Incidental Mutation 'R0650:Krt18'
ID 62234
Institutional Source Beutler Lab
Gene Symbol Krt18
Ensembl Gene ENSMUSG00000023043
Gene Name keratin 18
Synonyms Endo B, K18, CK18, Krt1-18
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0650 (G1)
Quality Score 196
Status Validated
Chromosome 15
Chromosomal Location 102028180-102032027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102029485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000023803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023803]
AlphaFold P05784
Predicted Effect possibly damaging
Transcript: ENSMUST00000023803
AA Change: D139G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023803
Gene: ENSMUSG00000023043
AA Change: D139G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 30 68 N/A INTRINSIC
Filament 71 384 3.69e-166 SMART
Meta Mutation Damage Score 0.1747 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable, fertile, and live normal life spans. They do, however, develop hepatomegaly by 18 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Krt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Krt18 APN 15 102030922 missense probably benign 0.07
IGL02666:Krt18 APN 15 102029867 missense probably damaging 1.00
PIT4378001:Krt18 UTSW 15 102029923 missense probably benign 0.20
R0077:Krt18 UTSW 15 102030974 missense probably benign 0.01
R0651:Krt18 UTSW 15 102029485 missense possibly damaging 0.60
R0947:Krt18 UTSW 15 102030728 missense possibly damaging 0.57
R1015:Krt18 UTSW 15 102031300 missense probably benign 0.00
R1219:Krt18 UTSW 15 102031288 splice site probably benign
R1328:Krt18 UTSW 15 102030734 missense probably benign 0.00
R2051:Krt18 UTSW 15 102029500 missense probably benign 0.19
R2082:Krt18 UTSW 15 102031020 splice site probably null
R3735:Krt18 UTSW 15 102028501 missense probably benign 0.39
R4696:Krt18 UTSW 15 102031858 missense probably benign 0.12
R5211:Krt18 UTSW 15 102031453 missense probably damaging 0.97
R5320:Krt18 UTSW 15 102028520 missense probably damaging 0.99
R5805:Krt18 UTSW 15 102031300 missense probably benign 0.40
R6736:Krt18 UTSW 15 102030769 missense probably benign 0.38
R7221:Krt18 UTSW 15 102029532 missense possibly damaging 0.66
R7543:Krt18 UTSW 15 102031461 missense probably damaging 0.99
R7873:Krt18 UTSW 15 102030956 missense probably benign 0.06
R7883:Krt18 UTSW 15 102028450 missense possibly damaging 0.63
R8837:Krt18 UTSW 15 102029830 missense possibly damaging 0.50
R8988:Krt18 UTSW 15 102029527 missense probably damaging 1.00
R8998:Krt18 UTSW 15 102031439 missense probably damaging 0.99
R8999:Krt18 UTSW 15 102031439 missense probably damaging 0.99
X0064:Krt18 UTSW 15 102029962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATACACGCCTCTGACTGTTCCTG -3'
(R):5'- CGTTTGCTTAAACTGGGCTGCAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacaca -3'
(R):5'- CTTAAACTGGGCTGCACAGATG -3'
Posted On 2013-07-30