Incidental Mutation 'R0650:Synpo'
ID 62241
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Name synaptopodin
Synonyms 9030217H17Rik, 9330140I15Rik
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock # R0650 (G1)
Quality Score 178
Status Validated
Chromosome 18
Chromosomal Location 60593973-60660142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60602340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 845 (N845D)
Ref Sequence ENSEMBL: ENSMUSP00000115355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000123288] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
AlphaFold Q8CC35
Predicted Effect probably benign
Transcript: ENSMUST00000097566
AA Change: N606D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079
AA Change: N606D

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115318
AA Change: N606D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079
AA Change: N606D

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128528
Predicted Effect probably benign
Transcript: ENSMUST00000130044
AA Change: N606D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079
AA Change: N606D

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130360
AA Change: N845D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: N845D

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137894
Predicted Effect probably benign
Transcript: ENSMUST00000143275
AA Change: N845D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079
AA Change: N845D

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155195
AA Change: N606D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079
AA Change: N606D

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160395
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60604077 missense probably damaging 1.00
IGL00976:Synpo APN 18 60603419 missense possibly damaging 0.74
IGL01808:Synpo APN 18 60602208 missense probably benign 0.01
IGL02116:Synpo APN 18 60603456 missense probably damaging 1.00
IGL02444:Synpo APN 18 60602430 missense probably damaging 1.00
IGL02838:Synpo APN 18 60603800 missense probably damaging 1.00
R0420:Synpo UTSW 18 60602418 missense probably damaging 0.97
R0790:Synpo UTSW 18 60603503 missense probably damaging 0.98
R1213:Synpo UTSW 18 60602453 missense possibly damaging 0.83
R1695:Synpo UTSW 18 60603387 missense probably benign 0.00
R1763:Synpo UTSW 18 60602784 missense probably damaging 1.00
R1920:Synpo UTSW 18 60603589 missense probably benign 0.00
R1921:Synpo UTSW 18 60603589 missense probably benign 0.00
R2133:Synpo UTSW 18 60602895 missense probably damaging 1.00
R3757:Synpo UTSW 18 60602990 missense probably damaging 1.00
R4796:Synpo UTSW 18 60604314 missense probably damaging 0.97
R4841:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4842:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4911:Synpo UTSW 18 60629864 utr 5 prime probably benign
R5091:Synpo UTSW 18 60602759 nonsense probably null
R5327:Synpo UTSW 18 60603846 missense possibly damaging 0.93
R5354:Synpo UTSW 18 60602231 critical splice donor site probably null
R5671:Synpo UTSW 18 60595950 missense probably damaging 0.99
R5868:Synpo UTSW 18 60604046 missense probably damaging 1.00
R6007:Synpo UTSW 18 60603615 missense probably benign 0.35
R7266:Synpo UTSW 18 60629559 missense probably benign 0.00
R7472:Synpo UTSW 18 60629823 missense probably benign 0.00
R7509:Synpo UTSW 18 60603494 missense probably damaging 1.00
R7554:Synpo UTSW 18 60603333 missense probably benign 0.21
R7584:Synpo UTSW 18 60596277 missense probably damaging 0.96
R7615:Synpo UTSW 18 60604475 missense probably damaging 1.00
R7633:Synpo UTSW 18 60603428 missense probably damaging 1.00
R8499:Synpo UTSW 18 60602972 missense probably damaging 1.00
R8512:Synpo UTSW 18 60602411 missense probably damaging 0.99
R8996:Synpo UTSW 18 60604158 missense possibly damaging 0.95
R9116:Synpo UTSW 18 60602527 missense probably damaging 0.98
R9336:Synpo UTSW 18 60602400 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTAAGCCCCGAGCTATATCCTTCC -3'
(R):5'- ACCACGGCTATCTGCCAGAGAATG -3'

Sequencing Primer
(F):5'- ccgagctatatccTTCCCACATC -3'
(R):5'- CTATCTGCCAGAGAATGGAGTCC -3'
Posted On 2013-07-30