Incidental Mutation 'R0650:Huwe1'
ID 62246
Institutional Source Beutler Lab
Gene Symbol Huwe1
Ensembl Gene ENSMUSG00000025261
Gene Name HECT, UBA and WWE domain containing 1
Synonyms LOC382250, C430014N20Rik, Ib772, Ureb1, Mule, Arf-bp1, 5430439H10Rik
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0650 (G1)
Quality Score 225
Status Validated
Chromosome X
Chromosomal Location 151800807-151935417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151876313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 921 (S921P)
Ref Sequence ENSEMBL: ENSMUSP00000108241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026292] [ENSMUST00000112622] [ENSMUST00000123306] [ENSMUST00000153687]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026292
AA Change: S921P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026292
Gene: ENSMUSG00000025261
AA Change: S921P

DomainStartEndE-ValueType
Pfam:DUF908 90 369 4.2e-38 PFAM
Pfam:DUF913 430 814 6.1e-121 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1614 1679 3.5e-16 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2021 2036 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
low complexity region 2131 2143 N/A INTRINSIC
low complexity region 2262 2272 N/A INTRINSIC
low complexity region 2276 2293 N/A INTRINSIC
low complexity region 2348 2358 N/A INTRINSIC
low complexity region 2409 2471 N/A INTRINSIC
low complexity region 2527 2543 N/A INTRINSIC
low complexity region 2591 2601 N/A INTRINSIC
low complexity region 2679 2702 N/A INTRINSIC
low complexity region 2739 2759 N/A INTRINSIC
low complexity region 2766 2781 N/A INTRINSIC
low complexity region 2914 2933 N/A INTRINSIC
low complexity region 2945 2960 N/A INTRINSIC
Pfam:DUF4414 2969 3080 1.3e-32 PFAM
low complexity region 3091 3108 N/A INTRINSIC
low complexity region 3173 3182 N/A INTRINSIC
low complexity region 3224 3239 N/A INTRINSIC
low complexity region 3254 3264 N/A INTRINSIC
low complexity region 3370 3384 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3476 3553 N/A INTRINSIC
low complexity region 3750 3762 N/A INTRINSIC
coiled coil region 3763 3787 N/A INTRINSIC
low complexity region 3838 3860 N/A INTRINSIC
low complexity region 3919 3935 N/A INTRINSIC
HECTc 4040 4378 2.28e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112622
AA Change: S921P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108241
Gene: ENSMUSG00000025261
AA Change: S921P

DomainStartEndE-ValueType
Pfam:DUF908 89 370 1.8e-74 PFAM
Pfam:DUF913 429 815 1.2e-126 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1611 1679 3.5e-14 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2130 2142 N/A INTRINSIC
low complexity region 2261 2271 N/A INTRINSIC
low complexity region 2275 2292 N/A INTRINSIC
low complexity region 2347 2357 N/A INTRINSIC
low complexity region 2408 2470 N/A INTRINSIC
low complexity region 2526 2542 N/A INTRINSIC
low complexity region 2590 2600 N/A INTRINSIC
low complexity region 2678 2701 N/A INTRINSIC
low complexity region 2738 2758 N/A INTRINSIC
low complexity region 2765 2780 N/A INTRINSIC
low complexity region 2913 2932 N/A INTRINSIC
low complexity region 2944 2959 N/A INTRINSIC
Pfam:DUF4414 2968 3079 1.1e-34 PFAM
low complexity region 3090 3107 N/A INTRINSIC
low complexity region 3172 3181 N/A INTRINSIC
low complexity region 3223 3238 N/A INTRINSIC
low complexity region 3253 3263 N/A INTRINSIC
low complexity region 3369 3383 N/A INTRINSIC
low complexity region 3445 3460 N/A INTRINSIC
low complexity region 3475 3552 N/A INTRINSIC
low complexity region 3749 3761 N/A INTRINSIC
coiled coil region 3762 3786 N/A INTRINSIC
low complexity region 3837 3859 N/A INTRINSIC
low complexity region 3918 3934 N/A INTRINSIC
HECTc 4039 4377 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123306
SMART Domains Protein: ENSMUSP00000118185
Gene: ENSMUSG00000025261

DomainStartEndE-ValueType
Pfam:DUF913 1 132 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130243
Predicted Effect unknown
Transcript: ENSMUST00000138023
AA Change: S424P
SMART Domains Protein: ENSMUSP00000120057
Gene: ENSMUSG00000025261
AA Change: S424P

DomainStartEndE-ValueType
Pfam:DUF913 2 318 7.3e-110 PFAM
low complexity region 345 362 N/A INTRINSIC
low complexity region 391 405 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 587 608 N/A INTRINSIC
low complexity region 796 818 N/A INTRINSIC
UBA 822 858 1.3e-4 SMART
low complexity region 901 928 N/A INTRINSIC
low complexity region 1030 1046 N/A INTRINSIC
Pfam:WWE 1118 1176 7.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150020
Predicted Effect probably benign
Transcript: ENSMUST00000153687
Meta Mutation Damage Score 0.2105 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons results in neonatal lethality, poorly developed dentate gyrus, small cerebellum, increased cortex density, and increased neuronal precursor cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Huwe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Huwe1 APN X 151885627 missense probably damaging 1.00
IGL00707:Huwe1 APN X 151860734 missense probably damaging 1.00
IGL00932:Huwe1 APN X 151860161 splice site probably benign
IGL01413:Huwe1 APN X 151882680 missense possibly damaging 0.48
IGL01685:Huwe1 APN X 151898670 splice site probably benign
IGL02120:Huwe1 APN X 151907390 missense possibly damaging 0.53
IGL02176:Huwe1 APN X 151903968 missense possibly damaging 0.47
IGL02868:Huwe1 APN X 151908833 missense possibly damaging 0.91
IGL02902:Huwe1 APN X 151886766 missense probably damaging 0.98
IGL02971:Huwe1 APN X 151927626 splice site probably benign
R0651:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0657:Huwe1 UTSW X 151919928 missense probably benign 0.33
R1241:Huwe1 UTSW X 151907048 small deletion probably benign
R1247:Huwe1 UTSW X 151901570 missense probably benign 0.03
R1791:Huwe1 UTSW X 151864753 missense probably benign 0.06
R4296:Huwe1 UTSW X 151888448 missense probably benign 0.20
R4561:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4562:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4563:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R5339:Huwe1 UTSW X 151907048 small deletion probably benign
R8817:Huwe1 UTSW X 151886997 missense probably benign 0.03
R8819:Huwe1 UTSW X 151886997 missense probably benign 0.03
R9026:Huwe1 UTSW X 151933088 missense unknown
R9027:Huwe1 UTSW X 151933088 missense unknown
Z1176:Huwe1 UTSW X 151856575 missense probably damaging 1.00
Z1176:Huwe1 UTSW X 151928381 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTAGCCCAGACATTGCTCGCAC -3'
(R):5'- TGTCCGCTTGACCAAATTCACATCC -3'

Sequencing Primer
(F):5'- cattgctcgcactcagtatttc -3'
(R):5'- TTGGGCAGTACCTCTAAGAGC -3'
Posted On 2013-07-30