaging Het
Cdyl C T 13: 35,815,966 (GRCm38) R77W probably damaging Het
Ceacam15 G T 7: 16,675,583 (GRCm38) P9H possibly damaging Het
Cela2a G T 4: 141,821,391 (GRCm38) P145T probably damaging Het
Celsr1 A C 15: 85,963,100 (GRCm38) F1479V probably damaging Het
Celsr2 G T 3: 108,412,341 (GRCm38) H1052N probably benign Het
Celsr2 C A 3: 108,393,131 (GRCm38) R2871L probably benign Het
Cenpf G A 1: 189,659,472 (GRCm38) T704I probably damaging Het
Cenpv A C 11: 62,527,525 (GRCm38) F201V probably damaging Het
Cep112 G A 11: 108,425,310 (GRCm38) G36D probably damaging Het
Cep152 C A 2: 125,583,971 (GRCm38) G825C probably benign Het
Cep170b G T 12: 112,741,012 (GRCm38) probably null Het
Cep192 A T 18: 67,881,288 (GRCm38) K2451M probably damaging Het
Cep290 AGG AG 10: 100,549,374 (GRCm38) probably benign Het
Cep295 G T 9: 15,357,697 (GRCm38) P16Q probably damaging Het
Cep295nl T C 11: 118,333,019 (GRCm38) E333G possibly damaging Het
Cep295nl T G 11: 118,333,873 (GRCm38) Q48H probably damaging Het
Cep44 C G 8: 56,544,128 (GRCm38) G125A possibly damaging Het
Cep97 C A 16: 55,927,735 (GRCm38) G111C probably damaging Het
Cerkl C A 2: 79,368,765 (GRCm38) Q160H probably benign Het
Cers1 C G 8: 70,318,318 (GRCm38) P126R probably benign Het
Ces1a C A 8: 93,036,085 (GRCm38) R186L probably benign Het
Ces1g G T 8: 93,325,811 (GRCm38) H283Q probably benign Het
Ces2a C A 8: 104,734,006 (GRCm38) probably benign Het
Ces2a A T 8: 104,734,850 (GRCm38) E77V probably damaging Het
Ces3a A C 8: 105,053,602 (GRCm38) K327T possibly damaging Het
Ces4a A G 8: 105,131,977 (GRCm38) K9R probably benign Het
Cetn2 T G X: 72,914,889 (GRCm38) K127T probably damaging Het
Cfap100 G C 6: 90,406,150 (GRCm38) A347G unknown Het
Cfap20 C T 8: 95,434,525 (GRCm38) S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 (GRCm38) P251R possibly damaging Het
Cfap221 G T 1: 119,995,141 (GRCm38) L24I probably benign Het
Cfap45 G T 1: 172,545,284 (GRCm38) E515D probably benign Het
Cfap46 A C 7: 139,639,548 (GRCm38) L1334V Het
Cfap65 G A 1: 74,910,747 (GRCm38) R1200C probably damaging Het
Cfap74 C G 4: 155,426,118 (GRCm38) R387G Het
Cflar G T 1: 58,740,313 (GRCm38) probably null Het
Cflar C G 1: 58,731,229 (GRCm38) C160W Het
Cgn G T 3: 94,776,178 (GRCm38) A389D probably benign Het
Cgn A T 3: 94,774,273 (GRCm38) V504E possibly damaging Het
Cgn T C 3: 94,774,346 (GRCm38) R480G probably damaging Het
Chd1 G T 17: 15,768,733 (GRCm38) G1583C probably damaging Het
Chd1 G T 17: 15,766,347 (GRCm38) V1482L probably damaging Het
Chd4 G T 6: 125,100,860 (GRCm38) R95L possibly damaging Het
Chd4 G T 6: 125,101,598 (GRCm38) A228S probably benign Het
Chd5 G A 4: 152,378,479 (GRCm38) R1363K probably damaging Het
Chd7 C G 4: 8,844,313 (GRCm38) A1502G probably damaging Het
Cherp C T 8: 72,470,953 (GRCm38) G101D Het
Chfr C G 5: 110,144,895 (GRCm38) S176* probably null Het
Chil1 G T 1: 134,182,779 (GRCm38) probably null Het
Chil1 C G 1: 134,189,230 (GRCm38) R319G probably damaging Het
Chml C A 1: 175,687,762 (GRCm38) G198C possibly damaging Het
Chmp3 G C 6: 71,579,775 (GRCm38) A220P probably damaging Het
Chmp3 A C 6: 71,560,964 (GRCm38) E58D probably benign Het
Chpf C G 1: 75,475,458 (GRCm38) A613P probably benign Het
Chpf G C 1: 75,475,470 (GRCm38) L609V probably damaging Het
Chrna2 C A 14: 66,149,304 (GRCm38) L300M probably damaging Het
Chrna5 G T 9: 55,004,482 (GRCm38) G189C probably damaging Het
Chrna7 A T 7: 63,212,184 (GRCm38) L40Q probably damaging Het
Chst3 T A 10: 60,185,676 (GRCm38) R450W possibly damaging Het
Chst4 A C 8: 110,030,092 (GRCm38) F380V probably damaging Het
Chsy1 C G 7: 66,172,226 (GRCm38) S736R probably damaging Het
Cic A C 7: 25,271,019 (GRCm38) E58D possibly damaging Het
Cidea A G 18: 67,358,853 (GRCm38) K61R probably null Het
Ciita C A 16: 10,508,700 (GRCm38) P252T probably damaging Het
Cilp TGGG TGG 9: 65,280,130 (GRCm38) probably null Het
Cipc G T 12: 86,960,337 (GRCm38) G103C probably damaging Het
Cit G C 5: 115,986,603 (GRCm38) G1526R probably damaging Het
Cited4 C A 4: 120,666,814 (GRCm38) H4Q probably damaging Het
Ckap2 G A 8: 22,169,794 (GRCm38) P557L probably damaging Het
Ckap2l C A 2: 129,285,362 (GRCm38) D299Y probably damaging Het
Clca1 G T 3: 145,013,921 (GRCm38) S429R probably damaging Het
Clcn1 T C 6: 42,307,567 (GRCm38) V613A probably damaging Het
Cldn11 T A 3: 31,150,306 (GRCm38) W53R probably damaging Het
Cldn18 T A 9: 99,698,847 (GRCm38) K116M possibly damaging Het
Cldn23 A T 8: 35,826,277 (GRCm38) L19Q probably damaging Het
Cldn34b1 T G X: 154,887,708 (GRCm38) K5T probably benign Het
Clec4d T G 6: 123,274,686 (GRCm38) F176V probably benign Het
Clic1 G T 17: 35,052,459 (GRCm38) G22W probably damaging Het
Clic6 G A 16: 92,498,895 (GRCm38) D148N probably benign Het
Clip3 A C 7: 30,298,838 (GRCm38) E236D probably benign Het
Clk1 C A 1: 58,417,372 (GRCm38) R186L probably benign Het
Clstn3 C T 6: 124,459,200 (GRCm38) V234M probably damaging Het
Cltc A G 11: 86,702,632 (GRCm38) V1525A probably benign Het
Cmklr1 T A 5: 113,613,891 (GRCm38) S350C probably damaging Het
Cmya5 C G 13: 93,096,790 (GRCm38) D597H unknown Het
Cmya5 C G 13: 93,063,579 (GRCm38) A3414P probably benign Het
Cnksr1 A T 4: 134,232,135 (GRCm38) L396Q probably damaging Het
Cnksr3 C T 10: 7,134,544 (GRCm38) R308Q probably damaging Het
Cnnm4 G T 1: 36,505,751 (GRCm38) R697L possibly damaging Het
Cnot1 C G 8: 95,748,277 (GRCm38) Q1103H possibly damaging Het
Cnot8 C G 11: 58,113,090 (GRCm38) A117G probably benign Het
Cnppd1 C A 1: 75,140,951 (GRCm38) G42V probably damaging Het
Cntn2 C A 1: 132,527,788 (GRCm38) R237L probably damaging Het
Cntn3 T G 6: 102,437,931 (GRCm38) probably null Het
Cntn4 T G 6: 106,523,563 (GRCm38) F334V probably benign Het
Cntn4 T G 6: 106,509,464 (GRCm38) N284K probably benign Het
Cntnap1 C A 11: 101,182,898 (GRCm38) T625K probably damaging Het
Cntnap2 A C 6: 47,271,148 (GRCm38) K1163Q probably benign Het
Cntnap3 T G 13: 64,792,388 (GRCm38) N332H probably damaging Het
Cntnap3 AC A 13: 64,740,872 (GRCm38) probably null Het
Cntnap4 A T 8: 112,858,189 (GRCm38) K1086M possibly damaging Het
Cntnap5a T A 1: 116,428,516 (GRCm38) V759E probably damaging Het
Cntnap5b C A 1: 99,967,270 (GRCm38) T89K probably damaging Het
Cntnap5b C G 1: 100,446,840 (GRCm38) Q734E probably benign Het
Cntnap5b C A 1: 100,164,228 (GRCm38) S231R possibly damaging Het
Cobl G T 11: 12,253,433 (GRCm38) Q1090K probably benign Het
Cobl G A 11: 12,375,827 (GRCm38) A223V probably damaging Het
Cobl C A 11: 12,369,645 (GRCm38) E244D probably damaging Het
Cog1 C A 11: 113,651,982 (GRCm38) H151Q probably damaging Het
Coil C A 11: 88,981,976 (GRCm38) P388T probably damaging Het
Col10a1 C A 10: 34,395,178 (GRCm38) P382H probably damaging Het
Col11a2 G T 17: 34,056,402 (GRCm38) G420C unknown Het
Col16a1 G C 4: 130,072,878 (GRCm38) G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,649,429 (GRCm38) probably benign Het
Col18a1 C A 10: 77,112,851 (GRCm38) A276S unknown Het
Col18a1 G C 10: 77,055,709 (GRCm38) A1097G possibly damaging Het
Col1a2 A C 6: 4,532,750 (GRCm38) T792P unknown Het
Col23a1 G T 11: 51,549,708 (GRCm38) D142Y unknown Het
Col24a1 G A 3: 145,342,498 (GRCm38) G619S probably damaging Het
Col25a1 AC A 3: 130,182,795 (GRCm38) probably null Het
Col27a1 C G 4: 63,225,788 (GRCm38) S571C probably damaging Het
Col5a1 G A 2: 28,002,517 (GRCm38) R1014H unknown Het
Col5a2 C A 1: 45,383,680 (GRCm38) G1126C probably damaging Het
Col5a2 C G 1: 45,396,484 (GRCm38) G697A probably benign Het
Col5a2 C A 1: 45,376,146 (GRCm38) V1478L possibly damaging Het
Col6a4 T C 9: 106,000,797 (GRCm38) S1994G probably benign Het
Col6a4 G C 9: 106,000,870 (GRCm38) C1969W probably damaging Het
Col6a6 G C 9: 105,780,952 (GRCm38) A687G probably damaging Het
Col9a1 C A 1: 24,214,588 (GRCm38) P464H probably damaging Het
Col9a2 C G 4: 121,053,797 (GRCm38) A543G probably damaging Het
Colec11 C A 12: 28,595,284 (GRCm38) Q129H probably damaging Het
Commd10 G T 18: 46,990,566 (GRCm38) G163* probably null Het
Commd2 C A 3: 57,646,857 (GRCm38) R141L probably damaging Het
Copb2 A C 9: 98,586,146 (GRCm38) K737T probably benign Het
Coq3 C A 4: 21,899,102 (GRCm38) P145H probably damaging Het
Coq4 G T 2: 29,795,449 (GRCm38) Q158H probably null Het
Coq6 G C 12: 84,370,963 (GRCm38) A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,467,865 (GRCm38) probably null Het
Cox6a1 C T 5: 115,345,908 (GRCm38) G92S probably damaging Het
Cox6b2 C A 7: 4,752,147 (GRCm38) V43L probably benign Het
Cpeb1 C A 7: 81,359,728 (GRCm38) probably null Het
Cpeb2 G T 5: 43,234,717 (GRCm38) G419C Het
Cpne1 C A 2: 156,077,644 (GRCm38) D302Y probably damaging Het
Cpq A C 15: 33,381,391 (GRCm38) D300A probably damaging Het
Cps1 G T 1: 67,123,268 (GRCm38) G35V possibly damaging Het
Cps1 CTT CT 1: 67,148,719 (GRCm38) probably null Het
Cpsf4 A T 5: 145,167,415 (GRCm38) E20V possibly damaging Het
Cr2 G T 1: 195,154,153 (GRCm38) Q901K probably benign Het
Crb1 CG C 1: 139,237,086 (GRCm38) probably null Het
Crb2 C T 2: 37,776,371 (GRCm38) P11S probably benign Het
Crebl2 G T 6: 134,849,289 (GRCm38) E68* probably null Het
Crem T A 18: 3,267,730 (GRCm38) E258V probably damaging Het
Crispld1 C A 1: 17,728,613 (GRCm38) probably benign Het
Crispld1 G T 1: 17,752,851 (GRCm38) A381S possibly damaging Het
Crtac1 T G 19: 42,287,926 (GRCm38) E521A probably benign Het
Cry1 C A 10: 85,144,197 (GRCm38) V416L probably benign Het
Crybg2 C A 4: 134,082,660 (GRCm38) P1241H probably damaging Het
Cryz A T 3: 154,621,769 (GRCm38) T277S probably benign Het
Csmd1 T A 8: 16,037,198 (GRCm38) T1946S probably damaging Het
Csmd1 T C 8: 15,998,814 (GRCm38) D2296G probably damaging Het
Cspg5 G T 9: 110,251,050 (GRCm38) A429S probably damaging Het
Ctbp2 C A 7: 133,015,290 (GRCm38) probably benign Het
Ctf2 T A 7: 127,719,456 (GRCm38) I124F possibly damaging Het
Ctps G C 4: 120,542,743 (GRCm38) D472E probably benign Het
Ctsf C A 19: 4,856,306 (GRCm38) Q155K probably benign Het
Ctsj C T 13: 61,004,115 (GRCm38) E43K probably damaging Het
Ctsq C A 13: 61,037,123 (GRCm38) V250L probably benign Het
Cttnbp2 C A 6: 18,408,709 (GRCm38) S971I probably benign Het
Cttnbp2 C A 6: 18,501,960 (GRCm38) E60* probably null Het
Cttnbp2 G T 6: 18,420,836 (GRCm38) A892E possibly damaging Het
Cttnbp2 C A 6: 18,408,725 (GRCm38) G966C possibly damaging Het
Cubn T A 2: 13,381,825 (GRCm38) E1543V probably damaging Het
Cul9 C A 17: 46,520,585 (GRCm38) G1568* probably null Het
Cul9 C A 17: 46,520,576 (GRCm38) G1571* probably null Het
Cutal G T 2: 34,882,425 (GRCm38) R67I probably damaging Het
Cux2 G T 5: 121,885,934 (GRCm38) T92K probably benign Het
Cux2 C A 5: 121,873,813 (GRCm38) G520* probably null Het
Cxcr1 A T 1: 74,192,392 (GRCm38) L157* probably null Het
Cyb561d2 G C 9: 107,540,296 (GRCm38) C85W probably damaging Het
Cybb G A X: 9,440,001 (GRCm38) H494Y probably damaging Het
Cybb T C X: 9,438,240 (GRCm38) I564V probably damaging Het
Cyfip2 G A 11: 46,222,615 (GRCm38) S968F not run Het
Cylc1 G A X: 111,123,146 (GRCm38) V399I unknown Het
Cyp11b1 T A 15: 74,839,355 (GRCm38) K158I probably damaging Het
Cyp19a1 T A 9: 54,176,599 (GRCm38) K169* probably null Het
Cyp1a1 C A 9: 57,700,594 (GRCm38) S168R probably benign Het
Cyp26b1 T C 6: 84,577,114 (GRCm38) S174G probably benign Het
Cyp2a4 G T 7: 26,307,323 (GRCm38) G36* probably null Het
Cyp2a4 C T 7: 26,310,841 (GRCm38) P264S probably damaging Het
Cyp2a5 A C 7: 26,835,497 (GRCm38) N45T probably damaging Het
Cyp2a5 G A 7: 26,836,774 (GRCm38) R148H probably damaging Het
Cyp2c29 G A 19: 39,324,997 (GRCm38) M351I probably benign Het
Cyp2c54 G A 19: 40,046,215 (GRCm38) P337L probably damaging Het
Cyp2c55 C T 19: 39,035,513 (GRCm38) R344C probably benign Het
Cyp2j11 G T 4: 96,307,436 (GRCm38) S341Y probably damaging Het
Cyp2j11 T G 4: 96,307,303 (GRCm38) E385D probably damaging Het
Cyp2j5 G T 4: 96,629,506 (GRCm38) P490T probably damaging Het
Cyp2j6 C A 4: 96,536,068 (GRCm38) G151* probably null Het
Cyp39a1 A C 17: 43,725,577 (GRCm38) I333L probably benign Het
Cyp39a1 A C 17: 43,731,048 (GRCm38) E382A probably damaging Het
Cyp3a44 T C 5: 145,791,664 (GRCm38) K250R probably benign Het
Cyp4a10 G T 4: 115,518,326 (GRCm38) S2I probably damaging Het
Cyp4a12a G T 4: 115,329,003 (GRCm38) probably null Het
Cyp4a14 G C 4: 115,490,017 (GRCm38) A408G probably benign Het
Cyp4a30b G T 4: 115,470,959 (GRCm38) R475L possibly damaging Het
Cypt14 T C X: 39,863,555 (GRCm38) K10R possibly damaging Het
Cypt15 A C X: 39,346,384 (GRCm38) K33T possibly damaging Het
Cypt2 G T X: 105,499,799 (GRCm38) R3L probably benign Het
Cyth2 C A 7: 45,813,105 (GRCm38) R24L possibly damaging Het
Cytip C A 2: 58,134,037 (GRCm38) S257I probably damaging Het
Cytl1 G T 5: 37,735,695 (GRCm38) A50S probably benign Het
D430041D05Rik C A 2: 104,256,856 (GRCm38) A592S probably benign Het
D430041D05Rik C A 2: 104,154,935 (GRCm38) L1262F probably damaging Het
D5Ertd579e C G 5: 36,615,762 (GRCm38) E430Q probably benign Het
D930020B18Rik C A 10: 121,667,616 (GRCm38) A232D probably benign Het
Dab1 G C 4: 104,728,078 (GRCm38) V472L probably benign Het
Dab2ip G T 2: 35,708,868 (GRCm38) D191Y probably damaging Het
Dapk1 AC A 13: 60,760,804 (GRCm38) probably null Het
Dars C A 1: 128,372,207 (GRCm38) E347* probably null Het
Daw1 A C 1: 83,209,255 (GRCm38) K262T probably damaging Het
Daw1 C A 1: 83,183,300 (GRCm38) T121K probably damaging Het
Daw1 C G 1: 83,180,391 (GRCm38) L54V probably damaging Het
Dbh T A 2: 27,177,727 (GRCm38) L454Q probably damaging Het
Dcaf12l1 G A X: 44,789,897 (GRCm38) T8M probably benign Het
Dcaf8 G T 1: 172,172,929 (GRCm38) R218L probably benign Het
Dcdc2c G T 12: 28,524,707 (GRCm38) P139T probably benign Het
Dcxr GA G 11: 120,727,208 (GRCm38) probably null Het
Ddhd2 C T 8: 25,735,829 (GRCm38) M500I possibly damaging Het
Ddo C A 10: 40,647,933 (GRCm38) H306Q probably damaging Het
Ddr2 G T 1: 169,998,083 (GRCm38) T316N probably benign Het
Ddr2 T G 1: 169,998,084 (GRCm38) T316P probably benign Het
Ddr2 T C 1: 169,984,955 (GRCm38) Y656C probably damaging Het
Ddx51 G T 5: 110,654,558 (GRCm38) E176* probably null Het
Deaf1 C T 7: 141,301,474 (GRCm38) W573* probably null Het
Dedd2 C A 7: 25,203,598 (GRCm38) R312L probably damaging Het
Def8 G T 8: 123,459,966 (GRCm38) E428D possibly damaging Het
Defa21 T G 8: 21,025,723 (GRCm38) F46V probably benign Het
Defa27 C A 8: 21,315,597 (GRCm38) Q18K probably damaging Het
Defa27 A G 8: 21,315,598 (GRCm38) Q18R probably damaging Het
Defb14 G T 8: 19,195,120 (GRCm38) G38C probably damaging Het
Defb21 C A 2: 152,573,833 (GRCm38) P22H unknown Het
Defb26 C T 2: 152,508,301 (GRCm38) probably null Het
Dennd4b T G 3: 90,279,495 (GRCm38) L1425R probably damaging Het
Depdc5 A T 5: 32,943,282 (GRCm38) M846L possibly damaging Het
Dffb G T 4: 153,972,843 (GRCm38) L126M probably damaging Het
Dgat2l6 C A X: 100,524,950 (GRCm38) Q10K probably benign Het
Dgcr14 C T 16: 17,902,310 (GRCm38) G393S possibly damaging Het
Dgcr8 C T 16: 18,278,318 (GRCm38) probably null Het
Dgkb C A 12: 38,136,613 (GRCm38) L254M probably damaging Het
Dgkb A G 12: 37,981,996 (GRCm38) Q19R possibly damaging Het
Dgkd A C 1: 87,927,810 (GRCm38) S725R probably benign Het
Dgkg C A 16: 22,588,398 (GRCm38) A146S probably benign Het
Dglucy A C 12: 100,853,304 (GRCm38) K425T probably benign Het
Dhx30 C A 9: 110,086,965 (GRCm38) G722C probably damaging Het
Dhx34 G A 7: 16,218,644 (GRCm38) R19* probably null Het
Dhx57 T G 17: 80,245,805 (GRCm38) K1231T probably damaging Het
Diaph3 C A 14: 86,656,432 (GRCm38) C1136F probably benign Het
Dicer1 C G 12: 104,731,020 (GRCm38) A93P probably null Het
Dip2a T A 10: 76,266,323 (GRCm38) S1446C possibly damaging Het
Dip2a T G 10: 76,280,820 (GRCm38) T890P probably damaging Het
Disp3 G T 4: 148,250,957 (GRCm38) P908T probably damaging Het
Dlc1 C A 8: 36,584,211 (GRCm38) G338C probably damaging Het
Dlec1 C A 9: 119,138,786 (GRCm38) P1218T probably benign Het
Dlg4 G A 11: 70,041,920 (GRCm38) G512E probably benign Het
Dlgap1 C T 17: 70,815,209 (GRCm38) P878S probably damaging Het
Dll4 G T 2: 119,326,052 (GRCm38) probably benign Het
Dmbt1 T G 7: 131,088,812 (GRCm38) I925S unknown Het
Dmd A T X: 83,878,484 (GRCm38) L1453F possibly damaging Het
Dmd A G X: 83,627,286 (GRCm38) K225R probably damaging Het
Dmkn G T 7: 30,776,497 (GRCm38) W25L possibly damaging Het
Dmrt1 C T 19: 25,559,970 (GRCm38) T307I possibly damaging Het
Dmrt2 T C 19: 25,678,000 (GRCm38) L321P probably damaging Het
Dmrtb1 T A 4: 107,680,830 (GRCm38) D47V probably damaging Het
Dnaaf1 A C 8: 119,575,441 (GRCm38) D27A possibly damaging Het
Dnaaf2 G C 12: 69,197,850 (GRCm38) H146D probably damaging Het
Dnah10 G T 5: 124,775,355 (GRCm38) A1883S probably benign Het
Dnah11 A T 12: 118,130,799 (GRCm38) L845M probably damaging Het
Dnah11 C T 12: 117,931,177 (GRCm38) R3645H possibly damaging Het
Dnah11 A C 12: 118,127,119 (GRCm38) I1030S probably benign Het
Dnah14 G C 1: 181,757,351 (GRCm38) E3216Q possibly damaging Het
Dnah17 G T 11: 118,127,166 (GRCm38) L168M probably benign Het
Dnah2 G A 11: 69,421,821 (GRCm38) A4306V possibly damaging Het
Dnah2 G A 11: 69,498,667 (GRCm38) H800Y probably benign Het
Dnah2 G T 11: 69,451,120 (GRCm38) Q2986K probably benign Het
Dnah2 C G 11: 69,516,523 (GRCm38) G478A probably damaging Het
Dnah2 T G 11: 69,516,481 (GRCm38) Y492S probably damaging Het
Dnah2 G C 11: 69,487,054 (GRCm38) N1317K possibly damaging Het
Dnah3 A G 7: 119,967,803 (GRCm38) V13A Het
Dnah6 T A 6: 73,087,783 (GRCm38) E2605D possibly damaging Het
Dnah6 G T 6: 73,133,559 (GRCm38) T1681K probably benign Het
Dnah7a T G 1: 53,483,463 (GRCm38) K2872T probably damaging Het
Dnah7a A C 1: 53,419,699 (GRCm38) L3760R probably damaging Het
Dnah7c T C 1: 46,760,316 (GRCm38) F3379L possibly damaging Het
Dnah7c G T 1: 46,615,281 (GRCm38) G107V probably damaging Het
Dnah7c T A 1: 46,467,302 (GRCm38) L180M probably benign Het
Dnah7c G C 1: 46,639,665 (GRCm38) V1790L probably benign Het
Dnah7c A T 1: 46,646,992 (GRCm38) probably null Het
Dnah8 A G 17: 30,648,540 (GRCm38) K322R probably benign Het
Dnah9 A T 11: 65,970,084 (GRCm38) L2820Q probably damaging Het
Dnah9 T A 11: 66,037,474 (GRCm38) Q2123L probably damaging Het
Dnah9 T A 11: 65,895,972 (GRCm38) I3612F probably damaging Het
Dnah9 G T 11: 65,927,853 (GRCm38) L3220M probably damaging Het
Dnah9 C A 11: 66,072,835 (GRCm38) G1764V probably damaging Het
Dnaic1 G T 4: 41,614,323 (GRCm38) R333L probably benign Het
Dnajb6 G A 5: 29,752,445 (GRCm38) G75D possibly damaging Het
Dnajb8 A T 6: 88,222,910 (GRCm38) M143L possibly damaging Het
Dnajc1 C T 2: 18,293,987 (GRCm38) A259T possibly damaging Het
Dnajc11 G A 4: 151,933,783 (GRCm38) D11N probably benign Het
Dnajc28 G A 16: 91,617,033 (GRCm38) H108Y probably benign Het
Dner C A 1: 84,383,980 (GRCm38) R636L possibly damaging Het
Dnhd1 A T 7: 105,703,036 (GRCm38) probably null Het
Dnhd1 GT GTT 7: 105,703,580 (GRCm38) probably null Het
Dnhd1 A T 7: 105,668,547 (GRCm38) K483M probably damaging Het
Dnhd1 G T 7: 105,678,299 (GRCm38) K50N probably benign Het
Dnmbp T A 19: 43,866,688 (GRCm38) K265N probably damaging Het
Dnmbp T A 19: 43,889,367 (GRCm38) T422S probably benign Het
Dnmt1 C A 9: 20,926,554 (GRCm38) V381L probably benign Het
Dnmt1 T G 9: 20,915,863 (GRCm38) K979T probably damaging Het
Dnmt3a G T 12: 3,904,201 (GRCm38) W791L probably damaging Het
Doc2b A T 11: 75,777,072 (GRCm38) L284Q probably benign Het
Dock10 A C 1: 80,560,954 (GRCm38) L959V probably benign Het
Dock11 G T X: 35,984,848 (GRCm38) A699S possibly damaging Het
Dock2 A C 11: 34,718,924 (GRCm38) F230V probably benign Het
Dock4 A T 12: 40,631,614 (GRCm38) Y104F probably benign Het
Dock4 G C 12: 40,631,616 (GRCm38) V105L probably benign Het
Dock7 C A 4: 98,945,225 (GRCm38) G1945V unknown Het
Dock9 C A 14: 121,651,782 (GRCm38) G308C probably benign Het
Dopey2 G A 16: 93,807,868 (GRCm38) G2132E possibly damaging Het
Dopey2 G T 16: 93,803,546 (GRCm38) S2037I probably damaging Het
Dopey2 T A 16: 93,769,581 (GRCm38) S1083R probably benign Het
Dpagt1 G T 9: 44,329,125 (GRCm38) V213L probably benign Het
Dpp10 C A 1: 123,353,440 (GRCm38) E627* probably null Het
Dpp3 T G 19: 4,922,341 (GRCm38) Q185P probably damaging Het
Dpp6 C A 5: 27,398,998 (GRCm38) A142E probably damaging Het
Dpysl5 G T 5: 30,778,120 (GRCm38) R189L probably benign Het
Drd2 G T 9: 49,395,655 (GRCm38) E14* probably null Het
Dsc1 C A 18: 20,114,538 (GRCm38) A7S probably benign Het
Dsc2 A T 18: 20,035,299 (GRCm38) L701Q probably damaging Het
Dsg1c G T 18: 20,283,573 (GRCm38) G844C probably damaging Het
Dsg2 C A 18: 20,580,621 (GRCm38) F216L probably damaging Het
Dsp C G 13: 38,197,190 (GRCm38) T2637R possibly damaging Het
Dst G C 1: 34,244,445 (GRCm38) E3330D probably benign Het
Dst G T 1: 34,188,467 (GRCm38) E1714* probably null Het
Dst A G 1: 34,275,208 (GRCm38) K4397E probably damaging Het
Dst C G 1: 34,165,143 (GRCm38) A806G probably benign Het
Dtx1 T C 5: 120,683,295 (GRCm38) S396G probably benign Het
Dtx3l C G 16: 35,932,457 (GRCm38) C593S probably damaging Het
Dtx3l G C 16: 35,933,183 (GRCm38) S351C probably damaging Het
Dtx4 C G 19: 12,491,909 (GRCm38) A285P probably benign Het
Duox1 G T 2: 122,333,038 (GRCm38) G784W probably damaging Het
Duox2 T C 2: 122,296,507 (GRCm38) T176A probably damaging Het
Dusp8 C A 7: 142,081,943 (GRCm38) G637W unknown Het
Dusp8 C G 7: 142,090,077 (GRCm38) R33P probably damaging Het
Dvl1 G T 4: 155,855,611 (GRCm38) G400V probably benign Het
Dvl3 G C 16: 20,530,881 (GRCm38) A535P probably damaging Het
Dydc2 C A 14: 41,061,983 (GRCm38) R61L probably benign Het
Dync1i2 G T 2: 71,247,884 (GRCm38) V306L probably benign Het
Dync2h1 G T 9: 7,142,361 (GRCm38) P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 (GRCm38) probably null Het
Dyrk1a A T 16: 94,691,762 (GRCm38) H618L probably benign Het
Dyrk4 T G 6: 126,892,128 (GRCm38) K240N probably damaging Het
Dysf T A 6: 84,072,685 (GRCm38) L372H probably damaging Het
Dzip1l G T 9: 99,641,761 (GRCm38) G205V possibly damaging Het
E030025P04Rik C A 11: 109,143,971 (GRCm38) Q30H unknown Het
E130114P18Rik G T 4: 97,569,200 (GRCm38) P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 (GRCm38) C615F probably damaging Het
E230025N22Rik T A 18: 36,695,824 (GRCm38) probably benign Het
E2f6 A C 12: 16,820,273 (GRCm38) K142T possibly damaging Het
E4f1 G A 17: 24,446,145 (GRCm38) S355L probably benign Het
Ears2 C G 7: 122,055,710 (GRCm38) A112P possibly damaging Het
Ears2 C G 7: 122,044,581 (GRCm38) G385R probably damaging Het
Ebna1bp2 A C 4: 118,621,146 (GRCm38) K44T probably damaging Het
Ece1 T G 4: 137,921,027 (GRCm38) F32V probably benign Het
Ecm1 T C 3: 95,734,876 (GRCm38) I466V probably benign Het
Edil3 G C 13: 88,944,870 (GRCm38) G40R probably benign Het
Eef2 G T 10: 81,181,158 (GRCm38) probably null Het
Efcab3 C A 11: 105,100,046 (GRCm38) A93D probably damaging Het
Efcab3 T G 11: 105,108,772 (GRCm38) Y162* probably null Het
Efcab5 C G 11: 77,132,139 (GRCm38) D583H probably damaging Het
Efcc1 G T 6: 87,732,796 (GRCm38) E257D probably benign Het
Efs C A 14: 54,920,336 (GRCm38) V173L probably benign Het
Egf C A 3: 129,697,717 (GRCm38) probably null Het
Ehbp1 G C 11: 22,095,590 (GRCm38) P720A probably benign Het
Ehbp1l1 T A 19: 5,717,889 (GRCm38) M1129L probably benign Het
Ehd3 C A 17: 73,805,285 (GRCm38) P15T probably benign Het
Ehf C A 2: 103,279,518 (GRCm38) G115C probably null Het
Eif2a G T 3: 58,548,884 (GRCm38) V435L probably benign Het
Eif2d A T 1: 131,164,465 (GRCm38) K324N probably damaging Het
Eif2d C G 1: 131,164,502 (GRCm38) P337A probably damaging Het
Eif3i C A 4: 129,600,575 (GRCm38) probably benign Het
Eif4e2 G A 1: 87,225,939 (GRCm38) M155I probably benign Het
Eif4g1 G T 16: 20,673,408 (GRCm38) probably benign Het
Eipr1 G T 12: 28,859,287 (GRCm38) Q184H probably benign Het
Ell A C 8: 70,578,927 (GRCm38) S92R probably damaging Het
Ell2 A C 13: 75,756,452 (GRCm38) K220T probably damaging Het
Ell2 A T 13: 75,770,689 (GRCm38) N605Y probably damaging Het
Elmod1 T G 9: 53,946,860 (GRCm38) K2T probably benign Het
Elmsan1 G T 12: 84,173,501 (GRCm38) H226Q probably damaging Het
Elmsan1 T A 12: 84,173,499 (GRCm38) Q227L probably damaging Het
Elovl5 G C 9: 77,976,755 (GRCm38) R111P possibly damaging Het
Eme1 A C 11: 94,650,696 (GRCm38) I100S possibly damaging Het
Eml4 G C 17: 83,445,965 (GRCm38) R355T probably damaging Het
Enam C A 5: 88,492,971 (GRCm38) P164H probably damaging Het
Eng C G 2: 32,671,422 (GRCm38) I148M possibly damaging Het
Eng G T 2: 32,673,424 (GRCm38) G331C probably null Het
Eng G C 2: 32,681,452 (GRCm38) R618P probably damaging Het
Enpp3 T G 10: 24,787,793 (GRCm38) T557P probably benign Het
Entpd1 G T 19: 40,738,964 (GRCm38) A519S probably benign Het
Entpd7 G C 19: 43,725,358 (GRCm38) L385F probably benign Het
Ep400 A C 5: 110,756,635 (GRCm38) L33V unknown Het
Epas1 C T 17: 86,827,946 (GRCm38) S669L possibly damaging Het
Epb41l2 A T 10: 25,499,902 (GRCm38) R80* probably null Het
Epb41l2 G T 10: 25,441,720 (GRCm38) G45V probably benign Het
Epc2 G T 2: 49,535,300 (GRCm38) G396C probably damaging Het
Epha10 G C 4: 124,885,775 (GRCm38) G138A probably damaging Het
Epha10 T C 4: 124,883,942 (GRCm38) W50R probably damaging Het
Epha3 G T 16: 63,585,012 (GRCm38) P695Q probably damaging Het
Epha4 T G 1: 77,383,011 (GRCm38) K735T probably damaging Het
Epha4 T C 1: 77,373,733 (GRCm38) *987W probably null Het
Epha5 C T 5: 84,071,120 (GRCm38) D765N possibly damaging Het
Epha8 C A 4: 136,938,696 (GRCm38) R383L probably benign Het
Ephb1 G A 9: 102,223,398 (GRCm38) P38L probably damaging Het
Ephb3 G T 16: 21,218,036 (GRCm38) G337V possibly damaging Het
Ephx3 T G 17: 32,185,237 (GRCm38) N343T probably damaging Het
Epop C A 11: 97,628,410 (GRCm38) R291L probably damaging Het
Eral1 T G 11: 78,075,620 (GRCm38) K244T probably damaging Het
Erap1 T A 13: 74,657,638 (GRCm38) L166H probably damaging Het
Erbb4 CA CAA 1: 68,298,402 (GRCm38) probably null Het
Erbb4 G T 1: 68,328,259 (GRCm38) S433* probably null Het
Ercc2 A C 7: 19,385,668 (GRCm38) S136R probably benign Het
Ercc6 A T 14: 32,526,487 (GRCm38) S332C probably benign Het
Ereg G T 5: 91,090,120 (GRCm38) G155V possibly damaging Het
Erg T G 16: 95,409,750 (GRCm38) Q81P possibly damaging Het
Erg T G 16: 95,361,317 (GRCm38) Q317P probably damaging Het
Erh C A 12: 80,642,804 (GRCm38) L15F probably benign Het
Erich2 C A 2: 70,509,114 (GRCm38) D4E possibly damaging Het
Erich3 G T 3: 154,762,430 (GRCm38) V840L Het
Erich3 T G 3: 154,698,701 (GRCm38) I65S Het
Ero1l G A 14: 45,299,890 (GRCm38) P193L probably damaging Het
Esp18 C T 17: 39,408,166 (GRCm38) L19F probably damaging Het
Esrp1 A T 4: 11,385,765 (GRCm38) L34Q possibly damaging Het
Esrp1 C T 4: 11,384,396 (GRCm38) G96R probably damaging Het
Etv4 C T 11: 101,770,590 (GRCm38) V412M probably damaging Het
Exoc3l G T 8: 105,290,794 (GRCm38) S546Y possibly damaging Het
Exoc3l2 C A 7: 19,480,061 (GRCm38) L471M probably null Het
Exoc3l4 G T 12: 111,423,720 (GRCm38) W243L probably damaging Het
Exoc8 C T 8: 124,896,666 (GRCm38) V321I possibly damaging Het
Eya1 G C 1: 14,252,430 (GRCm38) A270G probably benign Het
Eya1 G T 1: 14,302,868 (GRCm38) P9Q probably damaging Het
F5 C G 1: 164,184,516 (GRCm38) F434L probably damaging Het
F830045P16Rik G T 2: 129,536,530 (GRCm38) probably benign Het
Fabp1 A T 6: 71,199,955 (GRCm38) Q10L possibly damaging Het
Fads1 T A 19: 10,193,704 (GRCm38) L299M probably damaging Het
Fads3 A T 19: 10,041,807 (GRCm38) I26F probably benign Het
Faf1 A G 4: 109,840,356 (GRCm38) D293G probably damaging Het
Fam109a G C 5: 121,852,907 (GRCm38) A111P probably damaging Het
Fam124a T C 14: 62,606,408 (GRCm38) M455T probably benign Het
Fam124b A C 1: 80,213,403 (GRCm38) F88V possibly damaging Het
Fam149a C A 8: 45,342,458 (GRCm38) R672L possibly damaging Het
Fam160a1 G T 3: 85,673,201 (GRCm38) L566I probably benign Het
Fam160b2 G T 14: 70,586,204 (GRCm38) S575R not run Het
Fam161b G T 12: 84,356,053 (GRCm38) Q268K probably benign Het
Fam166b G T 4: 43,427,171 (GRCm38) S87Y Het
Fam166b A G 4: 43,427,172 (GRCm38) S87P Het
Fam170a C A 18: 50,281,584 (GRCm38) A99D possibly damaging Het
Fam170b A C 14: 32,835,804 (GRCm38) N199H probably damaging Het
Fam171a2 C G 11: 102,447,446 (GRCm38) A24P unknown Het
Fam196a G T 7: 134,918,706 (GRCm38) L32I probably damaging Het
Fam208a G A 14: 27,429,208 (GRCm38) G47D probably damaging Het
Fam208a T G 14: 27,477,148 (GRCm38) L1341R probably damaging Het
Fam208b C A 13: 3,576,636 (GRCm38) V1105L probably benign Het
Fam208b C A 13: 3,588,429 (GRCm38) R434M probably damaging Het
Fam213b A C 4: 154,898,989 (GRCm38) L6R probably damaging Het
Fam240a T G 9: 110,916,509 (GRCm38) K29T probably damaging Het
Fam3b C A 16: 97,481,844 (GRCm38) R77L probably damaging Het
Fam46b G T 4: 133,486,682 (GRCm38) R288L probably damaging Het
Fam47e G T 5: 92,579,668 (GRCm38) R145L possibly damaging Het
Fam71a C T 1: 191,163,745 (GRCm38) V234I probably benign Het
Fam83g C A 11: 61,707,470 (GRCm38) P728T probably benign Het
Fance T G 17: 28,318,064 (GRCm38) L14R probably damaging Het
Fancm A C 12: 65,094,926 (GRCm38) E440D probably benign Het
Fap C A 2: 62,528,774 (GRCm38) S428I possibly damaging Het
Farp2 G T 1: 93,580,467 (GRCm38) G629V probably benign Het
Farp2 G C 1: 93,580,461 (GRCm38) G627A probably benign Het
Farp2 T C 1: 93,580,136 (GRCm38) F519L probably benign Het
Fat1 A C 8: 45,023,596 (GRCm38) H1893P possibly damaging Het
Fat1 G T 8: 45,036,838 (GRCm38) D3596Y probably damaging Het
Fat1 G A 8: 44,950,598 (GRCm38) D129N probably benign Het
Fat2 T G 11: 55,310,121 (GRCm38) H709P probably damaging Het
Fat2 A G 11: 55,282,795 (GRCm38) L2364P probably damaging Het
Fat2 T G 11: 55,303,700 (GRCm38) K1171T probably damaging Het
Fat2 G T 11: 55,284,991 (GRCm38) A1632E probably damaging Het
Fat3 T G 9: 16,375,617 (GRCm38) H870P probably benign Het
Fat3 G T 9: 15,947,526 (GRCm38) P3798Q probably damaging Het
Fat3 G T 9: 16,375,429 (GRCm38) P933T probably damaging Het
Fat4 G T 3: 38,983,359 (GRCm38) G3720V probably benign Het
Fat4 C G 3: 38,983,815 (GRCm38) P3872R probably damaging Het
Fblim1 C T 4: 141,595,371 (GRCm38) A34T possibly damaging Het
Fbn1 C T 2: 125,387,350 (GRCm38) G504S possibly damaging Het
Fbxl16 G C 17: 25,817,011 (GRCm38) G194A possibly damaging Het
Fbxl18 T G 5: 142,886,424 (GRCm38) K352T possibly damaging Het
Fbxl19 CT C 7: 127,761,275 (GRCm38) probably null Het
Fbxl21 C A 13: 56,527,003 (GRCm38) L56I probably benign Het
Fbxl22 G T 9: 66,511,888 (GRCm38) R156S probably benign Het
Fbxl4 T C 4: 22,427,280 (GRCm38) L507P probably damaging Het
Fbxo17 G C 7: 28,732,777 (GRCm38) G93A unknown Het
Fbxo24 T G 5: 137,621,403 (GRCm38) K187T probably damaging Het
Fbxo28 T A 1: 182,317,870 (GRCm38) I218F probably damaging Het
Fbxo30 A T 10: 11,295,320 (GRCm38) E714V probably damaging Het
Fbxo32 C A 15: 58,205,242 (GRCm38) D115Y probably damaging Het
Fbxo40 T A 16: 36,969,599 (GRCm38) D383V probably damaging Het
Fbxo42 T G 4: 141,180,534 (GRCm38) probably null Het
Fbxw19 T C 9: 109,481,582 (GRCm38) K424R probably benign Het
Fbxw21 T C 9: 109,145,537 (GRCm38) H305R probably benign Het
Fbxw25 C A 9: 109,651,738 (GRCm38) W291C Het
Fdx1l C A 9: 21,073,492 (GRCm38) M5I probably benign Het
Fer1l5 C A 1: 36,390,563 (GRCm38) Y465* probably null Het
Fermt1 G T 2: 132,936,018 (GRCm38) P177Q probably benign Het
Fermt1 C G 2: 132,906,756 (GRCm38) G649A probably damaging Het
Fermt1 G T 2: 132,941,943 (GRCm38) Q49K probably benign Het
Ffar3 A T 7: 30,855,193 (GRCm38) F234Y probably damaging Het
Fgd3 C A 13: 49,281,826 (GRCm38) D319Y probably damaging Het
Fgd5 A C 6: 91,988,889 (GRCm38) K701T probably damaging Het
Fgr C A 4: 133,000,170 (GRCm38) H461N probably benign Het
Fibcd1 G A 2: 31,838,539 (GRCm38) T102I probably benign Het
Flg A C 3: 93,279,962 (GRCm38) R240S probably benign Het
Flii C A 11: 60,722,313 (GRCm38) G221C possibly damaging Het
Flnb T G 14: 7,942,066 (GRCm38) I2348S probably benign Het
Flot1 A C 17: 35,825,823 (GRCm38) K219T probably damaging Het
Flrt2 G T 12: 95,778,912 (GRCm38) W8L possibly damaging Het
Flrt2 G T 12: 95,779,559 (GRCm38) G224C probably damaging Het
Flywch1 A C 17: 23,761,009 (GRCm38) W264G probably benign Het
Fmn2 G T 1: 174,608,394 (GRCm38) V644L unknown Het
Fmo2 G T 1: 162,887,598 (GRCm38) Q152K probably benign Het
Fmo2 C A 1: 162,898,274 (GRCm38) G11V probably damaging Het
Fmo6 G C 1: 162,926,132 (GRCm38) S147* probably null Het
Fmod T G 1: 134,040,919 (GRCm38) Y232* probably null Het
Fn1 C G 1: 71,597,411 (GRCm38) G2194A probably benign Het
Fndc1 T G 17: 7,804,877 (GRCm38) K82T possibly damaging Het
Fndc1 C A 17: 7,773,593 (GRCm38) G424* probably null Het
Fndc3a C A 14: 72,567,373 (GRCm38) K489N probably damaging Het
Fndc3c1 G T X: 106,434,329 (GRCm38) P767T not run Het
Foxd1 G C 13: 98,355,938 (GRCm38) G440A unknown Het
Foxd3 C A 4: 99,657,066 (GRCm38) P148T probably damaging Het
Foxf1 G T 8: 121,084,529 (GRCm38) R44L probably damaging Het
Foxi1 G T 11: 34,207,488 (GRCm38) P179H probably damaging Het
Foxi3 G A 6: 70,956,798 (GRCm38) A90T probably benign Het
Foxj2 G T 6: 122,833,711 (GRCm38) A217S probably benign Het
Foxj2 A T 6: 122,832,936 (GRCm38) probably null Het
Foxo3 T TG 10: 42,275,265 (GRCm38) probably null Het
Fpgs C T 2: 32,692,660 (GRCm38) R67H probably benign Het
Fpr3 C A 17: 17,970,993 (GRCm38) H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,113,393 (GRCm38) W278C probably benign Het
Fras1 T C 5: 96,758,142 (GRCm38) L3135P probably benign Het
Frem1 C A 4: 82,999,983 (GRCm38) G574V probably damaging Het
Frem3 T C 8: 80,615,431 (GRCm38) L1451P probably benign Het
Frem3 C A 8: 80,611,503 (GRCm38) R142S probably damaging Het
Frg1 T A 8: 41,399,638 (GRCm38) R186* probably null Het
Frmd4a A G 2: 4,498,021 (GRCm38) D107G probably damaging Het
Frmpd3 G T X: 140,433,010 (GRCm38) E1575* probably null Het
Fryl T C 5: 73,072,837 (GRCm38) D1659G probably benign Het
Fscb T G 12: 64,472,930 (GRCm38) E587D unknown Het
Fsd2 T C 7: 81,553,192 (GRCm38) E213G probably damaging Het
Fshr C G 17: 89,046,667 (GRCm38) A88P probably benign Het
Fsip1 G T 2: 118,136,483 (GRCm38) L454I possibly damaging Het
Fsip2 G T 2: 82,989,665 (GRCm38) M5247I probably benign Het
Fstl3 G C 10: 79,781,198 (GRCm38) V192L probably benign Het
Fstl5 A T 3: 76,707,982 (GRCm38) K783N probably damaging Het
Fubp1 G A 3: 152,222,087 (GRCm38) G391D probably damaging Het
Fxn C G 19: 24,262,042 (GRCm38) R162P probably damaging Het
Fyb2 G C 4: 104,913,660 (GRCm38) Q57H probably damaging Het
Gabpb2 G T 3: 95,190,693 (GRCm38) T223N probably benign Het
Gabra3 C T X: 72,445,353 (GRCm38) S322N probably damaging Het
Gabra4 G T 5: 71,623,895 (GRCm38) A391D probably benign Het
Gabrp T C 11: 33,552,673 (GRCm38) E397G probably benign Het
Gabrr3 C A 16: 59,407,482 (GRCm38) S34* probably null Het
Gadd45a C A 6: 67,036,736 (GRCm38) G109V probably benign Het
Gal3st2b T G 1: 93,938,685 (GRCm38) L36R probably damaging Het
Galm C G 17: 80,183,233 (GRCm38) T273S possibly damaging Het
Galnt9 CG C 5: 110,596,146 (GRCm38) probably null Het
Galntl5 C A 5: 25,203,189 (GRCm38) P220T probably damaging Het
Galntl6 A C 8: 57,857,558 (GRCm38) Y370D probably damaging Het
Garem1 G A 18: 21,148,325 (GRCm38) H325Y probably damaging Het
Garem1 T G 18: 21,129,792 (GRCm38) K655T probably damaging Het
Gatad2a T A 8: 69,936,038 (GRCm38) probably null Het
Gba A T 3: 89,204,005 (GRCm38) K26* probably null Het
Gbp3 G A 3: 142,561,863 (GRCm38) V34M probably damaging Het
Gck C A 11: 5,906,526 (GRCm38) M210I probably damaging Het
Gckr G T 5: 31,300,831 (GRCm38) R172I probably damaging Het
Gdap1l1 G T 2: 163,447,670 (GRCm38) R185L probably damaging Het
Gdf10 C T 14: 33,932,532 (GRCm38) T332M possibly damaging Het
Gdf15 T C 8: 70,629,890 (GRCm38) S189G probably benign Het
Gdf7 C T 12: 8,298,409 (GRCm38) R304H unknown Het
Gdf7 G T 12: 8,298,578 (GRCm38) P240T unknown Het
Gdf9 C A 11: 53,437,525 (GRCm38) T436K probably damaging Het
Gemin4 G T 11: 76,217,579 (GRCm38) probably benign Het
Gga3 T G 11: 115,587,603 (GRCm38) Q454H probably benign Het
Ggt5 A G 10: 75,602,618 (GRCm38) probably null Het
Ggt7 T A 2: 155,491,078 (GRCm38) R622W probably damaging Het
Ggt7 T A 2: 155,499,063 (GRCm38) N394I probably damaging Het
Gh G C 11: 106,301,184 (GRCm38) R67G probably damaging Het
Ghdc A G 11: 100,769,417 (GRCm38) L168P probably benign Het
Ghr A G 15: 3,347,485 (GRCm38) Y85H probably benign Het
Gimap1 A C 6: 48,743,249 (GRCm38) K265T probably damaging Het
Gimap1 T G 6: 48,743,356 (GRCm38) *301E probably null Het
Gimap7 C A 6: 48,724,153 (GRCm38) D224E probably benign Het
Gins3 G T 8: 95,633,520 (GRCm38) probably benign Het
Gjc1 C A 11: 102,800,008 (GRCm38) G390W unknown Het
Glcci1 A T 6: 8,582,674 (GRCm38) Q345L possibly damaging Het
Glipr1 G T 10: 111,988,837 (GRCm38) P155T probably benign Het
Glis3 G C 19: 28,283,768 (GRCm38) P791R possibly damaging Het
Glra3 G T 8: 56,062,500 (GRCm38) M203I probably benign Het
Gls C G 1: 52,214,488 (GRCm38) D274H probably damaging Het
Gm10300 C G 4: 132,074,809 (GRCm38) P38R unknown Het
Gm10324 A G 13: 66,122,394 (GRCm38) K458R probably damaging Het
Gm10324 G A 13: 66,122,469 (GRCm38) R483K probably benign Het
Gm10324 T A 13: 66,122,673 (GRCm38) F551Y probably benign Het
Gm10340 A G 14: 3,134,911 (GRCm38) R60G possibly damaging Het
Gm10803 G C 2: 93,564,136 (GRCm38) Q84H unknown Het
Gm11565 C T 11: 99,914,851 (GRCm38) S23F possibly damaging Het
Gm11567 C A 11: 99,879,625 (GRCm38) Q130K unknown Het
Gm11567 C A 11: 99,879,421 (GRCm38) Q62K unknown Het
Gm11567 G A 11: 99,879,332 (GRCm38) S32N unknown Het
Gm11639 G C 11: 105,001,967 (GRCm38) G4247R probably benign Het
Gm11983 T C 11: 6,837,047 (GRCm38) K27E unknown Het
Gm11983 T G 11: 6,836,861 (GRCm38) K89Q unknown Het
Gm12185 T G 11: 48,908,086 (GRCm38) I527L probably benign Het
Gm12888 G T 4: 121,324,808 (GRCm38) P29H probably damaging Het
Gm13089 G C 4: 143,696,945 (GRCm38) H425D probably benign Het
Gm13103 A G 4: 143,853,110 (GRCm38) S422G probably benign Het
Gm13178 C A 4: 144,703,325 (GRCm38) G365W probably damaging Het
Gm13212 G C 4: 145,622,968 (GRCm38) S325T possibly damaging Het
Gm15130 A G 2: 111,144,587 (GRCm38) probably null Het
Gm16503 A C 4: 147,541,156 (GRCm38) T36P unknown Het
Gm17019 C T 5: 15,032,997 (GRCm38) probably benign Het
Gm17124 A G 14: 42,597,223 (GRCm38) probably null Het
Gm19410 G T 8: 35,792,611 (GRCm38) W800L possibly damaging Het
Gm21083 T G 5: 15,577,458 (GRCm38) V41G probably benign Het
Gm21149 G T 5: 15,472,148 (GRCm38) A236D probably damaging Het
Gm21149 G C 5: 15,476,412 (GRCm38) R18G not run Het
Gm21190 A C 5: 15,524,974 (GRCm38) D215E not run Het
Gm21190 G T 5: 15,526,580 (GRCm38) T136N probably benign Het
Gm21190 G A 5: 15,524,894 (GRCm38) P242L probably benign Het
Gm21680 C T 5: 25,971,419 (GRCm38) S60N probably benign Het
Gm21886 G C 18: 80,089,387 (GRCm38) Y185* probably null Het
Gm21886 G T 18: 80,089,923 (GRCm38) L14M probably damaging Het
Gm28729 C T 9: 96,492,088 (GRCm38) R401H unknown Het
Gm29609 A T 5: 31,154,242 (GRCm38) W852R probably benign Het
Gm29797 G C 2: 181,659,095 (GRCm38) A128P probably damaging Het
Gm30302 T C 13: 49,785,384 (GRCm38) D950G possibly damaging Het
Gm30302 A C 13: 49,787,848 (GRCm38) L39V probably damaging Het
Gm30302 T C 13: 49,786,462 (GRCm38) R591G possibly damaging Het
Gm3238 G T 10: 77,771,024 (GRCm38) P101Q unknown Het
Gm32742 G A 9: 51,159,165 (GRCm38) Q76* probably null Het
Gm3285 G A 10: 77,862,434 (GRCm38) C139Y unknown Het
Gm3543 T G 14: 41,981,007 (GRCm38) N60T probably damaging Het
Gm364 T C X: 57,463,184 (GRCm38) F487L probably benign Het
Gm364 T A X: 57,417,721 (GRCm38) N140K probably benign Het
Gm3776 T A 9: 78,258,763 (GRCm38) C18S probably benign Het
Gm4450 G T 3: 98,456,455 (GRCm38) Q25K probably benign Het
Gm45618 T C 7: 142,120,218 (GRCm38) K171R unknown Het
Gm45861 G A 8: 27,584,869 (GRCm38) G1416S unknown Het
Gm4737 T C 16: 46,154,229 (GRCm38) M262V probably benign Het
Gm4779 G T X: 101,792,186 (GRCm38) P504H unknown Het
Gm4788 G T 1: 139,698,256 (GRCm38) R827S probably benign Het
Gm4788 G C 1: 139,733,448 (GRCm38) C554W probably damaging Het
Gm47985 T C 1: 151,183,141 (GRCm38) S178P possibly damaging Het
Gm4858 G T 3: 93,074,055 (GRCm38) G53W probably damaging Het
Gm49336 C A 14: 60,239,502 (GRCm38) C240F probably null Het
Gm5111 C A 6: 48,590,309 (GRCm38) L153M unknown Het
Gm5538 C A 3: 59,747,194 (GRCm38) Q150K probably benign Het
Gm5592 G A 7: 41,286,319 (GRCm38) E82K possibly damaging Het
Gm5592 C A 7: 41,288,681 (GRCm38) D462E probably benign Het
Gm5592 C G 7: 41,286,317 (GRCm38) T81R probably damaging Het
Gm5862 TGGG TGG 5: 26,018,487 (GRCm38) probably null Het
Gm5936 T G X: 74,842,035 (GRCm38) V347G probably benign Het
Gm6377 T G X: 109,198,293 (GRCm38) L160R probably damaging Het
Gm6588 T C 5: 112,449,875 (GRCm38) V96A probably benign Het
Gm6614 A G 6: 141,990,348 (GRCm38) F357S probably benign Het
Gm6871 C A 7: 41,546,413 (GRCm38) G300V probably damaging Het
Gm7138 C G 10: 77,776,853 (GRCm38) C31S unknown Het
Gm7145 A C 1: 117,986,351 (GRCm38) K321T probably benign Het
Gm7298 A C 6: 121,764,870 (GRCm38) E417A probably benign Het
Gm7298 G T 6: 121,764,875 (GRCm38) D419Y possibly damaging Het
Gm732 A C X: 107,945,825 (GRCm38) I494S possibly damaging Het
Gm7534 C G 4: 134,200,338 (GRCm38) R368P possibly damaging Het
Gm7534 A G 4: 134,202,677 (GRCm38) S106P probably benign Het
Gm7579 G T 7: 142,211,941 (GRCm38) G28V unknown Het
Gm8369 G C 19: 11,511,624 (GRCm38) A92P probably damaging Het
Gm853 T A 4: 130,221,704 (GRCm38) H17L probably benign Het
Gm8693 T C 7: 22,691,842 (GRCm38) K159R probably benign Het
Gm884 C T 11: 103,613,681 (GRCm38) G2487D probably benign Het
Gm8879 C G 5: 11,130,351 (GRCm38) N75K probably benign Het
Gm8994 G C 6: 136,329,023 (GRCm38) A161P possibly damaging Het
Gm9112 G A X: 102,707,027 (GRCm38) T72M probably benign Het
Gm9513 A C 9: 36,476,511 (GRCm38) N31T probably damaging Het
Gm9573 G T 17: 35,621,245 (GRCm38) S683Y unknown Het
Gm960 G T 19: 4,625,903 (GRCm38) R734S unknown Het
Gm973 T G 1: 59,524,602 (GRCm38) probably benign Het
Gm9758 C G 5: 14,913,539 (GRCm38) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9887 C A 12: 69,371,941 (GRCm38) W173L not run Het
Gm9964 T C 11: 79,296,400 (GRCm38) R74G unknown Het
Gm9992 C A 17: 7,376,530 (GRCm38) G127W probably damaging Het
Gmip C T 8: 69,816,292 (GRCm38) R496W probably damaging Het
Gmpr2 T G 14: 55,672,743 (GRCm38) L10R probably benign Het
Gna12 T A 5: 140,760,553 (GRCm38) Q379L probably damaging Het
Gna12 C A 5: 140,762,607 (GRCm38) D185Y probably damaging Het
Gnas C A 2: 174,298,606 (GRCm38) P249T unknown Het
Gnptab G T 10: 88,431,368 (GRCm38) E440D probably damaging Het
Gpa33 C A 1: 166,164,671 (GRCm38) C261* probably null Het
Gpat2 C A 2: 127,430,882 (GRCm38) F171L probably benign Het
Gpat2 G C 2: 127,433,808 (GRCm38) G502A probably damaging Het
Gpat4 C G 8: 23,179,798 (GRCm38) S313T probably benign Het
Gpatch1 C A 7: 35,310,485 (GRCm38) G55C probably damaging Het
Gpc5 T A 14: 115,369,964 (GRCm38) L326Q probably damaging Het
Gpd1l C A 9: 114,904,780 (GRCm38) G283W probably damaging Het
Gpnmb C A 6: 49,051,832 (GRCm38) A428D possibly damaging Het
Gpr101 T G X: 57,501,274 (GRCm38) H172P probably benign Het
Gpr158 G T 2: 21,810,690 (GRCm38) probably null Het
Gpr179 G C 11: 97,336,648 (GRCm38) S1560R probably benign Het
Gpr26 C G 7: 131,967,225 (GRCm38) L100V probably damaging Het
Gpr26 C A 7: 131,967,048 (GRCm38) P41T probably damaging Het
Gpr39 G T 1: 125,872,843 (GRCm38) G444W probably damaging Het
Gprasp2 G T X: 135,842,893 (GRCm38) G334W probably damaging Het
Gprin1 C A 13: 54,740,397 (GRCm38) Q21H probably benign Het
Gpsm1 G T 2: 26,327,345 (GRCm38) Q408H possibly damaging Het
Grb10 C A 11: 11,944,845 (GRCm38) A359S possibly damaging Het
Grb7 G T 11: 98,453,971 (GRCm38) probably null Het
Grb7 G C 11: 98,454,484 (GRCm38) G456R probably damaging Het
Greb1 C A 12: 16,696,756 (GRCm38) C1171F probably benign Het
Greb1l G C 18: 10,515,305 (GRCm38) G699A probably damaging Het
Gria3 C A X: 41,478,647 (GRCm38) A113D probably benign Het
Grid2 A G 6: 64,663,228 (GRCm38) Q810R probably benign Het
Grid2 G A 6: 63,908,879 (GRCm38) M86I possibly damaging Het
Grik5 T A 7: 25,013,804 (GRCm38) D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,297,907 (GRCm38) probably null Het
Grin3a A G 4: 49,770,622 (GRCm38) S717P probably damaging Het
Grip1 C A 10: 119,819,483 (GRCm38) probably benign Het
Grip2 G C 6: 91,763,510 (GRCm38) P1023A possibly damaging Het
Grk2 C G 19: 4,287,645 (GRCm38) M568I probably benign Het
Grk3 C A 5: 112,957,314 (GRCm38) probably null Het
Grm5 G T 7: 87,602,715 (GRCm38) G58W probably damaging Het
Grm6 C A 11: 50,859,537 (GRCm38) P509H probably benign Het
Grm7 A G 6: 111,358,149 (GRCm38) E507G probably benign Het
Grm7 G T 6: 111,358,490 (GRCm38) V621F probably damaging Het
Grm8 G C 6: 28,126,027 (GRCm38) S33R probably benign Het
Grpr A G X: 163,515,034 (GRCm38) L338P probably damaging Het
Grtp1 T G 8: 13,200,199 (GRCm38) I17L probably benign Het
Gsdma C A 11: 98,669,759 (GRCm38) P179H probably damaging Het
Gsk3b A T 16: 38,208,070 (GRCm38) K297* probably null Het
Gspt2 GC G X: 94,637,468 (GRCm38) probably null Het
Gtf2h3 G T 5: 124,579,175 (GRCm38) probably benign Het
Gtf2i C A 5: 134,263,645 (GRCm38) G415V probably null Het
Gtf2ird1 T G 5: 134,409,312 (GRCm38) probably null Het
Gtf3a G A 5: 146,951,204 (GRCm38) C105Y probably damaging Het
Gtf3c1 T A 7: 125,703,964 (GRCm38) I100F probably damaging Het
Gtse1 A G 15: 85,868,746 (GRCm38) K354R possibly damaging Het
Guca1a T C 17: 47,400,410 (GRCm38) I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 (GRCm38) K400T probably damaging Het
Gulp1 C A 1: 44,788,479 (GRCm38) D260E probably damaging Het
Gxylt2 T G 6: 100,783,191 (GRCm38) L229R probably damaging Het
Gykl1 A G 18: 52,694,547 (GRCm38) K276E probably damaging Het
H2-Eb2 A C 17: 34,334,309 (GRCm38) E156D possibly damaging Het
H2-M11 A C 17: 36,548,770 (GRCm38) R218S possibly damaging Het
H2-Q2 A C 17: 35,345,675 (GRCm38) Q351P probably damaging Het
H2-T3 A T 17: 36,186,582 (GRCm38) L382M possibly damaging Het
H2-T3 C G 17: 36,186,580 (GRCm38) L382F possibly damaging Het
Habp2 T C 19: 56,317,760 (GRCm38) V426A probably damaging Het
Hacd1 C A 2: 14,035,795 (GRCm38) M216I probably damaging Het
Hacd2 G T 16: 35,106,325 (GRCm38) Q231H probably damaging Het
Hace1 A T 10: 45,686,662 (GRCm38) N758Y probably damaging Het
Hal G A 10: 93,489,893 (GRCm38) M89I probably benign Het
Hbb-bt A G 7: 103,813,892 (GRCm38) probably benign Het
Hc T A 2: 35,006,273 (GRCm38) probably null Het
Hcar1 T A 5: 123,879,741 (GRCm38) probably benign Het
Hcfc2 G C 10: 82,699,172 (GRCm38) R10T probably damaging Het
Hcls1 G T 16: 36,961,492 (GRCm38) R321M possibly damaging Het
Hcn4 G T 9: 58,858,148 (GRCm38) G638C unknown Het
Hdac1 T A 4: 129,542,616 (GRCm38) Q5L probably benign Het
Hdac9 G T 12: 34,373,987 (GRCm38) T536K probably benign Het
Hdgfl2 G T 17: 56,079,825 (GRCm38) R24L possibly damaging Het
Hdgfl2 G T 17: 56,097,016 (GRCm38) A281S probably null Het
Heatr1 T G 13: 12,399,008 (GRCm38) N155K possibly damaging Het
Hecw1 G A 13: 14,300,333 (GRCm38) A540V possibly damaging Het
Hells G T 19: 38,965,407 (GRCm38) R765S possibly damaging Het
Helq C A 5: 100,766,766 (GRCm38) L953F possibly damaging Het
Helz2 G C 2: 181,237,564 (GRCm38) P754A probably benign Het
Heph G C X: 96,554,922 (GRCm38) E919Q probably damaging Het
Herc1 A C 9: 66,434,576 (GRCm38) E1882D probably benign Het
Herc2 G T 7: 56,132,498 (GRCm38) G1311V probably damaging Het
Herc2 G A 7: 56,097,533 (GRCm38) V473I possibly damaging Het
Herc2 G A 7: 56,131,292 (GRCm38) G1235D probably benign Het
Herc3 G T 6: 58,843,858 (GRCm38) E76* probably null Het
Herc4 T G 10: 63,307,749 (GRCm38) I686S probably benign Het
Herc6 G T 6: 57,600,031 (GRCm38) G243V probably damaging Het
Herpud2 C G 9: 25,130,622 (GRCm38) V85L not run Het
Hexdc C A 11: 121,215,237 (GRCm38) P117T probably damaging Het
Hip1r A G 5: 123,997,010 (GRCm38) Q403R probably damaging Het
Hist1h1b T C 13: 21,780,094 (GRCm38) K154R unknown Het
Hist1h4i C A 13: 22,041,214 (GRCm38) R37L probably damaging Het
Hist2h2ab G T 3: 96,220,051 (GRCm38) A46S probably benign Het
Hivep3 C T 4: 120,133,782 (GRCm38) R2160W probably damaging Het
Hlcs A C 16: 94,262,659 (GRCm38) L367R probably damaging Het
Hmcn1 G T 1: 150,586,445 (GRCm38) Q5161K probably null Het
Hmcn1 A G 1: 150,663,917 (GRCm38) V2941A probably benign Het
Hmcn1 A G 1: 150,655,921 (GRCm38) V3199A possibly damaging Het
Hmcn2 G T 2: 31,429,091 (GRCm38) R3934S probably damaging Het
Hmcn2 C A 2: 31,425,416 (GRCm38) L3726M probably damaging Het
Hmcn2 G C 2: 31,344,029 (GRCm38) D269H possibly damaging Het
Hmga2 G C 10: 120,370,671 (GRCm38) P113A unknown Het
Hmgcs2 G A 3: 98,290,945 (GRCm38) G55S probably damaging Het
Hmx2 A T 7: 131,554,467 (GRCm38) E54V probably damaging Het
Hnf1a CA C 5: 114,950,124 (GRCm38) probably null Het
Hnrnpa2b1 G T 6: 51,467,243 (GRCm38) T20N probably damaging Het
Hnrnpf G A 6: 117,923,784 (GRCm38) G10S probably benign Het
Hnrnph2 G T X: 134,605,133 (GRCm38) E76* probably null Het
Hnrnpu T G 1: 178,332,215 (GRCm38) N434H unknown Het
Hnrnpul1 C A 7: 25,724,664 (GRCm38) S721I probably benign Het
Hnrnpul1 G C 7: 25,724,698 (GRCm38) P710A unknown Het
Hoxb1 C A 11: 96,367,051 (GRCm38) P269Q probably benign Het
Hoxd9 G C 2: 74,698,128 (GRCm38) A25P probably damaging Het
Hp1bp3 C T 4: 138,221,673 (GRCm38) L16F not run Het
Hpd C A 5: 123,181,475 (GRCm38) G49V probably damaging Het
Hps1 C A 19: 42,766,686 (GRCm38) R272S probably null Het
Hsd17b13 G T 5: 103,968,705 (GRCm38) P184T probably benign Het
Hsd17b3 C T 13: 64,063,138 (GRCm38) G182S possibly damaging Het
Hsd3b1 T G 3: 98,852,886 (GRCm38) Q263P probably damaging Het
Hsd3b2 C T 3: 98,712,222 (GRCm38) E136K probably benign Het
Hsd3b3 A G 3: 98,743,960 (GRCm38) V58A probably benign Het
Hsdl2 A T 4: 59,617,706 (GRCm38) K478* probably null Het
Hspa1l G C 17: 34,978,492 (GRCm38) K502N possibly damaging Het
Htr1f G T 16: 64,926,077 (GRCm38) S284* probably null Het
Htr1f G T 16: 64,926,874 (GRCm38) N18K probably benign Het
Htr7 G T 19: 35,969,423 (GRCm38) T397N probably damaging Het
Htra2 C A 6: 83,054,383 (GRCm38) R15L probably benign Het
Hunk C A 16: 90,472,573 (GRCm38) P335H probably damaging Het
Huwe1 C A X: 151,856,575 (GRCm38) H356N probably damaging Het
Huwe1 A C X: 151,928,381 (GRCm38) K3958T unknown Het
Hyal4 G A 6: 24,756,628 (GRCm38) V282M probably damaging Het
Hydin T G 8: 110,541,600 (GRCm38) F2904V possibly damaging Het
Hyou1 G T 9: 44,387,742 (GRCm38) E621* probably null Het
Ice1 C A 13: 70,605,201 (GRCm38) C922F probably damaging Het
Ide C T 19: 37,315,491 (GRCm38) V238M Het
Idh3b T A 2: 130,281,542 (GRCm38) probably null Het
Ifi204 C A 1: 173,751,628 (GRCm38) K550N probably null Het
Ifi206 T G 1: 173,482,048 (GRCm38) K127N Het
Ifi27l2b C A 12: 103,457,033 (GRCm38) G7C unknown Het
Ifi44 A G 3: 151,732,453 (GRCm38) L399P probably damaging Het
Ifih1 T G 2: 62,617,469 (GRCm38) Q297P probably benign Het
Ifitm1 C A 7: 140,969,517 (GRCm38) T71K probably benign Het
Ifna5 C T 4: 88,835,999 (GRCm38) H159Y probably damaging Het
Ifnab T G 4: 88,690,718 (GRCm38) E170D probably damaging Het
Ift122 A C 6: 115,915,994 (GRCm38) D854A probably damaging Het
Ift172 C A 5: 31,276,924 (GRCm38) W490L probably damaging Het
Igfbp4 C G 11: 99,051,515 (GRCm38) P234R probably damaging Het
Igfn1 G T 1: 135,972,000 (GRCm38) H524Q probably damaging Het
Ighv1-12 C A 12: 114,616,013 (GRCm38) G63V possibly damaging Het
Ighv14-4 C A 12: 114,176,667 (GRCm38) C41F probably damaging Het
Ighv14-4 C G 12: 114,176,672 (GRCm38) L39F probably damaging Het
Ighv1-52 C A 12: 115,145,777 (GRCm38) V21F probably damaging Het
Ighv1-63 C T 12: 115,495,645 (GRCm38) A111T possibly damaging Het
Ighv1-69 A C 12: 115,623,253 (GRCm38) S87A probably benign Het
Ighv1-9 T G 12: 114,583,834 (GRCm38) E29A probably benign Het
Igkv1-35 C T 6: 70,011,034 (GRCm38) G93R possibly damaging Het
Igkv1-99 T A 6: 68,542,262 (GRCm38) S68T Het
Igkv3-12 A T 6: 70,518,611 (GRCm38) I41F probably benign Het
Igkv4-74 T C 6: 69,185,345 (GRCm38) Q6R possibly damaging Het
Igkv6-32 T A 6: 70,074,586 (GRCm38) probably benign Het
Igsf21 A T 4: 140,067,215 (GRCm38) C116S probably damaging Het
Igsf5 C G 16: 96,391,023 (GRCm38) S274C probably damaging Het
Igsf8 G T 1: 172,318,354 (GRCm38) A406S probably damaging Het
Igsf9 G C 1: 172,492,149 (GRCm38) G337A probably damaging Het
Igsf9 G T 1: 172,495,226 (GRCm38) A586S probably benign Het
Igsf9b A G 9: 27,317,353 (GRCm38) probably null Het
Ihh T G 1: 74,946,094 (GRCm38) S411R probably damaging Het
Ik G T 18: 36,753,515 (GRCm38) D347Y possibly damaging Het
Ikbkap T A 4: 56,790,146 (GRCm38) T315S probably benign Het
Ikzf1 G T 11: 11,758,194 (GRCm38) probably null Het
Ikzf3 T G 11: 98,467,181 (GRCm38) E443D probably benign Het
Ikzf4 G A 10: 128,634,230 (GRCm38) P527S possibly damaging Het
Il10ra A C 9: 45,266,632 (GRCm38) S67A possibly damaging Het
Il16 C G 7: 83,652,827 (GRCm38) S727T probably benign Het
Il17rc G T 6: 113,476,795 (GRCm38) probably null Het
Il1rap G T 16: 26,722,399 (GRCm38) R463S probably damaging Het
Il27ra C A 8: 84,040,990 (GRCm38) W101C probably damaging Het
Il2ra C A 2: 11,681,931 (GRCm38) A191D probably damaging Het
Il6st A G 13: 112,493,618 (GRCm38) K333E probably benign Het
Impg1 C G 9: 80,378,467 (GRCm38) R418S probably benign Het
Incenp C A 19: 9,877,687 (GRCm38) W620L unknown Het
Inhbb C A 1: 119,417,798 (GRCm38) V254L probably benign Het
Inpp4b C G 8: 82,069,001 (GRCm38) A818G possibly damaging Het
Inpp5b CA C 4: 124,797,840 (GRCm38) probably null Het
Inpp5d T G 1: 87,669,709 (GRCm38) F201V probably benign Het
Inpp5d T G 1: 87,703,131 (GRCm38) L671W probably damaging Het
Inpp5j G T 11: 3,502,484 (GRCm38) Y255* probably null Het
Insc C T 7: 114,811,639 (GRCm38) Q244* probably null Het
Insm1 C T 2: 146,223,556 (GRCm38) Q431* probably null Het
Ints12 A C 3: 133,102,464 (GRCm38) D201A probably damaging Het
Ints6l G A X: 56,497,935 (GRCm38) M527I probably damaging Het
Ints9 G A 14: 65,037,454 (GRCm38) V620I probably benign Het
Ipo13 C A 4: 117,904,630 (GRCm38) E458* probably null Het
Ipp G T 4: 116,537,885 (GRCm38) G539V probably null Het
Iqca A T 1: 90,045,725 (GRCm38) V775E probably benign Het
Iqcf3 G T 9: 106,560,988 (GRCm38) P12Q unknown Het
Iqck C A 7: 118,941,654 (GRCm38) R259S probably benign Het
Iqgap1 C A 7: 80,768,309 (GRCm38) K104N probably benign Het
Iqgap2 A G 13: 95,731,443 (GRCm38) I219T possibly damaging Het
Irgq G T 7: 24,531,801 (GRCm38) G139V probably damaging Het
Irs2 T G 8: 11,006,185 (GRCm38) D749A probably damaging Het
Irx6 C A 8: 92,678,371 (GRCm38) P289H possibly damaging Het
Isl2 C A 9: 55,542,215 (GRCm38) C58* probably null Het
Ism1 A C 2: 139,731,874 (GRCm38) N48T probably benign Het
Itga7 A C 10: 128,953,827 (GRCm38) K1012T probably benign Het
Itga8 A C 2: 12,247,518 (GRCm38) F294V probably damaging Het
Itga8 C A 2: 12,262,136 (GRCm38) A163S probably benign Het
Itga8 C A 2: 12,301,832 (GRCm38) probably benign Het
Itga9 A C 9: 118,843,530 (GRCm38) D790A probably benign Het
Itga9 G A 9: 118,887,839 (GRCm38) V990M probably damaging Het
Itgad T A 7: 128,190,087 (GRCm38) N574K probably damaging Het
Itgax G C 7: 128,144,872 (GRCm38) R909T probably benign Het
Itgb2 A T 10: 77,557,962 (GRCm38) Q412L probably benign Het
Itgb3 G T 11: 104,643,623 (GRCm38) K435N possibly damaging Het
Itgb4 G A 11: 116,006,520 (GRCm38) G1536R probably damaging Het
Itgb6 G C 2: 60,611,468 (GRCm38) S666C possibly damaging Het
Itgbl1 G T 14: 123,954,672 (GRCm38) G373C probably damaging Het
Itih4 GAA G 14: 30,899,462 (GRCm38) probably null Het
Itm2c G A 1: 85,906,527 (GRCm38) V188M possibly damaging Het
Itpka G C 2: 119,742,800 (GRCm38) S141T probably damaging Het
Itpkc C A 7: 27,227,638 (GRCm38) D284Y probably benign Het
Itpr1 T A 6: 108,499,149 (GRCm38) W2275R probably damaging Het
Ivd G T 2: 118,876,344 (GRCm38) K272N possibly damaging Het
Ivns1abp A G 1: 151,351,033 (GRCm38) E12G probably damaging Het
Jak1 C A 4: 101,163,681 (GRCm38) G654V probably damaging Het
Jak1 C T 4: 101,163,722 (GRCm38) M640I probably benign Het
Jak2 G A 19: 29,271,398 (GRCm38) E92K possibly damaging Het
Jak3 C G 8: 71,680,683 (GRCm38) A340G possibly damaging Het
Jakmip3 G T 7: 139,020,133 (GRCm38) R254L probably benign Het
Jmjd1c T C 10: 67,238,174 (GRCm38) L1896P probably benign Het
Jph1 C T 1: 17,097,352 (GRCm38) E85K possibly damaging Het
Jph4 G A 14: 55,113,648 (GRCm38) R304C probably benign Het
Jun T A 4: 95,051,378 (GRCm38) probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,778,294 (GRCm38) probably null Het
Kat6a C G 8: 22,910,154 (GRCm38) C310W probably damaging Het
Katna1 G T 10: 7,759,785 (GRCm38) S328I probably damaging Het
Katnal2 T C 18: 77,012,057 (GRCm38) K127R probably benign Het
Kbtbd2 T G 6: 56,780,309 (GRCm38) E147D probably damaging Het
Kcna3 A T 3: 107,037,266 (GRCm38) N282Y probably damaging Het
Kcna5 T A 6: 126,533,716 (GRCm38) K483M probably damaging Het
Kcnb1 G T 2: 167,188,402 (GRCm38) D74E probably damaging Het
Kcne2 C T 16: 92,296,591 (GRCm38) A2V probably benign Het
Kcnh1 C A 1: 192,418,737 (GRCm38) R573S probably damaging Het
Kcnh8 C A 17: 52,894,061 (GRCm38) L508I probably damaging Het
Kcnj2 G T 11: 111,072,135 (GRCm38) V118L probably benign Het
Kcnk18 G T 19: 59,234,959 (GRCm38) A179S probably benign Het
Kcnq4 A C 4: 120,698,497 (GRCm38) probably null Het
Kcns1 G A 2: 164,168,633 (GRCm38) H69Y probably benign Het
Kcnt1 G C 2: 25,906,796 (GRCm38) R809P probably benign Het
Kcnt2 G C 1: 140,376,361 (GRCm38) W156C probably damaging Het
Kcnv2 G T 19: 27,323,438 (GRCm38) A230S probably benign Het
Kcp T A 6: 29,485,012 (GRCm38) E1247V probably benign Het
Kctd1 C T 18: 15,063,125 (GRCm38) S147N unknown Het
Kctd12 C G 14: 102,981,918 (GRCm38) G175R not run Het
Kctd19 A C 8: 105,385,136 (GRCm38) F842V probably damaging Het
Kdm3b G T 18: 34,809,069 (GRCm38) E738* probably null Het
Kdm4a T A 4: 118,177,502 (GRCm38) S11C probably benign Het
Kdm4a C T 4: 118,153,190 (GRCm38) E619K probably benign Het
Kdm5b G A 1: 134,625,035 (GRCm38) D1250N probably damaging Het
Kel G T 6: 41,687,572 (GRCm38) P644T probably damaging Het
Khdc1c G T 1: 21,369,563 (GRCm38) E113* probably null Het
Khdrbs2 G T 1: 32,333,662 (GRCm38) W139L unknown Het
Khdrbs3 T C 15: 69,017,467 (GRCm38) L155P probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 (GRCm38) probably benign Het
Kif12 T G 4: 63,171,997 (GRCm38) E3D possibly damaging Het
Kif13b C G 14: 64,803,344 (GRCm38) P1627R probably benign Het
Kif14 G T 1: 136,500,016 (GRCm38) probably null Het
Kif14 A T 1: 136,496,653 (GRCm38) Q1002L probably damaging Het
Kif18a G A 2: 109,318,053 (GRCm38) G631R possibly damaging Het
Kif19a A T 11: 114,786,590 (GRCm38) E600V probably damaging Het
Kif19a C A 11: 114,789,829 (GRCm38) A925E probably benign Het
Kif1a G A 1: 93,055,697 (GRCm38) P693S probably benign Het
Kif1a G C 1: 93,021,316 (GRCm38) L1495V probably damaging Het
Kif1a G A 1: 93,022,491 (GRCm38) R1405W probably damaging Het
Kif1b T G 4: 149,266,298 (GRCm38) K273T possibly damaging Het
Kif20b C G 19: 34,952,875 (GRCm38) S1260C probably benign Het
Kif21b C A 1: 136,154,137 (GRCm38) T641K probably benign Het
Kif26a G C 12: 112,177,618 (GRCm38) E1435D probably damaging Het
Kif28 T G 1: 179,733,134 (GRCm38) K202T probably benign Het
Kif2b C A 11: 91,576,264 (GRCm38) E398* probably null Het
Kirrel2 T C 7: 30,453,457 (GRCm38) T379A probably benign Het
Klf17 G T 4: 117,760,351 (GRCm38) R270S probably benign Het
Klhdc7a G T 4: 139,967,797 (GRCm38) probably benign Het
Klhdc8b T A 9: 108,448,377 (GRCm38) Q326L probably benign Het
Klhl18 C G 9: 110,437,347 (GRCm38) A300P probably null Het
Klhl2 C A 8: 64,758,126 (GRCm38) R296L probably damaging Het
Klhl22 G A 16: 17,776,696 (GRCm38) D230N probably benign Het
Klhl30 C G 1: 91,359,465 (GRCm38) A491G probably damaging Het
Klhl6 G T 16: 19,953,674 (GRCm38) T307N probably damaging Het
Klk8 C A 7: 43,803,725 (GRCm38) R247S possibly damaging Het
Klkb1 G T 8: 45,273,629 (GRCm38) R446S probably damaging Het
Klra1 C G 6: 130,372,851 (GRCm38) W208S probably damaging Het
Klra3 C A 6: 130,335,721 (GRCm38) E27* probably null Het
Klra5 G C 6: 129,911,452 (GRCm38) P4A not run Het
Klrb1a GT G 6: 128,618,585 (GRCm38) probably null Het
Kmt2a C A 9: 44,847,979 (GRCm38) D858Y probably damaging Het
Kmt2b C A 7: 30,577,370 (GRCm38) R1674L probably damaging Het
Kmt2c G C 5: 25,354,413 (GRCm38) A1076G probably damaging Het
Kmt5b G T 19: 3,793,118 (GRCm38) G72* probably null Het
Kng1 G T 16: 23,079,616 (GRCm38) V589L probably benign Het
Kpna6 C A 4: 129,655,548 (GRCm38) W147L probably damaging Het
Kpna6 T A 4: 129,648,078 (GRCm38) S509C possibly damaging Het
Krt12 C A 11: 99,420,761 (GRCm38) E205* probably null Het
Krt17 T G 11: 100,260,923 (GRCm38) K15Q probably benign Het
Krt222 A T 11: 99,238,552 (GRCm38) L143Q probably damaging Het
Krt24 C G 11: 99,284,886 (GRCm38) G108R unknown Het
Krt25 C G 11: 99,322,822 (GRCm38) A24P probably benign Het
Krt27 C A 11: 99,348,978 (GRCm38) E253D probably damaging Het
Krt33a C A 11: 100,011,914 (GRCm38) E361D probably benign Het
Krt34 G T 11: 100,041,434 (GRCm38) C21* probably null Het
Krt82 C T 15: 101,541,852 (GRCm38) V470I probably benign Het
Krtap1-3 A G 11: 99,590,995 (GRCm38) C109R possibly damaging Het
Krtap16-1 C T 11: 99,985,597 (GRCm38) R327Q possibly damaging Het
Krtap21-1 C A 16: 89,403,581 (GRCm38) G58C unknown Het
Krtap28-13 G T 1: 83,061,090 (GRCm38) C32F unknown Het
Krtap3-1 G C 11: 99,566,567 (GRCm38) A6G probably benign Het
Krtap4-2 C A 11: 99,634,976 (GRCm38) G17C unknown Het
Krtap6-1 G C 16: 89,031,809 (GRCm38) C31S unknown Het
Krtap7-1 C A 16: 89,508,260 (GRCm38) M1I probably null Het
Ksr1 C A 11: 79,027,600 (GRCm38) R576L probably benign Het
Ksr1 C A 11: 79,020,751 (GRCm38) R735L possibly damaging Het
Kyat1 G T 2: 30,187,732 (GRCm38) T175N probably damaging Het
L2hgdh C T 12: 69,707,132 (GRCm38) S233N probably benign Het
L3mbtl4 G T 17: 68,425,687 (GRCm38) W54L probably damaging Het
Lama1 G A 17: 67,752,883 (GRCm38) D656N probably benign Het
Lamb1 A T 12: 31,327,702 (GRCm38) S1697C possibly damaging Het
Lamb2 G T 9: 108,482,901 (GRCm38) G419C probably damaging Het
Lamc2 C A 1: 153,133,621 (GRCm38) V813L probably benign Het
Lamp2 T C X: 38,424,381 (GRCm38) S332G probably damaging Het
Lao1 C A 4: 118,968,440 (GRCm38) H486N probably damaging Het
Large2 G C 2: 92,370,198 (GRCm38) T87R probably benign Het
Lats1 G T 10: 7,705,809 (GRCm38) G786V probably damaging Het
Lbp T A 2: 158,325,762 (GRCm38) L402Q probably damaging Het
Lcn11 G T 2: 25,777,724 (GRCm38) K41N probably benign Het
Lct C A 1: 128,287,611 (GRCm38) E1743* probably null Het
Ldb3 C G 14: 34,555,365 (GRCm38) A351P probably benign Het
Ldhd G T 8: 111,627,520 (GRCm38) T382N probably damaging Het
Lect2 A T 13: 56,548,361 (GRCm38) M1K probably null Het
Lef1 C A 3: 131,200,323 (GRCm38) A344D probably damaging Het
Lep G C 6: 29,070,970 (GRCm38) A98P possibly damaging Het
Lepr C A 4: 101,745,614 (GRCm38) P200T probably damaging Het
Lexm G T 4: 106,607,300 (GRCm38) D387E probably benign Het
Lgr5 C A 10: 115,460,876 (GRCm38) R382M probably damaging Het
Lhcgr T G 17: 88,742,270 (GRCm38) K609N probably damaging Het
Lhx3 G T 2: 26,203,987 (GRCm38) R77S probably damaging Het
Lhx4 C A 1: 155,705,255 (GRCm38) A175S probably damaging Het
Lilra6 C T 7: 3,915,074 (GRCm38) probably null Het
Lingo3 G C 10: 80,834,855 (GRCm38) Q414E possibly damaging Het
Lins1 C G 7: 66,710,264 (GRCm38) A263G possibly damaging Het
Lipf T A 19: 33,965,595 (GRCm38) L101Q probably damaging Het
Lipo3 A C 19: 33,584,928 (GRCm38) L14R probably null Het
Lipo4 C A 19: 33,503,184 (GRCm38) M261I probably benign Het
Lipt1 G A 1: 37,875,903 (GRCm38) V347I probably benign Het
Llgl2 G T 11: 115,849,554 (GRCm38) E359* probably null Het
Lman2l C A 1: 36,428,376 (GRCm38) G197V probably damaging Het
Lmnb2 C G 10: 80,903,238 (GRCm38) G594R probably damaging Het
Lmo7 T C 14: 101,929,228 (GRCm38) S1548P unknown Het
Lmo7 G A 14: 101,919,443 (GRCm38) E1350K unknown Het
Lmo7 C A 14: 101,884,306 (GRCm38) P269Q probably damaging Het
Lmo7 A T 14: 101,919,281 (GRCm38) T1296S probably benign Het
Lmx1a A T 1: 167,691,999 (GRCm38) K32M possibly damaging Het
Lnp1 C T 16: 56,927,903 (GRCm38) D9N possibly damaging Het
Lox T G 18: 52,520,834 (GRCm38) T397P probably damaging Het
Lpar5 C A 6: 125,081,379 (GRCm38) T21K possibly damaging Het
Lpar5 T G 6: 125,082,072 (GRCm38) L252R probably damaging Het
Lpgat1 T G 1: 191,778,475 (GRCm38) F391V probably benign Het
Lpin2 C G 17: 71,225,211 (GRCm38) S225* probably null Het
Lpin3 C G 2: 160,899,785 (GRCm38) P492A probably damaging Het
Lpp G C 16: 24,761,603 (GRCm38) S148T probably benign Het
Lpxn C A 19: 12,824,947 (GRCm38) A212D probably damaging Het
Lrba G T 3: 86,751,532 (GRCm38) G2569C possibly damaging Het
Lrba G C 3: 86,715,538 (GRCm38) C2409S probably benign Het
Lrch3 A C 16: 32,914,316 (GRCm38) T59P possibly damaging Het
Lrfn1 A G 7: 28,459,115 (GRCm38) E153G possibly damaging Het
Lrig1 G T 6: 94,609,026 (GRCm38) T727N possibly damaging Het
Lrp1 C G 10: 127,554,962 (GRCm38) C3022S probably damaging Het
Lrp12 A T 15: 39,878,123 (GRCm38) F418I probably damaging Het
Lrp1b T A 2: 40,697,582 (GRCm38) D3887V Het
Lrp1b A C 2: 40,677,506 (GRCm38) L4070V Het
Lrp1b C A 2: 40,922,383 (GRCm38) E2517D Het
Lrp1b G T 2: 41,728,710 (GRCm38) N231K Het
Lrp2 C G 2: 69,480,042 (GRCm38) G2729A possibly damaging Het
Lrp2 A T 2: 69,507,881 (GRCm38) V1185E possibly damaging Het
Lrp6 C T 6: 134,456,157 (GRCm38) G1404R possibly damaging Het
Lrpprc C G 17: 84,770,431 (GRCm38) A359P possibly damaging Het
Lrrc15 C G 16: 30,274,252 (GRCm38) A90P probably benign Het
Lrrc18 C G 14: 33,009,200 (GRCm38) P232R probably benign Het
Lrrc20 A G 10: 61,527,165 (GRCm38) K63R probably damaging Het
Lrrc27 C A 7: 139,242,720 (GRCm38) P509Q probably damaging Het
Lrrc30 C T 17: 67,632,436 (GRCm38) V50I probably benign Het
Lrrc37a T G 11: 103,501,094 (GRCm38) E1168D probably benign Het
Lrrc37a C A 11: 103,456,486 (GRCm38) D3128Y probably damaging Het
Lrrc37a G T 11: 103,499,034 (GRCm38) A1855D possibly damaging Het
Lrrc49 T A 9: 60,677,221 (GRCm38) Q186L probably damaging Het
Lrrc4b G A 7: 44,445,123 (GRCm38) V72M probably damaging Het
Lrrc4b GC G 7: 44,461,312 (GRCm38) probably null Het
Lrrc59 A C 11: 94,643,321 (GRCm38) K235T probably benign Het
Lrrc8e A T 8: 4,234,822 (GRCm38) E349V probably damaging Het
Lrrc9 A G 12: 72,477,393 (GRCm38) K791R probably damaging Het
Lrrd1 C T 5: 3,850,025 (GRCm38) P110L probably benign Het
Lrrfip1 G T 1: 91,101,199 (GRCm38) M68I possibly damaging Het
Lrrfip2 C A 9: 111,161,340 (GRCm38) A43E probably damaging Het
Lrriq1 T A 10: 103,202,359 (GRCm38) Q861L probably damaging Het
Lrriq1 G T 10: 103,202,360 (GRCm38) Q861K probably damaging Het
Lrriq1 G T 10: 103,234,085 (GRCm38) S23R probably damaging Het
Lrrtm2 T C 18: 35,214,659 (GRCm38) probably benign Het
Lrrtm3 C A 10: 64,089,355 (GRCm38) G11V probably damaging Het
Lrsam1 C G 2: 32,941,814 (GRCm38) R383P probably damaging Het
Lrwd1 G A 5: 136,134,008 (GRCm38) R120C probably damaging Het
Ltbp2 G C 12: 84,875,853 (GRCm38) R147G probably benign Het
Luc7l2 G T 6: 38,551,908 (GRCm38) G21* probably null Het
Ly9 G T 1: 171,594,060 (GRCm38) T541K probably damaging Het
Lyg1 C A 1: 37,947,177 (GRCm38) G159C probably null Het
Lyg2 C A 1: 37,911,127 (GRCm38) C40F probably damaging Het
Lyst C G 13: 13,777,079 (GRCm38) A3755G probably benign Het
Lyst T C 13: 13,640,107 (GRCm38) L1149S probably damaging Het
M1ap A T 6: 82,968,042 (GRCm38) R106* probably null Het
Macrod2 G T 2: 140,706,208 (GRCm38) G93V probably damaging Het
Macrod2 T A 2: 141,024,090 (GRCm38) C123S probably damaging Het
Madd C A 2: 91,159,272 (GRCm38) G1129V probably damaging Het
Mafg T G 11: 120,629,528 (GRCm38) Q82P probably damaging Het
Mageb18 G A X: 92,119,896 (GRCm38) P247S probably damaging Het
Magi2 C A 5: 20,702,109 (GRCm38) Q1094K probably benign Het
Magohb C A 6: 131,288,063 (GRCm38) W79C probably damaging Het
Malrd1 C A 2: 16,217,845 (GRCm38) Q2015K unknown Het
Mamdc2 A C 19: 23,334,057 (GRCm38) F478V possibly damaging Het
Man1a G T 10: 53,919,315 (GRCm38) P523Q probably damaging Het
Man1b1 G C 2: 25,344,983 (GRCm38) R270T possibly damaging Het
Man2b1 A C 8: 85,093,938 (GRCm38) D618A probably damaging Het
Manba G T 3: 135,563,274 (GRCm38) G647* probably null Het
Map1a G T 2: 121,303,238 (GRCm38) G1512C possibly damaging Het
Map2k5 C A 9: 63,358,038 (GRCm38) R69S probably damaging Het
Map3k13 G T 16: 21,905,162 (GRCm38) G298V probably damaging Het
Map3k14 G T 11: 103,225,496 (GRCm38) T702K probably benign Het
Map3k14 T G 11: 103,231,073 (GRCm38) E506A probably benign Het
Map3k7 T G 4: 32,015,963 (GRCm38) I496S probably damaging Het
Map3k9 C A 12: 81,772,782 (GRCm38) D233Y possibly damaging Het
Map4k3 C G 17: 80,618,337 (GRCm38) A410P possibly damaging Het
Map6 G C 7: 99,317,660 (GRCm38) E565D probably damaging Het
Mapk10 A T 5: 102,991,887 (GRCm38) L166Q probably damaging Het
Mapk4 A G 18: 73,937,184 (GRCm38) W213R probably damaging Het
Mapk8 G T 14: 33,410,886 (GRCm38) P31H probably damaging Het
March4 C T 1: 72,452,500 (GRCm38) C204Y probably damaging Het
Marf1 C A 16: 14,115,777 (GRCm38) Q1582H probably benign Het
Mast1 G C 8: 84,918,681 (GRCm38) R712G probably damaging Het
Mast1 T G 8: 84,912,459 (GRCm38) S1414R probably damaging Het
Mast4 C G 13: 102,738,460 (GRCm38) E1467Q probably damaging Het
Mat1a A T 14: 41,105,510 (GRCm38) probably benign Het
Mat2b T A 11: 40,687,777 (GRCm38) S28C probably benign Het
Mat2b C G 11: 40,682,485 (GRCm38) Q233H probably damaging Het
Matn1 T A 4: 130,946,105 (GRCm38) L128Q probably damaging Het
Mavs G T 2: 131,240,401 (GRCm38) W68C probably damaging Het
Mbd5 A C 2: 49,279,308 (GRCm38) N1497T probably benign Het
Mbip T G 12: 56,340,385 (GRCm38) E156D probably damaging Het
Mbnl2 G C 14: 120,403,359 (GRCm38) A346P probably benign Het
Mboat2 G T 12: 24,948,344 (GRCm38) A282S possibly damaging Het
Mcm3 C A 1: 20,820,181 (GRCm38) V10L probably benign Het
Mcm8 G T 2: 132,827,567 (GRCm38) G319* probably null Het
Mcm9 C A 10: 53,537,507 (GRCm38) R492S unknown Het
Mcm9 CCGCGCGGCGTTGGAGGGGGCGGGGCGTGCGCGCGGC CCGCGCGGC 10: 53,629,788 (GRCm38) probably null Het
Mcoln3 C G 3: 146,140,466 (GRCm38) H510Q probably benign Het
Mcts1 A C X: 38,601,941 (GRCm38) K8N possibly damaging Het
Mdga2 C A 12: 66,689,443 (GRCm38) G337V probably damaging Het
Mdh1b G T 1: 63,711,531 (GRCm38) T426K probably benign Het
Mdh2 C A 5: 135,789,629 (GRCm38) S246Y probably damaging Het
Mdn1 A C 4: 32,696,244 (GRCm38) N1209T probably damaging Het
Mdn1 G T 4: 32,668,944 (GRCm38) G334V probably damaging Het
Mdn1 A G 4: 32,667,102 (GRCm38) N189S probably benign Het
Med1 C A 11: 98,161,183 (GRCm38) V452L possibly damaging Het
Med12 G T X: 101,281,225 (GRCm38) D679Y probably damaging Het
Med12 G T X: 101,293,573 (GRCm38) Q1902H possibly damaging Het
Med12l C A 3: 59,091,417 (GRCm38) N599K probably damaging Het
Med12l C A 3: 59,296,117 (GRCm38) P2020Q probably benign Het
Med12l C A 3: 59,244,943 (GRCm38) L1050I probably damaging Het
Med13 T A 11: 86,345,862 (GRCm38) K156N probably benign Het
Med13 T A 11: 86,328,544 (GRCm38) S359C possibly damaging Het
Med13 T G 11: 86,355,423 (GRCm38) D51A probably damaging Het
Medag G T 5: 149,427,507 (GRCm38) probably null Het
Mef2b G C 8: 70,166,375 (GRCm38) R202S probably damaging Het
Mefv C A 16: 3,715,455 (GRCm38) E317D possibly damaging Het
Megf10 C G 18: 57,277,694 (GRCm38) P692A probably damaging Het
Meis1 C A 11: 19,014,317 (GRCm38) G105V probably damaging Het
Mep1a C G 17: 43,477,320 (GRCm38) R628T probably benign Het
Mepce C A 5: 137,785,842 (GRCm38) G74V probably damaging Het
Mettl25 C A 10: 105,826,098 (GRCm38) R337I possibly damaging Het
Mettl4 T G 17: 94,733,563 (GRCm38) T388P probably benign Het
Mettl7b G T 10: 128,958,748 (GRCm38) P236T probably damaging Het
Mex3d C G 10: 80,386,713 (GRCm38) E236D Het
Mfsd11 G C 11: 116,863,940 (GRCm38) A226P probably damaging Het
Mfsd13b G A 7: 120,991,677 (GRCm38) V214I probably benign Het
Mfsd2a G C 4: 122,951,839 (GRCm38) T173S probably benign Het
Mfsd2a G T 4: 122,959,311 (GRCm38) L62M possibly damaging Het
Mfsd2b C A 12: 4,866,530 (GRCm38) probably null Het
Mfsd4b2 C T 10: 39,921,600 (GRCm38) S253N probably benign Het
Mfsd4b4 G T 10: 39,892,599 (GRCm38) P212H possibly damaging Het
Mfsd4b5 G C 10: 39,986,390 (GRCm38) L46V probably damaging Het
Mgam G T 6: 40,729,066 (GRCm38) R23L probably damaging Het
Mgam G T 6: 40,677,644 (GRCm38) probably null Het
Mgat4d A C 8: 83,368,112 (GRCm38) K259N probably benign Het
Mgat4d G C 8: 83,348,521 (GRCm38) V13L probably benign Het
Mia2 C G 12: 59,108,801 (GRCm38) D433E probably damaging Het
Mia2 G T 12: 59,108,124 (GRCm38) D208Y probably benign Het
Mib2 G C 4: 155,661,141 (GRCm38) A71G probably benign Het
Midn G A 10: 80,153,628 (GRCm38) G142E probably benign Het
Mier2 C A 10: 79,540,501 (GRCm38) V197L unknown Het
Mill1 A T 7: 18,245,499 (GRCm38) probably benign Het
Mkln1 A C 6: 31,398,921 (GRCm38) K22T possibly damaging Het
Mkln1 G T 6: 31,451,554 (GRCm38) G273C probably damaging Het
Mkrn1 T A 6: 39,400,456 (GRCm38) N282Y probably null Het
Mkrn3 C T 7: 62,419,810 (GRCm38) G78R probably benign Het
Mmel1 C T 4: 154,895,208 (GRCm38) R762* probably null Het
Mmp10 G T 9: 7,508,205 (GRCm38) probably null Het
Mmp24 G A 2: 155,810,392 (GRCm38) G340E probably damaging Het
Mmp25 C G 17: 23,630,659 (GRCm38) C586S probably damaging Het
Mmp7 G C 9: 7,695,602 (GRCm38) G160A probably damaging Het
Mmrn1 C G 6: 60,945,034 (GRCm38) D158E probably benign Het
Mn1 C G 5: 111,420,379 (GRCm38) S738R probably benign Het
Mn1 A C 5: 111,454,706 (GRCm38) K1270T possibly damaging Het
Mnt C T 11: 74,836,675 (GRCm38) P129L probably damaging Het
Mnx1 C A 5: 29,474,174 (GRCm38) E304* probably null Het
Mnx1 C A 5: 29,474,088 (GRCm38) E332D unknown Het
Moap1 C G 12: 102,743,075 (GRCm38) E72Q probably damaging Het
Mocos A T 18: 24,670,633 (GRCm38) H337L probably benign Het
Mogs G T 6: 83,116,213 (GRCm38) G181W probably damaging Het
Mon1b G C 8: 113,637,809 (GRCm38) E73Q probably benign Het
Morc1 G T 16: 48,587,058 (GRCm38) V646L probably benign Het
Mpig6b C A 17: 35,065,340 (GRCm38) G158V probably damaging Het
Mpp3 G T 11: 102,008,356 (GRCm38) H419N probably damaging Het
Mprip A T 11: 59,759,484 (GRCm38) Q1338L probably benign Het
Mprip G T 11: 59,737,404 (GRCm38) G226W possibly damaging Het
Mpv17l G T 16: 13,940,829 (GRCm38) R39L probably benign Het
Mrc2 G C 11: 105,341,376 (GRCm38) W886S possibly damaging Het
Mrc2 G T 11: 105,347,360 (GRCm38) E1153* probably null Het
Mrgprd T A 7: 145,321,953 (GRCm38) L187H probably damaging Het
Mrgprx2 A C 7: 48,482,342 (GRCm38) F243V probably damaging Het
Mrpl37 C A 4: 107,057,426 (GRCm38) Q380H probably damaging Het
Mrpl39 C T 16: 84,723,972 (GRCm38) V260I probably benign Het
Mrpl45 G T 11: 97,321,559 (GRCm38) A121S probably benign Het
Mrps14 A C 1: 160,197,027 (GRCm38) M43L probably benign Het
Mrps24 T A 11: 5,704,538 (GRCm38) S139C possibly damaging Het
Mrvi1 C T 7: 110,923,999 (GRCm38) R79H probably benign Het
Ms4a6b A T 19: 11,529,486 (GRCm38) probably null Het
Ms4a8a G A 19: 11,070,760 (GRCm38) S202L possibly damaging Het
Msc A T 1: 14,755,239 (GRCm38) C39S unknown Het
Msi2 C A 11: 88,348,792 (GRCm38) G331C probably damaging Het
Msln G T 17: 25,753,794 (GRCm38) Q38K possibly damaging Het
Mss51 C T 14: 20,486,146 (GRCm38) probably null Het
Mtcl1 T C 17: 66,379,460 (GRCm38) E817G probably benign Het
Mtf2 G C 5: 108,087,944 (GRCm38) G163R probably damaging Het
Mtfr1l C G 4: 134,530,679 (GRCm38) probably null Het
Mthfd1 G A 12: 76,303,967 (GRCm38) G708R possibly damaging Het
Mtmr2 A C 9: 13,799,281 (GRCm38) E375D probably benign Het
Mtmr3 G C 11: 4,485,913 (GRCm38) A1098G probably damaging Het
Mtor G C 4: 148,550,130 (GRCm38) V2403L possibly damaging Het
Mtor A T 4: 148,550,125 (GRCm38) H2401L probably benign Het
Mttp C A 3: 138,104,779 (GRCm38) R625L probably benign Het
Mtus2 A G 5: 148,076,742 (GRCm38) K115R probably benign Het
Mtus2 G T 5: 148,077,258 (GRCm38) R287L probably benign Het
Muc13 T C 16: 33,815,850 (GRCm38) M568T possibly damaging Het
Muc13 A C 16: 33,799,087 (GRCm38) Q68H unknown Het
Muc2 T G 7: 141,746,714 (GRCm38) I258S Het
Muc4 G A 16: 32,768,730 (GRCm38) V754I possibly damaging Het
Muc5b C A 7: 141,842,705 (GRCm38) L185I unknown Het
Mug1 G A 6: 121,841,294 (GRCm38) M151I probably benign Het
Mug1 T G 6: 121,880,493 (GRCm38) F1059V probably damaging Het
Mup11 C A 4: 60,660,215 (GRCm38) M121I probably benign Het
Mup8 C A 4: 60,222,542 (GRCm38) probably benign Het
Mup8 T C 4: 60,222,378 (GRCm38) E31G probably benign Het
Mvb12b A T 2: 33,874,370 (GRCm38) S56T probably damaging Het
Mybl1 C A 1: 9,685,769 (GRCm38) R185L probably damaging Het
Mybpc1 G T 10: 88,560,327 (GRCm38) N205K probably benign Het
Mybpc2 A C 7: 44,521,696 (GRCm38) S144A probably benign Het
Mybpc3 C A 2: 91,120,403 (GRCm38) P192Q possibly damaging Het
Mycbp2 T A 14: 103,346,249 (GRCm38) Q90L probably benign Het
Mycbp2 C A 14: 103,156,637 (GRCm38) K2829N probably benign Het
Myf6 G T 10: 107,494,260 (GRCm38) H149N probably benign Het
Myh11 C A 16: 14,239,396 (GRCm38) A345S probably null Het
Myh11 T A 16: 14,277,775 (GRCm38) E41V Het
Myh13 T A 11: 67,329,295 (GRCm38) S157T possibly damaging Het
Myh14 G T 7: 44,608,515 (GRCm38) R1858S probably damaging Het
Myh14 A G 7: 44,638,309 (GRCm38) V592A probably damaging Het
Myh15 A C 16: 49,096,531 (GRCm38) S405R probably damaging Het
Myh3 G C 11: 67,082,415 (GRCm38) W113S possibly damaging Het
Myh4 G A 11: 67,256,271 (GRCm38) A1581T probably benign Het
Myh4 G T 11: 67,253,505 (GRCm38) D1234Y probably damaging Het
Myh4 G T 11: 67,248,641 (GRCm38) G595C probably damaging Het
Myh8 A C 11: 67,303,674 (GRCm38) Q1570H probably damaging Het
Mylk3 A T 8: 85,365,179 (GRCm38) Het
Myo15 G C 11: 60,488,258 (GRCm38) A232P Het
Myo15 G C 11: 60,498,403 (GRCm38) R873P Het
Myo15 G T 11: 60,524,441 (GRCm38) V3410L probably damaging Het
Myo15b A T 11: 115,887,925 (GRCm38) T2582S unknown Het
Myo15b C T 11: 115,883,452 (GRCm38) P339S possibly damaging Het
Myo18b A T 5: 112,809,738 (GRCm38) L1453Q possibly damaging Het
Myo18b C T 5: 112,762,721 (GRCm38) R1935H not run Het
Myo18b C A 5: 112,831,190 (GRCm38) G1186W probably damaging Het
Myo19 GCACACAC GCACAC 11: 84,909,350 (GRCm38) probably null Het
Myo19 G A 11: 84,885,278 (GRCm38) G30E probably benign Het
Myo1g C G 11: 6,519,045 (GRCm38) A86P probably damaging Het
Myo7a C G 7: 98,095,727 (GRCm38) R291P probably damaging Het
Myo7b C A 18: 31,980,998 (GRCm38) R1100L possibly damaging Het
Myo9a A C 9: 59,895,259 (GRCm38) T2010P probably damaging Het
Myoc G T 1: 162,639,636 (GRCm38) E125* probably null Het
Myoc G C 1: 162,649,154 (GRCm38) D476H probably damaging Het
Myom3 G T 4: 135,764,820 (GRCm38) V92L probably benign Het
Myot G T 18: 44,346,085 (GRCm38) M296I probably damaging Het
N4bp2l2 C A 5: 150,662,320 (GRCm38) R65L probably benign Het
Nab2 C A 10: 127,663,132 (GRCm38) E426* probably null Het
Nabp1 T A 1: 51,477,725 (GRCm38) probably benign Het
Nacad G T 11: 6,602,297 (GRCm38) S298Y probably damaging Het
Nagpa C G 16: 5,203,933 (GRCm38) G17A probably damaging Het
Naip2 A T 13: 100,161,909 (GRCm38) Y540N probably benign Het
Naip2 T G 13: 100,161,593 (GRCm38) E645A probably benign Het
Nanog G A 6: 122,713,231 (GRCm38) W198* probably null Het
Nars2 G T 7: 96,951,897 (GRCm38) D32Y probably benign Het
Nat2 A G 8: 67,501,264 (GRCm38) R9G probably damaging Het
Nat3 G T 8: 67,547,814 (GRCm38) S115I possibly damaging Het
Nat8f2 T C 6: 85,868,044 (GRCm38) E112G probably damaging Het
Nat8f5 T C 6: 85,817,685 (GRCm38) T98A probably benign Het
Nat8l C T 5: 33,996,811 (GRCm38) probably benign Het
Nav1 T A 1: 135,472,420 (GRCm38) S471C probably damaging Het
Nav1 C A 1: 135,452,886 (GRCm38) V1432L unknown Het
Nbas G T 12: 13,483,876 (GRCm38) Q1837H probably benign Het
Nbeal2 C A 9: 110,638,835 (GRCm38) M455I probably benign Het
Nbeal2 G C 9: 110,625,816 (GRCm38) Q2645E probably benign Het
Nbr1 G C 11: 101,572,554 (GRCm38) G616R probably benign Het
Ncdn C A 4: 126,750,151 (GRCm38) G293C probably damaging Het
Ncdn C A 4: 126,750,153 (GRCm38) C292F probably benign Het
Nckap1 A C 2: 80,540,508 (GRCm38) probably null Het
Nckap5 C T 1: 126,528,681 (GRCm38) probably null Het
Ncoa6 T A 2: 155,421,302 (GRCm38) Q404L probably damaging Het
Ncor1 C A 11: 62,438,516 (GRCm38) probably null Het
Ndc1 G C 4: 107,386,602 (GRCm38) A332P probably damaging Het
Ndfip2 G T 14: 105,258,709 (GRCm38) A13S probably benign Het
Ndn C A 7: 62,348,544 (GRCm38) P46Q probably benign Het
Ndst3 C A 3: 123,671,494 (GRCm38) L276F probably damaging Het
Ndst3 A C 3: 123,552,630 (GRCm38) F665C probably damaging Het
Ndst3 T G 3: 123,627,969 (GRCm38) K405T possibly damaging Het
Ndufa9 C A 6: 126,844,815 (GRCm38) G66C probably damaging Het
Ndufs1 C A 1: 63,163,836 (GRCm38) A190S probably damaging Het
Ndufs6 A G 13: 73,328,436 (GRCm38) V4A probably benign Het
Neb C G 2: 52,267,782 (GRCm38) W2271S probably benign Het
Neb C T 2: 52,279,631 (GRCm38) probably null Het
Nectin2 C A 7: 19,738,363 (GRCm38) V34L probably benign Het
Neil2 A C 14: 63,188,496 (GRCm38) F142V probably damaging Het
Nek11 G C 9: 105,293,669 (GRCm38) A389G probably benign Het
Nek2 G T 1: 191,827,239 (GRCm38) R285S probably benign Het
Nell1 C G 7: 50,560,882 (GRCm38) S377C unknown Het
Neu4 G T 1: 94,025,250 (GRCm38) G447V probably benign Het
Neurl1a C A 19: 47,239,873 (GRCm38) L53M probably damaging Het
Nfasc C A 1: 132,634,638 (GRCm38) R133L probably benign Het
Nfatc2 G A 2: 168,571,349 (GRCm38) Q139* probably null Het
Nfe2l2 T A 2: 75,679,164 (GRCm38) Q104L probably null Het
Nfkbil1 C A 17: 35,234,962 (GRCm38) Q109H probably benign Het
Nfkbil1 C A 17: 35,234,961 (GRCm38) G110C probably damaging Het
Nfxl1 T G 5: 72,538,150 (GRCm38) Q450H probably null Het
Nfyc C A 4: 120,790,487 (GRCm38) probably benign Het
Ngb C A 12: 87,098,429 (GRCm38) G151C probably damaging Het
Nhlrc4 C A 17: 25,943,744 (GRCm38) A10S possibly damaging Het
Nin T A 12: 70,049,164 (GRCm38) probably null Het
Nipbl G C 15: 8,338,699 (GRCm38) P1180A possibly damaging Het
Nipsnap3a G T 4: 52,997,216 (GRCm38) E161* probably null Het
Nkain2 C A 10: 32,402,271 (GRCm38) G53* probably null Het
Nkapl C G 13: 21,468,303 (GRCm38) G47R unknown Het
Nkx2-1 C A 12: 56,534,964 (GRCm38) G33C probably damaging Het
Nkx2-1 G T 12: 56,533,684 (GRCm38) P157H probably benign Het
Nle1 C A 11: 82,904,312 (GRCm38) D298Y probably damaging Het
Nlgn1 G T 3: 25,436,604 (GRCm38) L320I probably benign Het
Nlgn3 G T X: 101,317,982 (GRCm38) V300L probably benign Het
Nlgn3 T C X: 101,319,877 (GRCm38) L698P probably damaging Het
Nlk C G 11: 78,583,399 (GRCm38) G358A probably damaging Het
Nlrp12 T C 7: 3,222,537 (GRCm38) K1034R probably benign Het
Nlrp14 A G 7: 107,182,714 (GRCm38) T373A probably benign Het
Nlrp1b T G 11: 71,182,270 (GRCm38) K249T probably damaging Het
Nlrp6 T A 7: 140,922,721 (GRCm38) W247R probably damaging Het
Nlrp9a G T 7: 26,558,229 (GRCm38) W424L probably damaging Het
Nlrx1 A C 9: 44,256,923 (GRCm38) V559G possibly damaging Het
Nme9 G A 9: 99,470,795 (GRCm38) R266Q possibly damaging Het
Nmur2 T G 11: 56,027,101 (GRCm38) K354T probably benign Het
Nos3 C A 5: 24,377,654 (GRCm38) R627S probably benign Het
Notch3 A T 17: 32,141,516 (GRCm38) F1480L probably benign Het
Notch3 A T 17: 32,151,370 (GRCm38) C739S probably damaging Het
Nova2 G T 7: 18,958,449 (GRCm38) G501V unknown Het
Noxa1 T A 2: 25,090,273 (GRCm38) Q170L possibly damaging Het
Noxred1 A C 12: 87,223,057 (GRCm38) L300W probably damaging Het
Npas2 T A 1: 39,336,010 (GRCm38) S470T probably benign Het
Npas3 T C 12: 53,501,180 (GRCm38) L103P probably damaging Het
Npm1 C A 11: 33,160,831 (GRCm38) V117L probably benign Het
Npr2 A T 4: 43,650,720 (GRCm38) H1000L probably damaging Het
Nr1h4 G C 10: 89,498,350 (GRCm38) Y59* probably null Het
Nr2f2 C A 7: 70,357,778 (GRCm38) V319F probably damaging Het
Nr3c2 G A 8: 76,909,700 (GRCm38) V477M probably damaging Het
Nrap CTGTGTGT CTGTGT 19: 56,345,517 (GRCm38) probably null Het
Nrcam G T 12: 44,571,570 (GRCm38) R781L probably damaging Het
Nrg2 G T 18: 36,018,470 (GRCm38) P673H probably damaging Het
Nrg3 C G 14: 39,472,533 (GRCm38) V90L possibly damaging Het
Nrn1l G T 8: 105,894,416 (GRCm38) A47S probably damaging Het
Nrxn3 C A 12: 89,517,909 (GRCm38) A676E possibly damaging Het
Nrxn3 C A 12: 89,187,055 (GRCm38) S264* probably null Het
Nsd1 A T 13: 55,245,525 (GRCm38) Q416L probably damaging Het
Nsf C G 11: 103,910,554 (GRCm38) D212H probably damaging Het
Nsrp1 C A 11: 77,050,695 (GRCm38) Q62H probably damaging Het
Ntmt1 G C 2: 30,822,428 (GRCm38) G161A probably damaging Het
Ntn4 G C 10: 93,741,153 (GRCm38) R561P probably damaging Het
Ntrk2 A G 13: 58,874,333 (GRCm38) T401A probably benign Het
Nudt8 G T 19: 4,001,690 (GRCm38) R130S not run Het
Nufip2 G C 11: 77,741,791 (GRCm38) *711S probably null Het
Nup214 G T 2: 32,010,258 (GRCm38) R866S possibly damaging Het
Nup214 G T 2: 32,034,225 (GRCm38) E1589* probably null Het
Nwd1 T G 8: 72,672,300 (GRCm38) L696R not run Het
Nwd2 A G 5: 63,725,197 (GRCm38) Y64C probably damaging Het
Nwd2 C A 5: 63,806,157 (GRCm38) T1028K probably damaging Het
Oas1d T C 5: 120,914,914 (GRCm38) W11R probably benign Het
Obox2 C T 7: 15,397,196 (GRCm38) P76S possibly damaging Het
Obox3 C A 7: 15,626,224 (GRCm38) E173D probably benign Het
Obscn G T 11: 58,994,372 (GRCm38) A8020E unknown Het
Obscn T G 11: 59,038,807 (GRCm38) D5194A probably damaging Het
Obscn A T 11: 58,995,530 (GRCm38) Y7835N unknown Het
Obscn G T 11: 59,049,725 (GRCm38) N4614K probably benign Het
Obscn G T 11: 59,040,347 (GRCm38) A5018E probably benign Het
Obscn G C 11: 59,136,286 (GRCm38) C30W probably benign Het
Obscn A G 11: 59,082,823 (GRCm38) I1894T probably benign Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Olfm4 T G 14: 80,021,219 (GRCm38) D302E probably benign Het
Olfr1015 T C 2: 85,786,120 (GRCm38) V203A probably damaging Het
Olfr1018 G A 2: 85,823,021 (GRCm38) G17R probably damaging Het
Olfr1025-ps1 C A 2: 85,918,501 (GRCm38) T192N probably damaging Het
Olfr1048 C T 2: 86,236,458 (GRCm38) A119T probably damaging Het
Olfr1052 T C 2: 86,298,226 (GRCm38) S137P probably damaging Het
Olfr1054 A T 2: 86,332,706 (GRCm38) Y217N probably damaging Het
Olfr1055 G T 2: 86,346,883 (GRCm38) N294K possibly damaging Het
Olfr1057 G C 2: 86,375,115 (GRCm38) T99R possibly damaging Het
Olfr1061 T A 2: 86,413,528 (GRCm38) S175C probably damaging Het
Olfr1062 G C 2: 86,423,374 (GRCm38) L101V probably benign Het
Olfr109 T A 17: 37,466,661 (GRCm38) F152I possibly damaging Het
Olfr1095 T G 2: 86,850,940 (GRCm38) S253R Het
Olfr1102 T A 2: 87,002,610 (GRCm38) C214S probably benign Het
Olfr1102 G T 2: 87,002,611 (GRCm38) C214F probably benign Het
Olfr1105 G T 2: 87,033,487 (GRCm38) L245I probably damaging Het
Olfr1109 G T 2: 87,093,224 (GRCm38) P58T possibly damaging Het
Olfr1128 A C 2: 87,544,621 (GRCm38) L308V probably benign Het
Olfr1130 C T 2: 87,607,754 (GRCm38) A122V probably benign Het
Olfr1131 T A 2: 87,629,315 (GRCm38) L168Q probably damaging Het
Olfr1136 G T 2: 87,693,151 (GRCm38) H244N probably damaging Het
Olfr1155 T G 2: 87,943,467 (GRCm38) N54H probably damaging Het
Olfr1155 G T 2: 87,943,209 (GRCm38) Q140K possibly damaging Het
Olfr1160 A C 2: 88,006,437 (GRCm38) C105G probably damaging Het
Olfr1164 A T 2: 88,093,334 (GRCm38) C201S probably damaging Het
Olfr1168 T C 2: 88,185,071 (GRCm38) S65P probably damaging Het
Olfr1178 C A 2: 88,392,033 (GRCm38) T262K probably damaging Het
Olfr1179 G C 2: 88,402,122 (GRCm38) L271V probably damaging Het
Olfr1180 G T 2: 88,411,986 (GRCm38) P224H probably damaging Het
Olfr1183 C A 2: 88,462,114 (GRCm38) P277Q probably damaging Het
Olfr1199 T G 2: 88,755,797 (GRCm38) K293Q probably damaging Het
Olfr1205 T A 2: 88,831,578 (GRCm38) S154T probably damaging Het
Olfr1208 A T 2: 88,897,061 (GRCm38) F179I probably damaging Het
Olfr121 G T 17: 37,752,767 (GRCm38) K304N probably damaging Het
Olfr1217 T G 2: 89,023,896 (GRCm38) T36P probably damaging Het
Olfr1217 A T 2: 89,023,795 (GRCm38) D69E possibly damaging Het
Olfr1219 C A 2: 89,074,438 (GRCm38) G218C probably benign Het
Olfr1224-ps1 A G 2: 89,156,467 (GRCm38) L236P probably damaging Het
Olfr1229 C A 2: 89,282,537 (GRCm38) V199F probably benign Het
Olfr1229 TGGG TGGGG 2: 89,282,897 (GRCm38) probably null Het
Olfr1230 C T 2: 89,296,953 (GRCm38) G106S probably damaging Het
Olfr1262 T A 2: 90,003,048 (GRCm38) V214E probably damaging Het
Olfr1287 C A 2: 111,449,784 (GRCm38) L215M probably damaging Het
Olfr1290 A G 2: 111,489,877 (GRCm38) F94L probably damaging Het
Olfr1294 C A 2: 111,538,285 (GRCm38) M1I probably null Het
Olfr1297 A G 2: 111,621,261 (GRCm38) L271P probably damaging Het
Olfr1300-ps1 T A 2: 111,692,429 (GRCm38) F304I unknown Het
Olfr1303 C A 2: 111,814,034 (GRCm38) G231C probably benign Het
Olfr1309 A C 2: 111,983,753 (GRCm38) V107G probably benign Het
Olfr1310 T A 2: 112,008,457 (GRCm38) H243L probably damaging Het
Olfr1328 T G 4: 118,933,918 (GRCm38) H310P probably benign Het
Olfr1329 C T 4: 118,917,027 (GRCm38) G147R probably benign Het
Olfr1329 T G 4: 118,917,135 (GRCm38) T111P probably damaging Het
Olfr1333 G T 4: 118,830,050 (GRCm38) P129Q probably damaging Het
Olfr1340 A G 4: 118,727,141 (GRCm38) K298R probably damaging Het
Olfr1342 G T 4: 118,690,272 (GRCm38) T60K probably benign Het
Olfr1347 G T 7: 6,488,698 (GRCm38) L52I probably damaging Het
Olfr1347 A T 7: 6,488,692 (GRCm38) C54S probably benign Het
Olfr1350 C A 7: 6,570,048 (GRCm38) P19H probably damaging Het
Olfr1351 G C 10: 79,018,205 (GRCm38) R294S probably damaging Het
Olfr1356 T A 10: 78,847,021 (GRCm38) Q298L possibly damaging Het
Olfr1357 T G 10: 78,612,056 (GRCm38) N195T probably damaging Het
Olfr136 A C 17: 38,335,352 (GRCm38) N65T probably damaging Het
Olfr1369-ps1 A T 13: 21,116,601 (GRCm38) K303I probably damaging Het
Olfr1375 T G 11: 51,048,835 (GRCm38) C243G probably damaging Het
Olfr1382 C G 11: 49,535,253 (GRCm38) L23V probably damaging Het
Olfr1385 G C 11: 49,495,067 (GRCm38) C178S probably damaging Het
Olfr140 G T 2: 90,052,265 (GRCm38) Q20K probably benign Het
Olfr1410 G T 1: 92,607,751 (GRCm38) probably benign Het
Olfr1425 G T 19: 12,073,910 (GRCm38) H241N probably damaging Het
Olfr1425 G T 19: 12,073,840 (GRCm38) P264H probably damaging Het
Olfr143 G T 9: 38,253,852 (GRCm38) C142F probably benign Het
Olfr1437 T G 19: 12,322,267 (GRCm38) N187H possibly damaging Het
Olfr1442 C A 19: 12,674,310 (GRCm38) T35N probably benign Het
Olfr1454 A T 19: 13,063,646 (GRCm38) K78N probably benign Het
Olfr1467 G C 19: 13,364,916 (GRCm38) C96S probably damaging Het
Olfr1467 T G 19: 13,364,915 (GRCm38) C96G probably damaging Het
Olfr1487 T G 19: 13,619,662 (GRCm38) F124V probably damaging Het
Olfr1490 C A 19: 13,654,463 (GRCm38) H11Q probably benign Het
Olfr1491 C G 19: 13,705,203 (GRCm38) D125E probably damaging Het
Olfr1500 G T 19: 13,827,899 (GRCm38) L166I probably damaging Het
Olfr152 C A 2: 87,783,024 (GRCm38) H161Q probably damaging Het
Olfr159 A C 4: 43,770,267 (GRCm38) V248G probably damaging Het
Olfr161 T A 16: 3,592,540 (GRCm38) L48Q probably damaging Het
Olfr161 G A 16: 3,593,133 (GRCm38) A246T probably benign Het
Olfr165 T A 16: 19,407,735 (GRCm38) M94L probably benign Het
Olfr173 G C 16: 58,797,673 (GRCm38) P58A probably damaging Het
Olfr173 C A 16: 58,797,423 (GRCm38) C141F probably damaging Het
Olfr175-ps1 GT GTT 16: 58,824,307 (GRCm38) probably null Het
Olfr197 C A 16: 59,186,485 (GRCm38) probably benign Het
Olfr203 G T 16: 59,303,169 (GRCm38) R5S probably benign Het
Olfr211 T C 6: 116,494,376 (GRCm38) Y256H probably damaging Het
Olfr218 C A 1: 173,203,797 (GRCm38) S147Y probably benign Het
Olfr266 C G 3: 106,822,043 (GRCm38) C172S probably damaging Het
Olfr301 T G 7: 86,412,698 (GRCm38) F112C probably benign Het
Olfr310 G A 7: 86,268,947 (GRCm38) P281S probably damaging Het
Olfr354 C A 2: 36,907,701 (GRCm38) L252I possibly damaging Het
Olfr361 C G 2: 37,085,636 (GRCm38) M37I probably benign Het
Olfr362 G A 2: 37,105,636 (GRCm38) P5S probably benign Het
Olfr387-ps1 C A 11: 73,664,774 (GRCm38) T55K not run Het
Olfr397 TC T 11: 73,965,297 (GRCm38) probably null Het
Olfr404-ps1 T A 11: 74,239,747 (GRCm38) F61Y probably damaging Het
Olfr404-ps1 G A 11: 74,240,120 (GRCm38) M185I possibly damaging Het
Olfr404-ps1 T G 11: 74,240,203 (GRCm38) L213R probably damaging Het
Olfr414 C G 1: 174,430,591 (GRCm38) S54R probably benign Het
Olfr430 A T 1: 174,069,331 (GRCm38) E11V probably damaging Het
Olfr430 G T 1: 174,069,514 (GRCm38) W72L probably damaging Het
Olfr444 A C 6: 42,955,690 (GRCm38) H64P probably damaging Het
Olfr444 G C 6: 42,956,298 (GRCm38) E267Q probably benign Het
Olfr449 T C 6: 42,837,977 (GRCm38) L32P probably damaging Het
Olfr469 C T 7: 107,822,993 (GRCm38) A159T probably benign Het
Olfr472 T G 7: 107,903,058 (GRCm38) L114V probably damaging Het
Olfr478 T C 7: 108,031,446 (GRCm38) E299G probably damaging Het
Olfr482 C A 7: 108,094,994 (GRCm38) C192F probably damaging Het
Olfr484 G T 7: 108,124,879 (GRCm38) A128E probably damaging Het
Olfr498 T A 7: 108,465,371 (GRCm38) F16I probably benign Het
Olfr509 T A 7: 108,645,767 (GRCm38) T270S possibly damaging Het
Olfr560 C G 7: 102,753,416 (GRCm38) C171S possibly damaging Het
Olfr560 T A 7: 102,753,414 (GRCm38) S172C probably benign Het
Olfr577 C T 7: 102,973,309 (GRCm38) V228I not run Het
Olfr62 A C 4: 118,665,826 (GRCm38) Q103P probably damaging Het
Olfr625-ps1 A T 7: 103,683,105 (GRCm38) Y129F probably benign Het
Olfr628 T C 7: 103,732,781 (GRCm38) L285P probably damaging Het
Olfr631 G A 7: 103,929,777 (GRCm38) W318* probably null Het
Olfr642 T A 7: 104,050,273 (GRCm38) H27L probably benign Het
Olfr67 C A 7: 103,787,453 (GRCm38) V275F probably benign Het
Olfr675 G T 7: 105,024,099 (GRCm38) P294T probably damaging Het
Olfr681 C A 7: 105,122,120 (GRCm38) S221Y probably damaging Het
Olfr681 T A 7: 105,122,122 (GRCm38) Y222N probably damaging Het
Olfr688 T A 7: 105,288,722 (GRCm38) W210R probably damaging Het
Olfr716 G T 7: 107,148,155 (GRCm38) V280L probably benign Het
Olfr721-ps1 G T 14: 14,407,732 (GRCm38) C168F probably damaging Het
Olfr742 C G 14: 50,516,065 (GRCm38) P287R probably damaging Het
Olfr780 G A 10: 129,322,219 (GRCm38) G199S probably benign Het
Olfr788 T A 10: 129,473,615 (GRCm38) S308T probably benign Het
Olfr794 G T 10: 129,571,236 (GRCm38) E194* probably null Het
Olfr796 G T 10: 129,608,103 (GRCm38) A126D probably damaging Het
Olfr8 A T 10: 78,955,219 (GRCm38) N5Y probably damaging Het
Olfr807 A G 10: 129,754,688 (GRCm38) F254S probably damaging Het
Olfr807 C A 10: 129,754,824 (GRCm38) A209S possibly damaging Het
Olfr809 A T 10: 129,776,042 (GRCm38) I43F probably damaging Het
Olfr822 G T 10: 130,075,104 (GRCm38) Q231H probably benign Het
Olfr826 A C 10: 130,179,965 (GRCm38) L305R possibly damaging Het
Olfr828 AGG AG 9: 18,815,980 (GRCm38) probably null Het
Olfr854 T A 9: 19,566,526 (GRCm38) Q286L probably damaging Het
Olfr871 G T 9: 20,212,844 (GRCm38) R165L possibly damaging Het
Olfr890 G A 9: 38,143,431 (GRCm38) A94T probably benign Het
Olfr912 G T 9: 38,581,885 (GRCm38) G203W probably damaging Het
Olfr919 C T 9: 38,697,928 (GRCm38) G146D possibly damaging Het
Olfr936 T G 9: 39,046,919 (GRCm38) T167P probably damaging Het
Olfr969 C A 9: 39,795,929 (GRCm38) L185M possibly damaging Het
Olfr970 A T 9: 39,820,355 (GRCm38) S239C probably damaging Het
Olfr987 C T 2: 85,331,893 (GRCm38) E2K probably benign Het
Olfr99 A T 17: 37,279,674 (GRCm38) Y249N probably damaging Het
Olfr993 C G 2: 85,414,663 (GRCm38) C72S probably damaging Het
Olfr993 G C 2: 85,414,685 (GRCm38) H65D possibly damaging Het
Omt2b T A 9: 78,329,330 (GRCm38) W113R probably damaging Het
Oog1 G C 12: 87,608,364 (GRCm38) E427D probably damaging Het
Opn1sw C G 6: 29,379,456 (GRCm38) G183A probably damaging Het
Oprk1 G A 1: 5,602,702 (GRCm38) R354H probably benign Het
Osbpl7 G A 11: 97,060,153 (GRCm38) G609S probably damaging Het
Otof G T 5: 30,371,586 (GRCm38) A1826E probably damaging Het
Otogl C T 10: 107,777,213 (GRCm38) R2046H probably benign Het
Otogl A T 10: 107,778,873 (GRCm38) C1973S probably damaging Het
Otogl G T 10: 107,789,032 (GRCm38) H1582N probably benign Het
Otop3 T A 11: 115,339,844 (GRCm38) L147Q probably damaging Het
Otop3 C G 11: 115,341,012 (GRCm38) H234Q probably damaging Het
Otud4 C T 8: 79,658,929 (GRCm38) T217I probably benign Het
Otud6a C A X: 100,429,391 (GRCm38) R127S possibly damaging Het
Otud7a G T 7: 63,758,700 (GRCm38) R917L unknown Het
Oxct2a G T 4: 123,322,538 (GRCm38) P350Q probably damaging Het
Oxtr T A 6: 112,489,695 (GRCm38) N35Y probably damaging Het
P2rx6 G C 16: 17,568,055 (GRCm38) D223H probably damaging Het
P2ry14 A C 3: 59,115,737 (GRCm38) F101V probably damaging Het
P2ry4 G A X: 100,593,321 (GRCm38) R324C probably benign Het
Pabpc4 G A 4: 123,295,274 (GRCm38) G469D probably benign Het
Padi3 G T 4: 140,795,671 (GRCm38) A330E possibly damaging Het
Padi3 A G 4: 140,798,123 (GRCm38) L193P not run Het
Pafah1b1 C A 11: 74,689,119 (GRCm38) G86V probably benign Het
Pafah1b1 T G 11: 74,690,241 (GRCm38) K54T probably damaging Het
Pak7 A C 2: 136,083,246 (GRCm38) L712R probably damaging Het
Pam C A 1: 97,934,723 (GRCm38) R99L probably benign Het
Pam16 C A 16: 4,624,906 (GRCm38) probably benign Het
Pappa2 C G 1: 158,814,814 (GRCm38) G1287A probably damaging Het
Pappa2 A C 1: 158,956,933 (GRCm38) I169S probably benign Het
Pappa2 A T 1: 158,814,816 (GRCm38) D1286E probably damaging Het
Paqr8 G T 1: 20,934,798 (GRCm38) G59W probably damaging Het
Paqr9 G C 9: 95,560,306 (GRCm38) W116C possibly damaging Het
Pard3b G T 1: 62,238,892 (GRCm38) V694L probably benign Het
Patj C T 4: 98,611,130 (GRCm38) S1347L probably benign Het
Patj A T 4: 98,676,318 (GRCm38) K1636* probably null Het
Pax3 C A 1: 78,122,590 (GRCm38) probably null Het
Pax5 C A 4: 44,697,678 (GRCm38) G19V probably damaging Het
Paxip1 C T 5: 27,783,729 (GRCm38) probably null Het
Pcdh1 C A 18: 38,198,688 (GRCm38) V560L possibly damaging Het
Pcdh15 G A 10: 74,630,701 (GRCm38) D1517N probably benign Het
Pcdh19 C T X: 133,682,092 (GRCm38) R763K probably null Het
Pcdh8 G A 14: 79,769,077 (GRCm38) P682L probably benign Het
Pcdha7 G C 18: 36,975,840 (GRCm38) E639D probably benign Het
Pcdhb10 AC A 18: 37,413,395 (GRCm38) probably null Het
Pcdhb13 C A 18: 37,443,235 (GRCm38) S222* probably null Het
Pcdhb16 C A 18: 37,479,160 (GRCm38) P391H probably damaging Het
Pcdhgb1 A T 18: 37,681,840 (GRCm38) Q461H probably benign Het
Pcgf2 T G 11: 97,690,021 (GRCm38) K332T probably damaging Het
Pck2 G T 14: 55,545,269 (GRCm38) A387S probably benign Het
Pclo C A 5: 14,681,516 (GRCm38) S218Y possibly damaging Het
Pclo G C 5: 14,681,779 (GRCm38) E306Q Het
Pclo C A 5: 14,712,648 (GRCm38) Q427K probably damaging Het
Pcna-ps2 G T 19: 9,284,112 (GRCm38) G245V probably damaging Het
Pcnt C A 10: 76,382,157 (GRCm38) E2095* probably null Het
Pcnx2 A C 8: 125,838,014 (GRCm38) L1047V probably benign Het
Pcnx2 G A 8: 125,761,654 (GRCm38) P1717L probably damaging Het
Pcnx3 T A 19: 5,687,220 (GRCm38) probably null Het
Pcolce2 G C 9: 95,637,836 (GRCm38) A15P possibly damaging Het
Pcsk1 A T 13: 75,098,042 (GRCm38) N180Y probably damaging Het
Pcsk4 G T 10: 80,322,726 (GRCm38) T564K possibly damaging Het
Pcsk9 G T 4: 106,458,941 (GRCm38) Q102K probably damaging Het
Pcx G T 19: 4,619,073 (GRCm38) V701L possibly damaging Het
Pcyt2 C G 11: 120,614,373 (GRCm38) G122A probably damaging Het
Pde11a C T 2: 76,194,905 (GRCm38) A451T probably benign Het
Pde1a G T 2: 79,906,028 (GRCm38) S87R probably damaging Het
Pde6c G T 19: 38,132,881 (GRCm38) probably benign Het
Pdk2 A C 11: 95,027,918 (GRCm38) L344V probably damaging Het
Pdk4 G T 6: 5,487,170 (GRCm38) S292Y probably damaging Het
Pds5a G C 5: 65,659,727 (GRCm38) S177R possibly damaging Het
Pdxdc1 C A 16: 13,903,043 (GRCm38) probably benign Het
Pdxk T G 10: 78,441,188 (GRCm38) T259P probably damaging Het
Pdzk1 A G 3: 96,854,557 (GRCm38) N162D probably benign Het
Pdzrn3 T A 6: 101,151,999 (GRCm38) S569C probably damaging Het
Pdzrn4 G A 15: 92,396,957 (GRCm38) A15T probably benign Het
Peg10 T TCCC 6: 4,756,451 (GRCm38) probably benign Het
Peli3 C A 19: 4,934,967 (GRCm38) R172L probably benign Het
Penk G T 4: 4,138,106 (GRCm38) A13E probably damaging Het
Per2 T A 1: 91,421,493 (GRCm38) N1052I possibly damaging Het
Pfas C T 11: 69,002,487 (GRCm38) G91R probably damaging Het
Pfas T C 11: 68,990,070 (GRCm38) M198V Het
Pfkl C A 10: 78,000,136 (GRCm38) G213W probably damaging Het
Pfpl G T 19: 12,429,941 (GRCm38) E519* probably null Het
Pga5 T C 19: 10,669,159 (GRCm38) T372A probably damaging Het
Pgc C G 17: 47,728,868 (GRCm38) Y62* probably null Het
Pgd C A 4: 149,166,679 (GRCm38) probably benign Het
Pglyrp3 A T 3: 92,028,085 (GRCm38) H214L probably damaging Het
Pglyrp4 A G 3: 90,739,005 (GRCm38) Q282R probably damaging Het
Pgm2 C T 4: 99,978,997 (GRCm38) T444I probably damaging Het
Pgm2l1 G T 7: 100,270,455 (GRCm38) G586V possibly damaging Het
Phactr3 C A 2: 178,269,374 (GRCm38) P139Q probably damaging Het
Phax G T 18: 56,586,952 (GRCm38) G322W probably damaging Het
Phc3 C G 3: 30,936,597 (GRCm38) M478I probably benign Het
Phf2 T A 13: 48,807,707 (GRCm38) T836S unknown Het
Phldb2 C A 16: 45,825,826 (GRCm38) A86S probably benign Het
Phldb2 T A 16: 45,953,508 (GRCm38) probably benign Het
Phldb2 C A 16: 45,825,827 (GRCm38) L85F probably benign Het
Phrf1 G T 7: 141,258,818 (GRCm38) R642L unknown Het
Phrf1 G C 7: 141,243,883 (GRCm38) G46R unknown Het
Picalm A T 7: 90,196,967 (GRCm38) S639C probably damaging Het
Pidd1 T A 7: 141,440,361 (GRCm38) S551C probably benign Het
Pigb C G 9: 73,034,572 (GRCm38) G135A probably benign Het
Pigr A C 1: 130,850,815 (GRCm38) E745D possibly damaging Het
Pigx T G 16: 32,087,425 (GRCm38) Q130P probably benign Het
Pik3c2b C A 1: 133,066,553 (GRCm38) S85Y probably damaging Het
Pik3c2b G T 1: 133,099,686 (GRCm38) E1308* probably null Het
Pik3cd TG T 4: 149,654,847 (GRCm38) probably null Het
Pik3cg T C 12: 32,204,795 (GRCm38) R398G probably damaging Het
Pik3r6 G T 11: 68,544,765 (GRCm38) A614S probably benign Het
Pik3r6 G A 11: 68,520,200 (GRCm38) probably benign Het
Pja2 C A 17: 64,292,869 (GRCm38) S540I probably damaging Het
Pkd1l1 C A 11: 8,826,801 (GRCm38) G2513C Het
Pkd1l2 G C 8: 117,054,914 (GRCm38) C797W probably damaging Het
Pkd1l3 C A 8: 109,623,242 (GRCm38) P240T unknown Het
Pkd2 G A 5: 104,460,049 (GRCm38) G138E probably benign Het
Pkd2l1 G T 19: 44,149,271 (GRCm38) T708K probably benign Het
Pkhd1 A C 1: 20,523,747 (GRCm38) F1381V possibly damaging Het
Pklr C G 3: 89,144,855 (GRCm38) P489R probably damaging Het
Pkn1 C T 8: 83,673,497 (GRCm38) R632Q probably damaging Het
Pkp2 T C 16: 16,230,700 (GRCm38) V323A probably benign Het
Pkp4 G C 2: 59,342,244 (GRCm38) probably null Het
Pla2g7 C G 17: 43,602,919 (GRCm38) A251G probably benign Het
Plagl1 A G 10: 13,128,716 (GRCm38) Q576R unknown Het
Plau A C 14: 20,839,481 (GRCm38) S205R probably damaging Het
Plcb2 T A 2: 118,723,128 (GRCm38) K171N probably damaging Het
Plcd4 C A 1: 74,557,792 (GRCm38) H398N probably damaging Het
Plcd4 T A 1: 74,548,126 (GRCm38) L15Q probably benign Het
Plce1 A G 19: 38,769,460 (GRCm38) H1959R probably damaging Het
Plce1 G T 19: 38,724,980 (GRCm38) E1231* probably null Het
Plce1 C T 19: 38,701,894 (GRCm38) A674V probably damaging Het
Plcg1 A T 2: 160,758,127 (GRCm38) R936W probably damaging Het
Plcl1 C T 1: 55,751,284 (GRCm38) Q1038* probably null Het
Plcl1 G A 1: 55,696,040 (GRCm38) G180D probably benign Het
Plcl2 T G 17: 50,608,456 (GRCm38) V831G probably damaging Het
Plcz1 C G 6: 140,013,676 (GRCm38) V252L possibly damaging Het
Pld1 A T 3: 28,131,577 (GRCm38) K984* probably null Het
Pld1 T C 3: 28,076,533 (GRCm38) L494P probably damaging Het
Pld6 G C 11: 59,787,438 (GRCm38) C66W probably damaging Het
Plekha6 G T 1: 133,272,471 (GRCm38) G263W probably damaging Het
Plekha6 G T 1: 133,263,813 (GRCm38) R40L probably benign Het
Plekhg3 G T 12: 76,575,856 (GRCm38) probably null Het
Plekhn1 C G 4: 156,223,431 (GRCm38) G346A possibly damaging Het
Plekho1 C G 3: 95,995,715 (GRCm38) G3A unknown Het
Plg A C 17: 12,414,185 (GRCm38) T678P probably benign Het
Plk1 C T 7: 122,167,650 (GRCm38) R364W not run Het
Plod1 C A 4: 147,923,200 (GRCm38) G342C probably damaging Het
Plppr4 T C 3: 117,322,849 (GRCm38) K453R probably damaging Het
Plxdc2 G A 2: 16,565,403 (GRCm38) G180E possibly damaging Het
Plxna1 C A 6: 89,321,052 (GRCm38) W1748L probably damaging Het
Plxna3 G T X: 74,336,020 (GRCm38) W788C probably damaging Het
Plxnb3 T A X: 73,759,165 (GRCm38) V213E probably damaging Het
Plxnc1 G T 10: 94,865,029 (GRCm38) P598T probably benign Het
Pm20d1 G T 1: 131,797,558 (GRCm38) E47D possibly damaging Het
Pmch T C 10: 88,091,833 (GRCm38) I132T not run Het
Pmfbp1 T A 8: 109,531,751 (GRCm38) L649Q probably damaging Het
Pnisr C G 4: 21,873,684 (GRCm38) R476G probably benign Het
Pnmal2 C A 7: 16,946,810 (GRCm38) A573D possibly damaging Het
Pnpla8 CAGA CA 12: 44,295,990 (GRCm38) probably null Het
Pnpt1 C T 11: 29,145,475 (GRCm38) S408L probably benign Het
Pnpt1 G A 11: 29,145,477 (GRCm38) D409N possibly damaging Het
Poc5 G T 13: 96,401,722 (GRCm38) Q298H probably benign Het
Podxl T A 6: 31,528,634 (GRCm38) K158M probably damaging Het
Pola1 T G X: 93,480,604 (GRCm38) T1144P probably damaging Het
Pold1 G A 7: 44,542,232 (GRCm38) P110L probably benign Het
Pold1 C A 7: 44,541,780 (GRCm38) R209L probably benign Het
Pold4 G T 19: 4,232,172 (GRCm38) E27D probably benign Het
Polg G T 7: 79,453,741 (GRCm38) A960D probably damaging Het
Polg2 C A 11: 106,773,429 (GRCm38) V357F probably damaging Het
Polq G T 16: 37,042,257 (GRCm38) probably null Het
Polr2b A C 5: 77,331,971 (GRCm38) K524Q probably damaging Het
Pom121l12 C A 11: 14,599,639 (GRCm38) A115E probably damaging Het
Pom121l12 C A 11: 14,599,681 (GRCm38) T129K probably damaging Het
Pop7 C A 5: 137,502,187 (GRCm38) probably benign Het
Poteg G T 8: 27,447,954 (GRCm38) R46I possibly damaging Het
Pou5f2 G C 13: 78,025,097 (GRCm38) V53L probably benign Het
Pou6f2 T C 13: 18,378,635 (GRCm38) Q38R unknown Het
Ppfia2 A T 10: 106,474,645 (GRCm38) E4D probably damaging Het
Ppfia4 C A 1: 134,327,379 (GRCm38) R246L probably benign Het
Ppia G T 11: 6,419,600 (GRCm38) G162V possibly damaging Het
Ppip5k1 A C 2: 121,337,866 (GRCm38) L685R probably damaging Het
Ppl A T 16: 5,106,778 (GRCm38) L141Q probably damaging Het
Ppm1b G T 17: 84,994,265 (GRCm38) R191L probably damaging Het
Ppm1d G C 11: 85,339,573 (GRCm38) C339S probably benign Het
Ppm1g T A 5: 31,220,436 (GRCm38) probably benign Het
Ppm1n C A 7: 19,279,245 (GRCm38) E260D probably damaging Het
Ppp1r26 G T 2: 28,452,847 (GRCm38) G830W probably damaging Het
Ppp1r7 C A 1: 93,354,354 (GRCm38) T209N possibly damaging Het
Ppp2r1b AGGG AGG 9: 50,873,645 (GRCm38) probably null Het
Ppp2r2c C G 5: 36,931,277 (GRCm38) S163R probably benign Het
Ppp2r3a C G 9: 101,126,389 (GRCm38) A427P possibly damaging Het
Ppp4r1 G A 17: 65,838,926 (GRCm38) A887T probably damaging Het
Pramef25 C A 4: 143,950,123 (GRCm38) G137V probably benign Het
Pramef6 T A 4: 143,895,684 (GRCm38) Q367L probably damaging Het
Pramel4 G T 4: 144,068,521 (GRCm38) G496W unknown Het
Pramel5 G T 4: 144,273,860 (GRCm38) R49S probably benign Het
Pramel6 G T 2: 87,508,722 (GRCm38) V89L probably benign Het
Prc1 C G 7: 80,306,485 (GRCm38) S311R probably damaging Het
Prcd