Incidental Mutation 'Z1176:Sppl2b'
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #Z1176 ()
Quality Score225.009
Status Not validated
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80867425 bp
Amino Acid Change Alanine to Glycine at position 507 (A507G)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000219817] [ENSMUST00000220091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035597
AA Change: A507G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: A507G

signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219951
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 3316 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C A 2: 32,381,764 G3C possibly damaging Het
1110032A03Rik C A 9: 50,768,219 probably benign Het
1520401A03Rik G C 17: 23,715,763 A96G possibly damaging Het
1600015I10Rik A C 6: 48,932,468 K549T probably benign Het
1700001C19Rik T G 17: 47,413,734 N154T probably benign Het
1700003E16Rik A C 6: 83,161,115 K74N probably damaging Het
1700013G24Rik C A 4: 137,454,992 P153T probably damaging Het
1700016C15Rik A T 1: 177,741,017 R27W possibly damaging Het
1700017N19Rik T G 10: 100,612,429 M274R probably damaging Het
1700019N19Rik T G 19: 58,787,706 K105T probably damaging Het
1700030J22Rik G T 8: 116,973,597 T22K probably benign Het
1700123K08Rik G T 5: 138,563,553 Q124K probably damaging Het
1810046K07Rik G T 9: 51,291,564 P97T probably benign Het
2310035C23Rik G T 1: 105,719,615 R734M probably benign Het
2310050C09Rik T C 3: 92,869,274 Q34R probably benign Het
2610021A01Rik G C 7: 41,625,342 L156F probably benign Het
2610028H24Rik C A 10: 76,452,863 P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 E10G probably damaging Het
2700081O15Rik C G 19: 7,422,747 P193A unknown Het
2900011O08Rik C A 16: 14,049,481 R68S probably damaging Het
3100002H09Rik T A 4: 124,610,705 D18V unknown Het
3110018I06Rik C G 12: 107,488,855 R67G unknown Het
3110082J24Rik G C 5: 30,105,067 A98G unknown Het
4833420G17Rik C A 13: 119,477,808 T484K not run Het
4833423E24Rik C T 2: 85,518,462 R102Q probably benign Het
4921501E09Rik C A 17: 33,065,657 D724Y possibly damaging Het
4921507P07Rik G T 6: 50,574,021 L483I possibly damaging Het
4921511C20Rik A G X: 127,394,842 K135E probably damaging Het
4930415L06Rik A C X: 89,930,241 N783K unknown Het
4930447C04Rik G C 12: 72,916,726 F18L probably benign Het
4930503B20Rik C T 3: 146,650,956 D66N probably damaging Het
4930516K23Rik A T 7: 104,059,288 F105I probably damaging Het
4930562C15Rik G A 16: 4,866,248 V236M possibly damaging Het
4930595M18Rik C T X: 81,420,272 G610R probably damaging Het
4932415D10Rik G T 10: 82,282,537 L4880I unknown Het
4932415D10Rik A C 10: 82,289,896 L2427V possibly damaging Het
4932415D10Rik A G 10: 82,293,228 I1316T probably benign Het
4933402D24Rik T A 1: 63,756,335 K90* probably null Het
4933402J07Rik G T 8: 87,568,574 M113I probably benign Het
4933403O08Rik C A X: 112,241,313 R213S probably benign Het
4933425L06Rik G A 13: 105,111,144 G324D probably damaging Het
4933427D14Rik C T 11: 72,159,000 V852I probably benign Het
4933427I04Rik T C 4: 123,860,875 L194P probably damaging Het
5330417C22Rik C A 3: 108,471,435 W349L probably damaging Het
5330417C22Rik C A 3: 108,471,978 G345C probably damaging Het
5730559C18Rik C A 1: 136,219,783 R399L possibly damaging Het
6430571L13Rik G T 9: 107,342,527 G60C probably damaging Het
9430015G10Rik G C 4: 156,122,011 G76A probably benign Het
9530053A07Rik G A 7: 28,142,386 S582N probably benign Het
9530053A07Rik G A 7: 28,154,762 G1717D probably benign Het
A1cf A C 19: 31,918,017 I167L probably benign Het
A2ml1 A G 6: 128,571,977 F281L probably benign Het
A430005L14Rik CG C 4: 153,960,665 probably null Het
A730049H05Rik C A 6: 92,828,066 S69* probably null Het
A830018L16Rik C G 1: 11,518,625 Q89E probably damaging Het
AA986860 A C 1: 130,742,991 S317R probably benign Het
Aasdh C G 5: 76,891,796 probably null Het
Aass T C 6: 23,078,857 T719A probably damaging Het
Aatf C T 11: 84,442,585 A500T probably benign Het
Abca12 A C 1: 71,284,070 Y1618D probably damaging Het
Abca13 G T 11: 9,251,376 G153C possibly damaging Het
Abca13 C A 11: 9,267,461 P301H probably damaging Het
Abca13 G T 11: 9,294,342 W2068C probably benign Het
Abca13 G T 11: 9,335,181 A3272S probably damaging Het
Abca13 C A 11: 9,335,182 A3272E probably damaging Het
Abca14 G T 7: 120,246,923 G599V probably damaging Het
Abca15 T G 7: 120,346,026 F442V probably benign Het
Abca15 G T 7: 120,382,505 G1061W probably damaging Het
Abca2 G T 2: 25,444,110 V1800L probably benign Het
Abca4 G T 3: 122,103,488 W605C probably damaging Het
Abca4 C A 3: 122,156,443 S1805R probably damaging Het
Abca7 C T 10: 79,999,432 R208* probably null Het
Abca7 T C 10: 80,006,559 L1109P probably damaging Het
Abca8b A T 11: 109,961,908 C761S possibly damaging Het
Abca8b G A 11: 109,974,644 T329I possibly damaging Het
Abca9 G A 11: 110,135,375 A953V probably benign Het
Abcb10 C A 8: 123,982,663 G51C possibly damaging Het
Abcb11 C A 2: 69,291,981 G386V probably damaging Het
Abcb1b A G 5: 8,827,441 Y667C probably benign Het
Abcb4 C A 5: 8,959,005 R1221S probably damaging Het
Abcb5 C A 12: 118,918,272 G574V probably damaging Het
Abcb8 A T 5: 24,400,995 D226V probably damaging Het
Abcc10 G A 17: 46,313,700 H784Y probably damaging Het
Abcc10 C T 17: 46,324,262 A272T probably benign Het
Abcc12 T G 8: 86,550,601 K389T probably damaging Het
Abcc3 C G 11: 94,361,275 Q827H probably benign Het
Abcc6 C T 7: 45,979,734 D1363N probably damaging Het
Abcc6 A T 7: 45,992,306 probably null Het
Abcc8 T C 7: 46,106,965 S1439G possibly damaging Het
Abhd12b G A 12: 70,163,451 D134N probably damaging Het
Abhd13 A C 8: 9,987,413 K3N probably damaging Het
Abl1 A C 2: 31,689,827 K7N probably damaging Het
Ablim2 C T 5: 35,848,858 P409L possibly damaging Het
Abo C G 2: 26,848,258 V45L probably benign Het
Abtb2 G T 2: 103,708,172 E649* probably null Het
Acaca G C 11: 84,260,720 A815P probably damaging Het
Acacb G T 5: 114,248,948 R2386L probably benign Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Acap3 C G 4: 155,905,179 N693K probably damaging Het
Acmsd G T 1: 127,745,802 V76F probably damaging Het
Actc1 C A 2: 114,051,997 C12F probably benign Het
Actl11 T G 9: 107,931,700 V1074G probably benign Het
Actl6a A C 3: 32,726,543 I411L probably benign Het
Actl9 C A 17: 33,433,101 P45Q possibly damaging Het
Actr10 C A 12: 70,962,029 A412E probably damaging Het
Actr1b T A 1: 36,701,208 H284L probably benign Het
Actrt2 G T 4: 154,666,832 N282K probably benign Het
Acvr1 C A 2: 58,479,868 G43V probably benign Het
Acy3 G T 19: 3,987,107 R13L probably damaging Het
Adam17 T G 12: 21,361,737 Q51P possibly damaging Het
Adam21 T G 12: 81,559,743 N415T probably damaging Het
Adam30 A G 3: 98,162,360 Y503C possibly damaging Het
Adam32 C A 8: 24,948,750 E16* probably null Het
Adam6a A G 12: 113,545,321 K438R possibly damaging Het
Adam7 A T 14: 68,527,701 S82R probably benign Het
Adamts10 C T 17: 33,528,787 R66W probably damaging Het
Adamts10 G T 17: 33,528,788 R66L probably damaging Het
Adamts12 G T 15: 11,336,383 C1518F not run Het
Adamts15 G C 9: 30,910,700 C480W probably damaging Het
Adamts16 C T 13: 70,761,773 R887K probably benign Het
Adamts18 A T 8: 113,743,168 I634N possibly damaging Het
Adamts2 G T 11: 50,792,708 R939L probably damaging Het
Adamts3 C T 5: 89,775,351 V199I not run Het
Adamts4 G A 1: 171,258,783 A715T probably benign Het
Adamts4 C G 1: 171,258,784 A715G probably benign Het
Adamtsl1 C T 4: 86,342,177 P883L probably damaging Het
Adamtsl1 T G 4: 86,342,693 M1055R probably benign Het
Adamtsl2 C A 2: 27,081,720 Q6K probably benign Het
Adcy1 G A 11: 7,109,098 D335N probably damaging Het
Adcy1 C A 11: 7,149,536 T672N probably damaging Het
Adcy1 G A 11: 7,150,857 R802K probably damaging Het
Adcy1 G T 11: 7,150,858 R802S possibly damaging Het
Adcy5 G T 16: 35,156,321 G75C unknown Het
Adcy5 C G 16: 35,290,185 F907L probably benign Het
Adcy5 G A 16: 35,291,544 V924M not run Het
Adcy8 T C 15: 64,725,518 T895A probably benign Het
Adcy9 G T 16: 4,307,232 P745Q probably damaging Het
Add2 G T 6: 86,098,590 K240N probably damaging Het
Adgb G T 10: 10,378,742 T1159N probably benign Het
Adgrb2 G T 4: 130,017,563 C1126F probably damaging Het
Adgrb3 C T 1: 25,093,914 D1364N probably benign Het
Adgre1 T G 17: 57,361,729 L30R possibly damaging Het
Adgrg4 G T X: 56,894,702 V174L probably benign Het
Adgrg4 C A X: 56,914,259 P601H probably benign Het
Adgrg5 G C 8: 94,935,151 W173C Het
Adgrv1 C A 13: 81,559,634 A1218S possibly damaging Het
Adh7 G A 3: 138,223,731 G87D probably benign Het
Adora2a C A 10: 75,333,328 Q209K probably benign Het
Adprhl1 C G 8: 13,225,613 A382P probably benign Het
Adprhl2 C G 4: 126,321,567 G35A probably damaging Het
Adprhl2 C G 4: 126,321,661 A4P unknown Het
Adra1a C A 14: 66,727,628 L356M probably benign Het
Adra2b C A 2: 127,364,038 D158E probably benign Het
Adra2c G C 5: 35,280,904 R340P probably damaging Het
Adss C A 1: 177,776,493 C182F probably damaging Het
Adss C A 1: 177,796,498 probably benign Het
Aff3 T A 1: 38,329,872 K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,478,353 probably null Het
Afg3l2 C A 18: 67,431,707 L232F probably benign Het
Afmid G A 11: 117,834,966 D129N probably benign Het
Agap2 G C 10: 127,080,225 G202R unknown Het
Agbl1 T G 7: 76,418,685 L333R Het
Agbl4 T A 4: 110,660,839 L109Q probably damaging Het
Agbl4 G T 4: 111,526,643 G232W probably damaging Het
Ago4 C A 4: 126,520,190 probably null Het
Ahnak G T 19: 9,008,856 M2501I probably damaging Het
AI593442 C A 9: 52,677,945 G111C probably damaging Het
AI597479 A G 1: 43,113,190 H216R probably benign Het
Aipl1 G T 11: 72,030,533 P179T possibly damaging Het
Ak9 G C 10: 41,348,251 G524R Het
Ak9 G T 10: 41,423,023 W1573C unknown Het
Akap1 G T 11: 88,837,167 T663N probably benign Het
Akap13 G T 7: 75,730,552 R491L probably damaging Het
Akap14 G T X: 37,163,245 P279H unknown Het
Akap4 G T X: 7,078,360 E831* probably null Het
Akap6 C G 12: 53,140,444 T1547R possibly damaging Het
Akap8 C A 17: 32,306,549 V519L probably damaging Het
Akap9 G T 5: 3,962,251 G985W probably damaging Het
Akirin1 C T 4: 123,750,067 G33D probably damaging Het
Akr1cl C A 1: 65,016,687 G219C probably damaging Het
Alas1 G A 9: 106,238,769 R349C probably benign Het
Alas1 C A 9: 106,243,367 Q76H probably benign Het
Aldh1l1 GAA GA 6: 90,557,284 probably null Het
Aldh1l1 G T 6: 90,583,173 V601L probably benign Het
Aldh3a2 T G 11: 61,264,283 K145T probably benign Het
Aldoart1 C A 4: 72,852,004 R189L probably benign Het
Alg8 T G 7: 97,383,761 F285V probably benign Het
Alkbh8 G C 9: 3,345,820 G180A probably damaging Het
Alms1 C G 6: 85,678,418 N2846K probably benign Het
Alox12b T A 11: 69,157,323 I26N possibly damaging Het
Alox12b G C 11: 69,157,325 V27L possibly damaging Het
Aloxe3 C A 11: 69,133,079 L279M probably damaging Het
Alpi T C 1: 87,099,072 N428S probably benign Het
Alpk1 T A 3: 127,673,438 H1064L probably damaging Het
Alpk2 G C 18: 65,305,611 L904V probably damaging Het
Alpk3 G T 7: 81,078,626 L501F probably benign Het
Alpl G C 4: 137,754,010 S110R probably damaging Het
Alppl2 G A 1: 87,087,666 S391F probably damaging Het
Alppl2 G T 1: 87,087,704 H378Q probably damaging Het
Amer3 G T 1: 34,589,013 V778L probably benign Het
Ampd2 C A 3: 108,080,064 G151V probably damaging Het
Amz1 G T 5: 140,744,073 E121* probably null Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Ank3 T G 10: 69,932,474 L941R possibly damaging Het
Ank3 C T 10: 69,951,010 A968V possibly damaging Het
Ank3 G C 10: 69,991,215 E1905Q Het
Ankar G T 1: 72,689,961 L342I possibly damaging Het
Ankib1 G A 5: 3,692,763 S1084L probably benign Het
Ankk1 T A 9: 49,416,643 Q412L probably benign Het
Ankk1 T G 9: 49,421,911 K91T probably damaging Het
Ankle2 G C 5: 110,234,499 E114Q possibly damaging Het
Ankmy1 C T 1: 92,878,437 G780E probably damaging Het
Ankmy2 T G 12: 36,186,859 M222R probably damaging Het
Ankrd11 C T 8: 122,895,803 V437M possibly damaging Het
Ankrd12 C A 17: 65,970,338 probably null Het
Ankrd36 T A 11: 5,615,538 F457L probably benign Het
Ankrd39 C G 1: 36,542,005 A88P probably damaging Het
Ankrd45 C T 1: 161,163,283 A202V possibly damaging Het
Ankrd49 C G 9: 14,781,428 A147P probably damaging Het
Ankrd6 C T 4: 32,806,229 E675K possibly damaging Het
Ankrd6 G T 4: 32,806,326 S642R probably benign Het
Ankrd6 G C 4: 32,824,486 N142K probably damaging Het
Anks3 T G 16: 4,950,714 Q255P probably benign Het
Ano2 G T 6: 125,710,707 Q58H probably benign Het
Ano2 T G 6: 125,863,453 Y362* probably null Het
Ano4 A T 10: 89,112,945 V101E probably benign Het
Ano5 T A 7: 51,574,703 V469E probably damaging Het
Ano6 C A 15: 95,913,460 P147Q probably damaging Het
Ano7 C A 1: 93,394,465 D398E probably benign Het
Anpep G C 7: 79,827,639 P727A possibly damaging Het
Anxa10 T G 8: 62,063,070 probably null Het
Aoc2 G T 11: 101,326,420 G443V probably benign Het
Aox4 G C 1: 58,246,351 E665Q possibly damaging Het
Ap1m2 G A 9: 21,298,256 R375* probably null Het
Ap1s1 G A 5: 137,037,470 T126I probably damaging Het
Apba1 C A 19: 23,944,115 S767R probably damaging Het
Apex2 C A X: 150,572,099 G414V probably benign Het
Apoa4 C A 9: 46,242,589 R163S possibly damaging Het
Apob G C 12: 7,998,011 G997R probably damaging Het
Apob G T 12: 8,004,978 V1326L probably benign Het
Apobr A T 7: 126,587,264 E649V probably damaging Het
Apoh G T 11: 108,343,459 probably benign Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
App A G 16: 85,024,917 L390P probably damaging Het
Aqr C A 2: 114,108,122 R1283M probably damaging Het
Aqr C G 2: 114,109,991 A1225P probably benign Het
Ar G T X: 98,151,009 G410W probably damaging Het
Arfgef2 G A 2: 166,894,712 R1768Q probably damaging Het
Arfgef3 T A 10: 18,591,437 K2005M probably damaging Het
Arfgef3 C A 10: 18,608,358 C1383F probably damaging Het
Arfgef3 T A 10: 18,634,852 H787L probably benign Het
Arhgap1 C T 2: 91,650,214 A27V possibly damaging Het
Arhgap10 C A 8: 77,277,175 G667V probably benign Het
Arhgap10 T G 8: 77,432,805 S107R probably damaging Het
Arhgap11a C G 2: 113,833,758 A727P probably benign Het
Arhgap22 A T 14: 33,362,522 R253W probably damaging Het
Arhgap24 G T 5: 102,875,759 V220F probably damaging Het
Arhgap24 G A 5: 102,880,807 A283T probably benign Het
Arhgap25 G T 6: 87,476,186 L211M probably damaging Het
Arhgap31 G C 16: 38,623,893 Q201E possibly damaging Het
Arhgap33 C A 7: 30,522,717 R1263S probably benign Het
Arhgap40 C A 2: 158,534,885 P317T probably benign Het
Arhgap45 C A 10: 80,025,536 T511N probably damaging Het
Arhgap45 C G 10: 80,029,052 R950G probably damaging Het
Arhgap5 G A 12: 52,518,463 R739H possibly damaging Het
Arhgap9 C A 10: 127,327,689 T452N probably damaging Het
Arhgef11 C T 3: 87,735,462 P1434L not run Het
Arhgef12 T A 9: 42,971,072 Q1492L probably benign Het
Arhgef18 G T 8: 3,453,224 V877L probably damaging Het
Arhgef4 G T 1: 34,723,729 D689Y unknown Het
Arhgef4 G T 1: 34,804,926 G1358C probably damaging Het
Arid1a C A 4: 133,720,550 Q217H probably null Het
Arid4a A C 12: 71,039,920 K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,319,355 probably null Het
Arl10 C G 13: 54,580,724 L188V probably benign Het
Arl14 C A 3: 69,222,648 P43T probably damaging Het
Arl4c T C 1: 88,701,450 Q72R possibly damaging Het
Arl6ip5 C A 6: 97,229,555 N65K probably benign Het
Armc2 C A 10: 41,927,044 Q544H probably damaging Het
Armc2 C G 10: 41,963,656 G438R probably damaging Het
Armc4 G C 18: 7,129,487 A897G probably damaging Het
Armc4 C A 18: 7,216,973 E680* probably null Het
Armcx4 C A X: 134,693,042 A1233D not run Het
Armcx4 G A X: 134,694,091 E1583K possibly damaging Het
Arnt2 G A 7: 84,263,196 P579S probably benign Het
Arpc3 C T 5: 122,404,230 P120L probably damaging Het
Arrdc5 C G 17: 56,300,189 A19P probably damaging Het
Arsi C A 18: 60,916,780 P245H probably damaging Het
Art2b T A 7: 101,578,882 Q283L not run Het
Arx G T X: 93,289,184 A280S probably damaging Het
Asap3 TGGG TGG 4: 136,240,201 probably benign Het
Asap3 C A 4: 136,241,503 P753Q probably damaging Het
Asb15 G T 6: 24,566,331 D428Y probably damaging Het
Ascc1 G T 10: 60,007,793 R59L possibly damaging Het
Ascc2 G T 11: 4,646,653 R58L probably benign Het
Ascc2 G C 11: 4,672,487 G518R probably benign Het
Ash1l G A 3: 89,043,217 R2139Q probably damaging Het
Asic2 A T 11: 80,889,832 L417Q possibly damaging Het
Asic2 T G 11: 81,967,670 K172T probably benign Het
Aspg C G 12: 112,113,081 Q98E possibly damaging Het
Asphd1 A T 7: 126,948,636 L165Q probably damaging Het
Astl C T 2: 127,356,545 A360V probably benign Het
Asxl3 G T 18: 22,522,220 G1096C probably damaging Het
Atad5 A C 11: 80,094,896 S270R probably damaging Het
Ate1 C A 7: 130,504,714 D306Y probably benign Het
Atg7 G T 6: 114,673,050 V63F possibly damaging Het
Atg9a A T 1: 75,186,559 L299Q probably damaging Het
Atl1 C G 12: 69,937,075 L192V possibly damaging Het
Atl3 T G 19: 7,510,037 F106V probably damaging Het
Atp10a G T 7: 58,788,447 probably null Het
Atp12a G C 14: 56,372,706 G221A probably damaging Het
Atp13a2 A T 4: 141,005,117 S898C probably benign Het
Atp13a4 C A 16: 29,422,587 Q754H probably null Het
Atp1a2 A T 1: 172,279,754 I733N possibly damaging Het
Atp1a3 C A 7: 24,998,688 A198S probably benign Het
Atp1a4 C G 1: 172,231,954 R857P probably benign Het
Atp1b2 G T 11: 69,601,315 A269D possibly damaging Het
Atp2a3 G T 11: 72,980,622 G650C possibly damaging Het
Atp2a3 C A 11: 72,989,540 H1016N probably benign Het
Atp2b3 G A X: 73,535,424 E343K possibly damaging Het
Atp6v0a4 G A 6: 38,049,036 S819F possibly damaging Het
Atp6v1e1 T C 6: 120,804,119 E97G probably benign Het
Atp6v1e1 T A 6: 120,822,449 probably benign Het
Atp6v1h G C 1: 5,095,628 R107P probably damaging Het
Atp7b G T 8: 22,028,714 P36H probably benign Het
Atp8b4 C A 2: 126,414,429 E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 R650W probably benign Het
Atp9b T A 18: 80,765,865 Q613L Het
Atpaf2 C A 11: 60,416,775 A46S probably benign Het
Atrn G T 2: 130,946,193 G305V probably benign Het
Atxn2 A T 5: 121,777,990 S420C probably damaging Het
Atxn7l1 G T 12: 33,367,645 A602S probably benign Het
Atxn7l1 G C 12: 33,368,017 A726P probably benign Het
Atxn7l2 A C 3: 108,205,666 S309A probably benign Het
AU022751 G T X: 6,082,314 P216T unknown Het
AU022751 T G X: 6,082,321 E213D unknown Het
Aup1 G T 6: 83,056,633 R306L probably benign Het
Aurkaip1 G T 4: 155,832,763 R156L probably damaging Het
Aurkc TGG TG 7: 6,995,514 probably null Het
Avl9 G C 6: 56,736,764 D336H probably damaging Het
Avpr1b C A 1: 131,609,573 S365Y probably damaging Het
Axdnd1 A T 1: 156,349,063 L714Q probably damaging Het
Azin2 C A 4: 128,934,659 D347Y possibly damaging Het
B3gnt5 A T 16: 19,769,810 R260* probably null Het
B3gnt6 C G 7: 98,193,889 R288P probably benign Het
Bag6 G T 17: 35,139,310 probably null Het
Bahcc1 G T 11: 120,276,609 G1279W possibly damaging Het
Bahcc1 G T 11: 120,284,394 V1765L probably benign Het
Bahd1 G A 2: 118,922,403 R717H probably damaging Het
Baiap3 C A 17: 25,244,768 R934S probably benign Het
Bbs10 G C 10: 111,298,908 probably null Het
Bbs10 G T 10: 111,299,657 L210F probably benign Het
Bbs10 G T 10: 111,301,124 R699S probably damaging Het
BC005561 T C 5: 104,520,192 V860A possibly damaging Het
BC024063 G T 10: 82,109,050 G168V probably damaging Het
BC080695 T C 4: 143,572,252 I255T probably benign Het
Bcan C A 3: 87,990,750 G635W probably damaging Het
Bcan T G 3: 87,990,755 N633T probably damaging Het
Bcan C T 3: 87,995,650 D274N probably benign Het
Bckdha T C 7: 25,631,143 S343G probably damaging Het
Bcl10 T G 3: 145,930,513 I55M probably damaging Het
Bcl11a G T 11: 24,165,010 K784N probably damaging Het
Bcl6 C G 16: 23,969,958 Q553H probably damaging Het
Bcorl1 T G X: 48,367,842 L84R unknown Het
Bcorl1 GAAAA GAAA X: 48,375,090 probably null Het
Bend6 C A 1: 33,864,523 Q173H probably null Het
Best3 T G 10: 117,024,622 L596V probably benign Het
Bmp4 A C 14: 46,384,628 V153G possibly damaging Het
Bmpr1b C A 3: 141,842,954 E438D probably benign Het
Bmpr2 G A 1: 59,847,167 R321Q not run Het
Bnc1 T G 7: 81,974,542 E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,694,045 probably benign Het
Borcs5 A T 6: 134,710,123 Q147L probably benign Het
Borcs8 C G 8: 70,141,971 H49D probably damaging Het
Bpi G T 2: 158,272,102 G307W possibly damaging Het
Bpifa3 A T 2: 154,130,471 probably benign Het
Bpifb4 A C 2: 153,942,832 E153D probably benign Het
Bpifc C A 10: 85,965,228 A419S probably benign Het
Bptf C A 11: 107,058,684 G2270W probably damaging Het
Braf C A 6: 39,643,182 W487C probably damaging Het
Brap A G 5: 121,675,377 T298A possibly damaging Het
Brd2 C A 17: 34,113,688 G573W possibly damaging Het
Brd9 G C 13: 73,944,751 A287P probably damaging Het
Brdt G T 5: 107,359,898 S664I possibly damaging Het
Brinp1 C A 4: 68,798,751 E287* probably null Het
Brinp2 C G 1: 158,247,039 G504A probably damaging Het
Brinp2 A T 1: 158,247,171 L460* probably null Het
Brinp3 C T 1: 146,902,076 P754S probably damaging Het
Btg4 G A 9: 51,119,175 D192N probably benign Het
Btla G T 16: 45,239,358 V142L probably damaging Het
Bub1 C A 2: 127,829,565 W33L probably damaging Het
C130026I21Rik G T 1: 85,113,523 D71E probably damaging Het
C1qb C G 4: 136,882,145 G55R probably damaging Het
C1ql2 C G 1: 120,341,624 H169Q possibly damaging Het
C2cd4a C G 9: 67,831,413 G116A probably damaging Het
C2cd4c G A 10: 79,612,465 P283S possibly damaging Het
C4b A T 17: 34,731,147 L1383Q probably damaging Het
C530008M17Rik C A 5: 76,857,246 P485T unknown Het
C77080 G T 4: 129,223,704 S434Y probably damaging Het
C87977 A G 4: 144,207,461 F359L probably benign Het
C8a C A 4: 104,862,686 G76C probably damaging Het
Cabp7 T G 11: 4,746,669 N20T probably benign Het
Cacna1a G T 8: 84,415,676 R11L unknown Het
Cacna1b A T 2: 24,626,884 L54* probably null Het
Cacna1c T G 6: 118,697,737 K547T Het
Cacna1d C T 14: 30,111,116 A923T probably benign Het
Cacna1d A G 14: 30,179,188 F325S probably benign Het
Cacna1e T A 1: 154,635,850 T176S probably damaging Het
Cacna1g A T 11: 94,438,111 L1020M probably benign Het
Cacna1h G C 17: 25,391,250 P761A probably benign Het
Cacna1s G T 1: 136,107,084 E1322* probably null Het
Cacna2d2 G C 9: 107,517,293 A585P probably damaging Het
Cacna2d2 C A 9: 107,526,102 L921M probably benign Het
Cacna2d4 G T 6: 119,312,450 R815M probably benign Het
Cacnb1 C A 11: 98,022,555 probably benign Het
Cacnb4 C A 2: 52,675,812 probably null Het
Cacng5 G T 11: 107,877,546 P212T probably damaging Het
Cacng5 C G 11: 107,884,346 G66R probably null Het
Cadps2 A C 6: 23,321,801 L1031V probably benign Het
Calcoco2 C A 11: 96,103,520 W69L probably damaging Het
Calr C A 8: 84,844,064 probably null Het
Camk1g C A 1: 193,362,100 G2V probably damaging Het
Camk2b G C 11: 5,977,940 S447C possibly damaging Het
Camk2g C A 14: 20,764,912 W215C probably damaging Het
Camsap1 C T 2: 25,936,639 A1260T probably damaging Het
Camsap1 G C 2: 25,940,881 P461A probably benign Het
Camta1 G T 4: 151,144,385 H663Q probably benign Het
Cand1 A C 10: 119,239,194 I16S probably benign Het
Capg G T 6: 72,555,476 probably null Het
Capn1 C G 19: 6,014,278 V64L probably benign Het
Capn13 G T 17: 73,341,110 S298R probably benign Het
Capn6 C G X: 143,810,907 G79R probably damaging Het
Car5b G T X: 164,000,310 A90D probably benign Het
Car7 G T 8: 104,548,959 C180F possibly damaging Het
Card9 T A 2: 26,357,796 E181V probably damaging Het
Carnmt1 C G 19: 18,679,213 A170G possibly damaging Het
Carnmt1 G C 19: 18,704,090 C391S probably benign Het
Cartpt C A 13: 99,899,983 E86* probably null Het
Casc1 C A 6: 145,205,293 E18* probably null Het
Cask C T X: 13,533,489 V785I probably benign Het
Caskin1 C A 17: 24,505,038 N933K probably damaging Het
Caskin2 A G 11: 115,802,096 L621P probably damaging Het
Caskin2 C G 11: 115,802,103 A619P probably damaging Het
Caskin2 C A 11: 115,803,620 G385V probably benign Het
Casq1 G T 1: 172,215,914 S191* probably null Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catip A C 1: 74,367,789 H240P probably damaging Het
Catsper2 C A 2: 121,407,385 W171C probably damaging Het
Cav2 G T 6: 17,281,433 V25F probably benign Het
Cavin2 G T 1: 51,301,156 G331C probably damaging Het
Cbfa2t3 G C 8: 122,698,895 probably benign Het
Cbx8 G A 11: 119,039,119 A216V possibly damaging Het
Ccdc113 G T 8: 95,538,219 R119L probably damaging Het
Ccdc121 C T 1: 181,510,875 E171K possibly damaging Het
Ccdc14 G T 16: 34,706,498 G306C probably damaging Het
Ccdc144b T C 3: 36,018,888 Q415R possibly damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,420,813 probably null Het
Ccdc151 C A 9: 21,990,424 V547F possibly damaging Het
Ccdc155 C G 7: 45,184,254 probably null Het
Ccdc158 T C 5: 92,608,491 M1086V probably damaging Het
Ccdc162 C T 10: 41,553,131 R645H probably benign Het
Ccdc162 C T 10: 41,605,108 D1318N possibly damaging Het
Ccdc162 G A 10: 41,654,997 T571I possibly damaging Het
Ccdc162 T G 10: 41,690,092 K85T probably benign Het
Ccdc171 G A 4: 83,795,230 A1169T probably damaging Het
Ccdc175 C A 12: 72,112,308 R619L possibly damaging Het
Ccdc180 A C 4: 45,916,406 K869T probably damaging Het
Ccdc180 A C 4: 45,920,910 K952T probably damaging Het
Ccdc187 G T 2: 26,281,507 Q320K probably benign Het
Ccdc28b C A 4: 129,621,104 G71C probably damaging Het
Ccdc33 G A 9: 58,117,416 P176S probably benign Het
Ccdc40 G A 11: 119,252,008 R864H probably damaging Het
Ccdc51 G T 9: 109,092,148 E368* probably null Het
Ccdc51 G C 9: 109,092,226 A394P probably damaging Het
Ccdc57 C G 11: 120,860,488 A919P possibly damaging Het
Ccdc57 C A 11: 120,861,138 Q872H probably null Het
Ccdc7a G T 8: 129,026,663 R196S probably benign Het
Ccdc80 G T 16: 45,095,786 G302* probably null Het
Ccdc80 G A 16: 45,096,207 S442N probably benign Het
Ccdc80 T C 16: 45,116,344 F711L probably damaging Het
Ccdc87 G A 19: 4,841,923 W814* probably null Het
Ccdc88b C A 19: 6,849,740 A1020S possibly damaging Het
Ccdc88c T C 12: 100,945,770 K602E possibly damaging Het
Ccdc94 T C 17: 55,960,732 F15S probably damaging Het
Ccdc96 C G 5: 36,485,594 R315G probably benign Het
Ccin A T 4: 43,985,018 Q475L probably damaging Het
Ccnb1ip1 C A 14: 50,792,104 R167L probably benign Het
Ccnb3 T C X: 7,009,375 T322A possibly damaging Het
Ccr10 C G 11: 101,174,323 G127A probably damaging Het
Ccr10 CG C 11: 101,174,340 probably null Het
Ccr7 G T 11: 99,144,980 T372N probably damaging Het
Cct6b C T 11: 82,723,939 V408I probably damaging Het
Cct6b C A 11: 82,764,065 probably benign Het
Cd163l1 A T 7: 140,224,857 H591L probably benign Het
Cd164 G T 10: 41,519,565 A11S probably damaging Het
Cd177 G T 7: 24,746,171 Q616K probably benign Het
Cd180 C T 13: 102,705,766 P440L probably damaging Het
Cd200r1 A T 16: 44,792,759 I243F probably damaging Het
Cd209e C T 8: 3,849,196 G172E probably benign Het
Cd22 T G 7: 30,867,963 K732T probably benign Het
Cd22 G T 7: 30,869,530 P693H probably damaging Het
Cd3d A G 9: 44,985,628 D100G probably damaging Het
Cd59a C A 2: 104,104,198 Q4K probably benign Het
Cd69 G T 6: 129,268,342 C173* probably null Het
Cdc123 T G 2: 5,804,985 Q205P probably damaging Het
Cdc14b C G 13: 64,274,669 V28L possibly damaging Het
Cdc42bpa A G 1: 180,065,093 E274G probably damaging Het
Cdc42ep2 A G 19: 5,918,492 F62L probably benign Het
Cdc42ep5 A T 7: 4,151,726 L21H probably damaging Het
Cdh15 G C 8: 122,864,259 D416H probably damaging Het
Cdh16 G C 8: 104,615,185 P783A probably damaging Het
Cdh19 T G 1: 110,893,306 Q567H probably benign Het
Cdh19 A T 1: 110,895,387 N522K probably damaging Het
Cdh19 C G 1: 110,932,214 G179A probably damaging Het
Cdh22 G T 2: 165,116,184 P621H probably damaging Het
Cdh23 T A 10: 60,310,770 N2877Y probably damaging Het
Cdh23 T C 10: 60,428,321 N683D probably benign Het
Cdh7 G T 1: 110,108,736 G549C probably damaging Het
Cdh8 G A 8: 99,171,323 P453S probably benign Het
Cdh8 C A 8: 99,190,205 R426M probably null Het
Cdhr3 G T 12: 33,060,322 P321H probably damaging Het
Cdhr3 C A 12: 33,080,324 G171W probably benign Het
Cdk12 G T 11: 98,203,941 G192* probably null Het
Cdk14 G T 5: 5,135,322 Y212* probably null Het
Cdk5r2 C G 1: 74,855,350 P85A probably damaging Het
Cdk5rap2 C T 4: 70,266,743 G1157R probably damaging Het
Cdk6 T A 5: 3,390,694 C83S possibly damaging Het
Cdsn T G 17: 35,555,825 V417G possibly damaging Het
Cdsn T A 17: 35,556,071 L499Q probably damaging Het
Cdyl C T 13: 35,815,966 R77W probably damaging Het
Ceacam15 G T 7: 16,675,583 P9H possibly damaging Het
Cela2a G T 4: 141,821,391 P145T probably damaging Het
Celsr1 A C 15: 85,963,100 F1479V probably damaging Het
Celsr2 C A 3: 108,393,131 R2871L probably benign Het
Celsr2 G T 3: 108,412,341 H1052N probably benign Het
Cenpf G A 1: 189,659,472 T704I probably damaging Het
Cenpv A C 11: 62,527,525 F201V probably damaging Het
Cep112 G A 11: 108,425,310 G36D probably damaging Het
Cep152 C A 2: 125,583,971 G825C probably benign Het
Cep170b G T 12: 112,741,012 probably null Het
Cep192 A T 18: 67,881,288 K2451M probably damaging Het
Cep290 AGG AG 10: 100,549,374 probably benign Het
Cep295 G T 9: 15,357,697 P16Q probably damaging Het
Cep295nl T C 11: 118,333,019 E333G possibly damaging Het
Cep295nl T G 11: 118,333,873 Q48H probably damaging Het
Cep44 C G 8: 56,544,128 G125A possibly damaging Het
Cep97 C A 16: 55,927,735 G111C probably damaging Het
Cerkl C A 2: 79,368,765 Q160H probably benign Het
Cers1 C G 8: 70,318,318 P126R probably benign Het
Ces1a C A 8: 93,036,085 R186L probably benign Het
Ces1g G T 8: 93,325,811 H283Q probably benign Het
Ces2a C A 8: 104,734,006 probably benign Het
Ces2a A T 8: 104,734,850 E77V probably damaging Het
Ces3a A C 8: 105,053,602 K327T possibly damaging Het
Ces4a A G 8: 105,131,977 K9R probably benign Het
Cetn2 T G X: 72,914,889 K127T probably damaging Het
Cfap100 G C 6: 90,406,150 A347G unknown Het
Cfap20 C T 8: 95,434,525 S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 P251R possibly damaging Het
Cfap221 G T 1: 119,995,141 L24I probably benign Het
Cfap45 G T 1: 172,545,284 E515D probably benign Het
Cfap46 A C 7: 139,639,548 L1334V Het
Cfap65 G A 1: 74,910,747 R1200C probably damaging Het
Cfap74 C G 4: 155,426,118 R387G Het
Cflar C G 1: 58,731,229 C160W Het
Cflar G T 1: 58,740,313 probably null Het
Cgn A T 3: 94,774,273 V504E possibly damaging Het
Cgn T C 3: 94,774,346 R480G probably damaging Het
Cgn G T 3: 94,776,178 A389D probably benign Het
Chd1 G T 17: 15,766,347 V1482L probably damaging Het
Chd1 G T 17: 15,768,733 G1583C probably damaging Het
Chd4 G T 6: 125,100,860 R95L possibly damaging Het
Chd4 G T 6: 125,101,598 A228S probably benign Het
Chd5 G A 4: 152,378,479 R1363K probably damaging Het
Chd7 C G 4: 8,844,313 A1502G probably damaging Het
Cherp C T 8: 72,470,953 G101D Het
Chfr C G 5: 110,144,895 S176* probably null Het
Chil1 G T 1: 134,182,779 probably null Het
Chil1 C G 1: 134,189,230 R319G probably damaging Het
Chml C A 1: 175,687,762 G198C possibly damaging Het
Chmp3 A C 6: 71,560,964 E58D probably benign Het
Chmp3 G C 6: 71,579,775 A220P probably damaging Het
Chpf C G 1: 75,475,458 A613P probably benign Het
Chpf G C 1: 75,475,470 L609V probably damaging Het
Chrna2 C A 14: 66,149,304 L300M probably damaging Het
Chrna5 G T 9: 55,004,482 G189C probably damaging Het
Chrna7 A T 7: 63,212,184 L40Q probably damaging Het
Chst3 T A 10: 60,185,676 R450W possibly damaging Het
Chst4 A C 8: 110,030,092 F380V probably damaging Het
Chsy1 C G 7: 66,172,226 S736R probably damaging Het
Cic A C 7: 25,271,019 E58D possibly damaging Het
Cidea A G 18: 67,358,853 K61R probably null Het
Ciita C A 16: 10,508,700 P252T probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cipc G T 12: 86,960,337 G103C probably damaging Het
Cit G C 5: 115,986,603 G1526R probably damaging Het
Cited4 C A 4: 120,666,814 H4Q probably damaging Het
Ckap2 G A 8: 22,169,794 P557L probably damaging Het
Ckap2l C A 2: 129,285,362 D299Y probably damaging Het
Clca1 G T 3: 145,013,921 S429R probably damaging Het
Clcn1 T C 6: 42,307,567 V613A probably damaging Het
Cldn11 T A 3: 31,150,306 W53R probably damaging Het
Cldn18 T A 9: 99,698,847 K116M possibly damaging Het
Cldn23 A T 8: 35,826,277 L19Q probably damaging Het
Cldn34b1 T G X: 154,887,708 K5T probably benign Het
Clec4d T G 6: 123,274,686 F176V probably benign Het
Clic1 G T 17: 35,052,459 G22W probably damaging Het
Clic6 G A 16: 92,498,895 D148N probably benign Het
Clip3 A C 7: 30,298,838 E236D probably benign Het
Clk1 C A 1: 58,417,372 R186L probably benign Het
Clstn3 C T 6: 124,459,200 V234M probably damaging Het
Cltc A G 11: 86,702,632 V1525A probably benign Het
Cmklr1 T A 5: 113,613,891 S350C probably damaging Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
Cmya5 C G 13: 93,096,790 D597H unknown Het
Cnksr1 A T 4: 134,232,135 L396Q probably damaging Het
Cnksr3 C T 10: 7,134,544 R308Q probably damaging Het
Cnnm4 G T 1: 36,505,751 R697L possibly damaging Het
Cnot1 C G 8: 95,748,277 Q1103H possibly damaging Het
Cnot8 C G 11: 58,113,090 A117G probably benign Het
Cnppd1 C A 1: 75,140,951 G42V probably damaging Het
Cntn2 C A 1: 132,527,788 R237L probably damaging Het
Cntn3 T G 6: 102,437,931 probably null Het
Cntn4 T G 6: 106,509,464 N284K probably benign Het
Cntn4 T G 6: 106,523,563 F334V probably benign Het
Cntnap1 C A 11: 101,182,898 T625K probably damaging Het
Cntnap2 A C 6: 47,271,148 K1163Q probably benign Het
Cntnap3 AC A 13: 64,740,872 probably null Het
Cntnap3 T G 13: 64,792,388 N332H probably damaging Het
Cntnap4 A T 8: 112,858,189 K1086M possibly damaging Het
Cntnap5a T A 1: 116,428,516 V759E probably damaging Het
Cntnap5b C A 1: 99,967,270 T89K probably damaging Het
Cntnap5b C A 1: 100,164,228 S231R possibly damaging Het
Cntnap5b C G 1: 100,446,840 Q734E probably benign Het
Cobl G T 11: 12,253,433 Q1090K probably benign Het
Cobl C A 11: 12,369,645 E244D probably damaging Het
Cobl G A 11: 12,375,827 A223V probably damaging Het
Cog1 C A 11: 113,651,982 H151Q probably damaging Het
Coil C A 11: 88,981,976 P388T probably damaging Het
Col10a1 C A 10: 34,395,178 P382H probably damaging Het
Col11a2 G T 17: 34,056,402 G420C unknown Het
Col16a1 G C 4: 130,072,878 G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,649,429 probably benign Het
Col18a1 G C 10: 77,055,709 A1097G possibly damaging Het
Col18a1 C A 10: 77,112,851 A276S unknown Het
Col1a2 A C 6: 4,532,750 T792P unknown Het
Col23a1 G T 11: 51,549,708 D142Y unknown Het
Col24a1 G A 3: 145,342,498 G619S probably damaging Het
Col25a1 AC A 3: 130,182,795 probably null Het
Col27a1 C G 4: 63,225,788 S571C probably damaging Het
Col5a1 G A 2: 28,002,517 R1014H unknown Het
Col5a2 C A 1: 45,376,146 V1478L possibly damaging Het
Col5a2 C A 1: 45,383,680 G1126C probably damaging Het
Col5a2 C G 1: 45,396,484 G697A probably benign Het
Col6a4 T C 9: 106,000,797 S1994G probably benign Het
Col6a4 G C 9: 106,000,870 C1969W probably damaging Het
Col6a6 G C 9: 105,780,952 A687G probably damaging Het
Col9a1 C A 1: 24,214,588 P464H probably damaging Het
Col9a2 C G 4: 121,053,797 A543G probably damaging Het
Colec11 C A 12: 28,595,284 Q129H probably damaging Het
Commd10 G T 18: 46,990,566 G163* probably null Het
Commd2 C A 3: 57,646,857 R141L probably damaging Het
Copb2 A C 9: 98,586,146 K737T probably benign Het
Coq3 C A 4: 21,899,102 P145H probably damaging Het
Coq4 G T 2: 29,795,449 Q158H probably null Het
Coq6 G C 12: 84,370,963 A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,467,865 probably null Het
Cox6a1 C T 5: 115,345,908 G92S probably damaging Het
Cox6b2 C A 7: 4,752,147 V43L probably benign Het
Cpeb1 C A 7: 81,359,728 probably null Het
Cpeb2 G T 5: 43,234,717 G419C Het
Cpne1 C A 2: 156,077,644 D302Y probably damaging Het
Cpq A C 15: 33,381,391 D300A probably damaging Het
Cps1 G T 1: 67,123,268 G35V possibly damaging Het
Cps1 CTT CT 1: 67,148,719 probably null Het
Cpsf4 A T 5: 145,167,415 E20V possibly damaging Het
Cr2 G T 1: 195,154,153 Q901K probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crb2 C T 2: 37,776,371 P11S probably benign Het
Crebl2 G T 6: 134,849,289 E68* probably null Het
Crem T A 18: 3,267,730 E258V probably damaging Het
Crispld1 C A 1: 17,728,613 probably benign Het
Crispld1 G T 1: 17,752,851 A381S possibly damaging Het
Crtac1 T G 19: 42,287,926 E521A probably benign Het
Cry1 C A 10: 85,144,197 V416L probably benign Het
Crybg2 C A 4: 134,082,660 P1241H probably damaging Het
Cryz A T 3: 154,621,769 T277S probably benign Het
Csmd1 T C 8: 15,998,814 D2296G probably damaging Het
Csmd1 T A 8: 16,037,198 T1946S probably damaging Het
Cspg5 G T 9: 110,251,050 A429S probably damaging Het
Ctbp2 C A 7: 133,015,290 probably benign Het
Ctf2 T A 7: 127,719,456 I124F possibly damaging Het
Ctps G C 4: 120,542,743 D472E probably benign Het
Ctsf C A 19: 4,856,306 Q155K probably benign Het
Ctsj C T 13: 61,004,115 E43K probably damaging Het
Ctsq C A 13: 61,037,123 V250L probably benign Het
Cttnbp2 C A 6: 18,408,709 S971I probably benign Het
Cttnbp2 C A 6: 18,408,725 G966C possibly damaging Het
Cttnbp2 G T 6: 18,420,836 A892E possibly damaging Het
Cttnbp2 C A 6: 18,501,960 E60* probably null Het
Cubn T A 2: 13,381,825 E1543V probably damaging Het
Cul9 C A 17: 46,520,576 G1571* probably null Het
Cul9 C A 17: 46,520,585 G1568* probably null Het
Cutal G T 2: 34,882,425 R67I probably damaging Het
Cux2 C A 5: 121,873,813 G520* probably null Het
Cux2 G T 5: 121,885,934 T92K probably benign Het
Cxcr1 A T 1: 74,192,392 L157* probably null Het
Cyb561d2 G C 9: 107,540,296 C85W probably damaging Het
Cybb T C X: 9,438,240 I564V probably damaging Het
Cybb G A X: 9,440,001 H494Y probably damaging Het
Cyfip2 G A 11: 46,222,615 S968F not run Het
Cylc1 G A X: 111,123,146 V399I unknown Het
Cyp11b1 T A 15: 74,839,355 K158I probably damaging Het
Cyp19a1 T A 9: 54,176,599 K169* probably null Het
Cyp1a1 C A 9: 57,700,594 S168R probably benign Het
Cyp26b1 T C 6: 84,577,114 S174G probably benign Het
Cyp2a4 G T 7: 26,307,323 G36* probably null Het
Cyp2a4 C T 7: 26,310,841 P264S probably damaging Het
Cyp2a5 A C 7: 26,835,497 N45T probably damaging Het
Cyp2a5 G A 7: 26,836,774 R148H probably damaging Het
Cyp2c29 G A 19: 39,324,997 M351I probably benign Het
Cyp2c54 G A 19: 40,046,215 P337L probably damaging Het
Cyp2c55 C T 19: 39,035,513 R344C probably benign Het
Cyp2j11 T G 4: 96,307,303 E385D probably damaging Het
Cyp2j11 G T 4: 96,307,436 S341Y probably damaging Het
Cyp2j5 G T 4: 96,629,506 P490T probably damaging Het
Cyp2j6 C A 4: 96,536,068 G151* probably null Het
Cyp39a1 A C 17: 43,725,577 I333L probably benign Het
Cyp39a1 A C 17: 43,731,048 E382A probably damaging Het
Cyp3a44 T C 5: 145,791,664 K250R probably benign Het
Cyp4a10 G T 4: 115,518,326 S2I probably damaging Het
Cyp4a12a G T 4: 115,329,003 probably null Het
Cyp4a14 G C 4: 115,490,017 A408G probably benign Het
Cyp4a30b G T 4: 115,470,959 R475L possibly damaging Het
Cypt14 T C X: 39,863,555 K10R possibly damaging Het
Cypt15 A C X: 39,346,384 K33T possibly damaging Het
Cypt2 G T X: 105,499,799 R3L probably benign Het
Cyth2 C A 7: 45,813,105 R24L possibly damaging Het
Cytip C A 2: 58,134,037 S257I probably damaging Het
Cytl1 G T 5: 37,735,695 A50S probably benign Het
D430041D05Rik C A 2: 104,154,935 L1262F probably damaging Het
D430041D05Rik C A 2: 104,256,856 A592S probably benign Het
D5Ertd579e C G 5: 36,615,762 E430Q probably benign Het
D930020B18Rik C A 10: 121,667,616 A232D probably benign Het
Dab1 G C 4: 104,728,078 V472L probably benign Het
Dab2ip G T 2: 35,708,868 D191Y probably damaging Het
Dapk1 AC A 13: 60,760,804 probably null Het
Dars C A 1: 128,372,207 E347* probably null Het
Daw1 C G 1: 83,180,391 L54V probably damaging Het
Daw1 C A 1: 83,183,300 T121K probably damaging Het
Daw1 A C 1: 83,209,255 K262T probably damaging Het
Dbh T A 2: 27,177,727 L454Q probably damaging Het
Dcaf12l1 G A X: 44,789,897 T8M probably benign Het
Dcaf8 G T 1: 172,172,929 R218L probably benign Het
Dcdc2c G T 12: 28,524,707 P139T probably benign Het
Dcxr GA G 11: 120,727,208 probably null Het
Ddhd2 C T 8: 25,735,829 M500I possibly damaging Het
Ddo C A 10: 40,647,933 H306Q probably damaging Het
Ddr2 T C 1: 169,984,955 Y656C probably damaging Het
Ddr2 G T 1: 169,998,083 T316N probably benign Het
Ddr2 T G 1: 169,998,084 T316P probably benign Het
Ddx51 G T 5: 110,654,558 E176* probably null Het
Deaf1 C T 7: 141,301,474 W573* probably null Het
Dedd2 C A 7: 25,203,598 R312L probably damaging Het
Def8 G T 8: 123,459,966 E428D possibly damaging Het
Defa21 T G 8: 21,025,723 F46V probably benign Het
Defa27 C A 8: 21,315,597 Q18K probably damaging Het
Defa27 A G 8: 21,315,598 Q18R probably damaging Het
Defb14 G T 8: 19,195,120 G38C probably damaging Het
Defb21 C A 2: 152,573,833 P22H unknown Het
Defb26 C T 2: 152,508,301 probably null Het
Dennd4b T G 3: 90,279,495 L1425R probably damaging Het
Depdc5 A T 5: 32,943,282 M846L possibly damaging Het
Dffb G T 4: 153,972,843 L126M probably damaging Het
Dgat2l6 C A X: 100,524,950 Q10K probably benign Het
Dgcr14 C T 16: 17,902,310 G393S possibly damaging Het
Dgcr8 C T 16: 18,278,318 probably null Het
Dgkb A G 12: 37,981,996 Q19R possibly damaging Het
Dgkb C A 12: 38,136,613 L254M probably damaging Het
Dgkd A C 1: 87,927,810 S725R probably benign Het
Dgkg C A 16: 22,588,398 A146S probably benign Het
Dglucy A C 12: 100,853,304 K425T probably benign Het
Dhx30 C A 9: 110,086,965 G722C probably damaging Het
Dhx34 G A 7: 16,218,644 R19* probably null Het
Dhx57 T G 17: 80,245,805 K1231T probably damaging Het
Diaph3 C A 14: 86,656,432 C1136F probably benign Het
Dicer1 C G 12: 104,731,020 A93P probably null Het
Dip2a T A 10: 76,266,323 S1446C possibly damaging Het
Dip2a T G 10: 76,280,820 T890P probably damaging Het
Disp3 G T 4: 148,250,957 P908T probably damaging Het
Dlc1 C A 8: 36,584,211 G338C probably damaging Het
Dlec1 C A 9: 119,138,786 P1218T probably benign Het
Dlg4 G A 11: 70,041,920 G512E probably benign Het
Dlgap1 C T 17: 70,815,209 P878S probably damaging Het
Dll4 G T 2: 119,326,052 probably benign Het
Dmbt1 T G 7: 131,088,812 I925S unknown Het
Dmd A G X: 83,627,286 K225R probably damaging Het
Dmd A T X: 83,878,484 L1453F possibly damaging Het
Dmkn G T 7: 30,776,497 W25L possibly damaging Het
Dmrt1 C T 19: 25,559,970 T307I possibly damaging Het
Dmrt2 T C 19: 25,678,000 L321P probably damaging Het
Dmrtb1 T A 4: 107,680,830 D47V probably damaging Het
Dnaaf1 A C 8: 119,575,441 D27A possibly damaging Het
Dnaaf2 G C 12: 69,197,850 H146D probably damaging Het
Dnah10 G T 5: 124,775,355 A1883S probably benign Het
Dnah11 C T 12: 117,931,177 R3645H possibly damaging Het
Dnah11 A C 12: 118,127,119 I1030S probably benign Het
Dnah11 A T 12: 118,130,799 L845M probably damaging Het
Dnah14 G C 1: 181,757,351 E3216Q possibly damaging Het
Dnah17 G T 11: 118,127,166 L168M probably benign Het
Dnah2 G A 11: 69,421,821 A4306V possibly damaging Het
Dnah2 G T 11: 69,451,120 Q2986K probably benign Het
Dnah2 G C 11: 69,487,054 N1317K possibly damaging Het
Dnah2 G A 11: 69,498,667 H800Y probably benign Het
Dnah2 T G 11: 69,516,481 Y492S probably damaging Het
Dnah2 C G 11: 69,516,523 G478A probably damaging Het
Dnah3 A G 7: 119,967,803 V13A Het
Dnah6 T A 6: 73,087,783 E2605D possibly damaging Het
Dnah6 G T 6: 73,133,559 T1681K probably benign Het
Dnah7a A C 1: 53,419,699 L3760R probably damaging Het
Dnah7a T G 1: 53,483,463 K2872T probably damaging Het
Dnah7c T A 1: 46,467,302 L180M probably benign Het
Dnah7c G T 1: 46,615,281 G107V probably damaging Het
Dnah7c G C 1: 46,639,665 V1790L probably benign Het
Dnah7c A T 1: 46,646,992 probably null Het
Dnah7c T C 1: 46,760,316 F3379L possibly damaging Het
Dnah8 A G 17: 30,648,540 K322R probably benign Het
Dnah9 T A 11: 65,895,972 I3612F probably damaging Het
Dnah9 G T 11: 65,927,853 L3220M probably damaging Het
Dnah9 A T 11: 65,970,084 L2820Q probably damaging Het
Dnah9 T A 11: 66,037,474 Q2123L probably damaging Het
Dnah9 C A 11: 66,072,835 G1764V probably damaging Het
Dnaic1 G T 4: 41,614,323 R333L probably benign Het
Dnajb6 G A 5: 29,752,445 G75D possibly damaging Het
Dnajb8 A T 6: 88,222,910 M143L possibly damaging Het
Dnajc1 C T 2: 18,293,987 A259T possibly damaging Het
Dnajc11 G A 4: 151,933,783 D11N probably benign Het
Dnajc28 G A 16: 91,617,033 H108Y probably benign Het
Dner C A 1: 84,383,980 R636L possibly damaging Het
Dnhd1 A T 7: 105,668,547 K483M probably damaging Het
Dnhd1 G T 7: 105,678,299 K50N probably benign Het
Dnhd1 A T 7: 105,703,036 probably null Het
Dnhd1 GT GTT 7: 105,703,580 probably null Het
Dnmbp T A 19: 43,866,688 K265N probably damaging Het
Dnmbp T A 19: 43,889,367 T422S probably benign Het
Dnmt1 T G 9: 20,915,863 K979T probably damaging Het
Dnmt1 C A 9: 20,926,554 V381L probably benign Het
Dnmt3a G T 12: 3,904,201 W791L probably damaging Het
Doc2b A T 11: 75,777,072 L284Q probably benign Het
Dock10 A C 1: 80,560,954 L959V probably benign Het
Dock11 G T X: 35,984,848 A699S possibly damaging Het
Dock2 A C 11: 34,718,924 F230V probably benign Het
Dock4 A T 12: 40,631,614 Y104F probably benign Het
Dock4 G C 12: 40,631,616 V105L probably benign Het
Dock7 C A 4: 98,945,225 G1945V unknown Het
Dock9 C A 14: 121,651,782 G308C probably benign Het
Dopey2 T A 16: 93,769,581 S1083R probably benign Het
Dopey2 G T 16: 93,803,546 S2037I probably damaging Het
Dopey2 G A 16: 93,807,868 G2132E possibly damaging Het
Dpagt1 G T 9: 44,329,125 V213L probably benign Het
Dpp10 C A 1: 123,353,440 E627* probably null Het
Dpp3 T G 19: 4,922,341 Q185P probably damaging Het
Dpp6 C A 5: 27,398,998 A142E probably damaging Het
Dpysl5 G T 5: 30,778,120 R189L probably benign Het
Drd2 G T 9: 49,395,655 E14* probably null Het
Dsc1 C A 18: 20,114,538 A7S probably benign Het
Dsc2 A T 18: 20,035,299 L701Q probably damaging Het
Dsg1c G T 18: 20,283,573 G844C probably damaging Het
Dsg2 C A 18: 20,580,621 F216L probably damaging Het
Dsp C G 13: 38,197,190 T2637R possibly damaging Het
Dst C G 1: 34,165,143 A806G probably benign Het
Dst G T 1: 34,188,467 E1714* probably null Het
Dst G C 1: 34,244,445 E3330D probably benign Het
Dst A G 1: 34,275,208 K4397E probably damaging Het
Dtx1 T C 5: 120,683,295 S396G probably benign Het
Dtx3l C G 16: 35,932,457 C593S probably damaging Het
Dtx3l G C 16: 35,933,183 S351C probably damaging Het
Dtx4 C G 19: 12,491,909 A285P probably benign Het
Duox1 G T 2: 122,333,038 G784W probably damaging Het
Duox2 T C 2: 122,296,507 T176A probably damaging Het
Dusp8 C A 7: 142,081,943 G637W unknown Het
Dusp8 C G 7: 142,090,077 R33P probably damaging Het
Dvl1 G T 4: 155,855,611 G400V probably benign Het
Dvl3 G C 16: 20,530,881 A535P probably damaging Het
Dydc2 C A 14: 41,061,983 R61L probably benign Het
Dync1i2 G T 2: 71,247,884 V306L probably benign Het
Dync2h1 G T 9: 7,142,361 P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 probably null Het
Dyrk1a A T 16: 94,691,762 H618L probably benign Het
Dyrk4 T G 6: 126,892,128 K240N probably damaging Het
Dysf T A 6: 84,072,685 L372H probably damaging Het
Dzip1l G T 9: 99,641,761 G205V possibly damaging Het
E030025P04Rik C A 11: 109,143,971 Q30H unknown Het
E130114P18Rik G T 4: 97,569,200 P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 C615F probably damaging Het
E230025N22Rik T A 18: 36,695,824 probably benign Het
E2f6 A C 12: 16,820,273 K142T possibly damaging Het
E4f1 G A 17: 24,446,145 S355L probably benign Het
Ears2 C G 7: 122,044,581 G385R probably damaging Het
Ears2 C G 7: 122,055,710 A112P possibly damaging Het
Ebna1bp2 A C 4: 118,621,146 K44T probably damaging Het
Ece1 T G 4: 137,921,027 F32V probably benign Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Edil3 G C 13: 88,944,870 G40R probably benign Het
Eef2 G T 10: 81,181,158 probably null Het
Efcab3 C A 11: 105,100,046 A93D probably damaging Het
Efcab3 T G 11: 105,108,772 Y162* probably null Het
Efcab5 C G 11: 77,132,139 D583H probably damaging Het
Efcc1 G T 6: 87,732,796 E257D probably benign Het
Efs C A 14: 54,920,336 V173L probably benign Het
Egf C A 3: 129,697,717 probably null Het
Ehbp1 G C 11: 22,095,590 P720A probably benign Het
Ehbp1l1 T A 19: 5,717,889 M1129L probably benign Het
Ehd3 C A 17: 73,805,285 P15T probably benign Het
Ehf C A 2: 103,279,518 G115C probably null Het
Eif2a G T 3: 58,548,884 V435L probably benign Het
Eif2d A T 1: 131,164,465 K324N probably damaging Het
Eif2d C G 1: 131,164,502 P337A probably damaging Het
Eif3i C A 4: 129,600,575 probably benign Het
Eif4e2 G A 1: 87,225,939 M155I probably benign Het
Eif4g1 G T 16: 20,673,408 probably benign Het
Eipr1 G T 12: 28,859,287 Q184H probably benign Het
Ell A C 8: 70,578,927 S92R probably damaging Het
Ell2 A C 13: 75,756,452 K220T probably damaging Het
Ell2 A T 13: 75,770,689 N605Y probably damaging Het
Elmod1 T G 9: 53,946,860 K2T probably benign Het
Elmsan1 T A 12: 84,173,499 Q227L probably damaging Het
Elmsan1 G T 12: 84,173,501 H226Q probably damaging Het
Elovl5 G C 9: 77,976,755 R111P possibly damaging Het
Eme1 A C 11: 94,650,696 I100S possibly damaging Het
Eml4 G C 17: 83,445,965 R355T probably damaging Het
Enam C A 5: 88,492,971 P164H probably damaging Het
Eng C G 2: 32,671,422 I148M possibly damaging Het
Eng G T 2: 32,673,424 G331C probably null Het
Eng G C 2: 32,681,452 R618P probably damaging Het
Enpp3 T G 10: 24,787,793 T557P probably benign Het
Entpd1 G T 19: 40,738,964 A519S probably benign Het
Entpd7 G C 19: 43,725,358 L385F probably benign Het
Ep400 A C 5: 110,756,635 L33V unknown Het
Epas1 C T 17: 86,827,946 S669L possibly damaging Het
Epb41l2 G T 10: 25,441,720 G45V probably benign Het
Epb41l2 A T 10: 25,499,902 R80* probably null Het
Epc2 G T 2: 49,535,300 G396C probably damaging Het
Epha10 T C 4: 124,883,942 W50R probably damaging Het
Epha10 G C 4: 124,885,775 G138A probably damaging Het
Epha3 G T 16: 63,585,012 P695Q probably damaging Het
Epha4 T C 1: 77,373,733 *987W probably null Het
Epha4 T G 1: 77,383,011 K735T probably damaging Het
Epha5 C T 5: 84,071,120 D765N possibly damaging Het
Epha8 C A 4: 136,938,696 R383L probably benign Het
Ephb1 G A 9: 102,223,398 P38L probably damaging Het
Ephb3 G T 16: 21,218,036 G337V possibly damaging Het
Ephx3 T G 17: 32,185,237 N343T probably damaging Het
Epop C A 11: 97,628,410 R291L probably damaging Het
Eral1 T G 11: 78,075,620 K244T probably damaging Het
Erap1 T A 13: 74,657,638 L166H probably damaging Het
Erbb4 CA CAA 1: 68,298,402 probably null Het
Erbb4 G T 1: 68,328,259 S433* probably null Het
Ercc2 A C 7: 19,385,668 S136R probably benign Het
Ercc6 A T 14: 32,526,487 S332C probably benign Het
Ereg G T 5: 91,090,120 G155V possibly damaging Het
Erg T G 16: 95,361,317 Q317P probably damaging Het
Erg T G 16: 95,409,750 Q81P possibly damaging Het
Erh C A 12: 80,642,804 L15F probably benign Het
Erich2 C A 2: 70,509,114 D4E possibly damaging Het
Erich3 T G 3: 154,698,701 I65S Het
Erich3 G T 3: 154,762,430 V840L Het
Ero1l G A 14: 45,299,890 P193L probably damaging Het
Esp18 C T 17: 39,408,166 L19F probably damaging Het
Esrp1 C T 4: 11,384,396 G96R probably damaging Het
Esrp1 A T 4: 11,385,765 L34Q possibly damaging Het
Etv4 C T 11: 101,770,590 V412M probably damaging Het
Exoc3l G T 8: 105,290,794 S546Y possibly damaging Het
Exoc3l2 C A 7: 19,480,061 L471M probably null Het
Exoc3l4 G T 12: 111,423,720 W243L probably damaging Het
Exoc8 C T 8: 124,896,666 V321I possibly damaging Het
Eya1 G C 1: 14,252,430 A270G probably benign Het
Eya1 G T 1: 14,302,868 P9Q probably damaging Het
F5 C G 1: 164,184,516 F434L probably damaging Het
F830045P16Rik G T 2: 129,536,530 probably benign Het
Fabp1 A T 6: 71,199,955 Q10L possibly damaging Het
Fads1 T A 19: 10,193,704 L299M probably damaging Het
Fads3 A T 19: 10,041,807 I26F probably benign Het
Faf1 A G 4: 109,840,356 D293G probably damaging Het
Fam109a G C 5: 121,852,907 A111P probably damaging Het
Fam124a T C 14: 62,606,408 M455T probably benign Het
Fam124b A C 1: 80,213,403 F88V possibly damaging Het
Fam149a C A 8: 45,342,458 R672L possibly damaging Het
Fam160a1 G T 3: 85,673,201 L566I probably benign Het
Fam160b2 G T 14: 70,586,204 S575R not run Het
Fam161b G T 12: 84,356,053 Q268K probably benign Het
Fam166b G T 4: 43,427,171 S87Y Het
Fam166b A G 4: 43,427,172 S87P Het
Fam170a C A 18: 50,281,584 A99D possibly damaging Het
Fam170b A C 14: 32,835,804 N199H probably damaging Het
Fam171a2 C G 11: 102,447,446 A24P unknown Het
Fam196a G T 7: 134,918,706 L32I probably damaging Het
Fam208a G A 14: 27,429,208 G47D probably damaging Het
Fam208a T G 14: 27,477,148 L1341R probably damaging Het
Fam208b C A 13: 3,576,636 V1105L probably benign Het
Fam208b C A 13: 3,588,429 R434M probably damaging Het
Fam213b A C 4: 154,898,989 L6R probably damaging Het
Fam240a T G 9: 110,916,509 K29T probably damaging Het
Fam3b C A 16: 97,481,844 R77L probably damaging Het
Fam46b G T 4: 133,486,682 R288L probably damaging Het
Fam47e G T 5: 92,579,668 R145L possibly damaging Het
Fam71a C T 1: 191,163,745 V234I probably benign Het
Fam83g C A 11: 61,707,470 P728T probably benign Het
Fance T G 17: 28,318,064 L14R probably damaging Het
Fancm A C 12: 65,094,926 E440D probably benign Het
Fap C A 2: 62,528,774 S428I possibly damaging Het
Farp2 T C 1: 93,580,136 F519L probably benign Het
Farp2 G C 1: 93,580,461 G627A probably benign Het
Farp2 G T 1: 93,580,467 G629V probably benign Het
Fat1 G A 8: 44,950,598 D129N probably benign Het
Fat1 A C 8: 45,023,596 H1893P possibly damaging Het
Fat1 G T 8: 45,036,838 D3596Y probably damaging Het
Fat2 A G 11: 55,282,795 L2364P probably damaging Het
Fat2 G T 11: 55,284,991 A1632E probably damaging Het
Fat2 T G 11: 55,303,700 K1171T probably damaging Het
Fat2 T G 11: 55,310,121 H709P probably damaging Het
Fat3 G T 9: 15,947,526 P3798Q probably damaging Het
Fat3 G T 9: 16,375,429 P933T probably damaging Het
Fat3 T G 9: 16,375,617 H870P probably benign Het
Fat4 G T 3: 38,983,359 G3720V probably benign Het
Fat4 C G 3: 38,983,815 P3872R probably damaging Het
Fblim1 C T 4: 141,595,371 A34T possibly damaging Het
Fbn1 C T 2: 125,387,350 G504S possibly damaging Het
Fbxl16 G C 17: 25,817,011 G194A possibly damaging Het
Fbxl18 T G 5: 142,886,424 K352T possibly damaging Het
Fbxl19 CT C 7: 127,761,275 probably null Het
Fbxl21 C A 13: 56,527,003 L56I probably benign Het
Fbxl22 G T 9: 66,511,888 R156S probably benign Het
Fbxl4 T C 4: 22,427,280 L507P probably damaging Het
Fbxo17 G C 7: 28,732,777 G93A unknown Het
Fbxo24 T G 5: 137,621,403 K187T probably damaging Het
Fbxo28 T A 1: 182,317,870 I218F probably damaging Het
Fbxo30 A T 10: 11,295,320 E714V probably damaging Het
Fbxo32 C A 15: 58,205,242 D115Y probably damaging Het
Fbxo40 T A 16: 36,969,599 D383V probably damaging Het
Fbxo42 T G 4: 141,180,534 probably null Het
Fbxw19 T C 9: 109,481,582 K424R probably benign Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fbxw25 C A 9: 109,651,738 W291C Het
Fdx1l C A 9: 21,073,492 M5I probably benign Het
Fer1l5 C A 1: 36,390,563 Y465* probably null Het
Fermt1 C G 2: 132,906,756 G649A probably damaging Het
Fermt1 G T 2: 132,936,018 P177Q probably benign Het
Fermt1 G T 2: 132,941,943 Q49K probably benign Het
Ffar3 A T 7: 30,855,193 F234Y probably damaging Het
Fgd3 C A 13: 49,281,826 D319Y probably damaging Het
Fgd5 A C 6: 91,988,889 K701T probably damaging Het
Fgr C A 4: 133,000,170 H461N probably benign Het
Fibcd1 G A 2: 31,838,539 T102I probably benign Het
Flg A C 3: 93,279,962 R240S probably benign Het
Flii C A 11: 60,722,313 G221C possibly damaging Het
Flnb T G 14: 7,942,066 I2348S probably benign Het
Flot1 A C 17: 35,825,823 K219T probably damaging Het
Flrt2 G T 12: 95,778,912 W8L possibly damaging Het
Flrt2 G T 12: 95,779,559 G224C probably damaging Het
Flywch1 A C 17: 23,761,009 W264G probably benign Het
Fmn2 G T 1: 174,608,394 V644L unknown Het
Fmo2 G T 1: 162,887,598 Q152K probably benign Het
Fmo2 C A 1: 162,898,274 G11V probably damaging Het
Fmo6 G C 1: 162,926,132 S147* probably null Het
Fmod T G 1: 134,040,919 Y232* probably null Het
Fn1 C G 1: 71,597,411 G2194A probably benign Het
Fndc1 C A 17: 7,773,593 G424* probably null Het
Fndc1 T G 17: 7,804,877 K82T possibly damaging Het
Fndc3a C A 14: 72,567,373 K489N probably damaging Het
Fndc3c1 G T X: 106,434,329 P767T not run Het
Foxd1 G C 13: 98,355,938 G440A unknown Het
Foxd3 C A 4: 99,657,066 P148T probably damaging Het
Foxf1 G T 8: 121,084,529 R44L probably damaging Het
Foxi1 G T 11: 34,207,488 P179H probably damaging Het
Foxi3 G A 6: 70,956,798 A90T probably benign Het
Foxj2 A T 6: 122,832,936 probably null Het
Foxj2 G T 6: 122,833,711 A217S probably benign Het
Foxo3 T TG 10: 42,275,265 probably null Het
Fpgs C T 2: 32,692,660 R67H probably benign Het
Fpr3 C A 17: 17,970,993 H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,113,393 W278C probably benign Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frem1 C A 4: 82,999,983 G574V probably damaging Het
Frem3 C A 8: 80,611,503 R142S probably damaging Het
Frem3 T C 8: 80,615,431 L1451P probably benign Het
Frg1 T A 8: 41,399,638 R186* probably null Het
Frmd4a A G 2: 4,498,021 D107G probably damaging Het
Frmpd3 G T X: 140,433,010 E1575* probably null Het
Fryl T C 5: 73,072,837 D1659G probably benign Het
Fscb T G 12: 64,472,930 E587D unknown Het
Fsd2 T C 7: 81,553,192 E213G probably damaging Het
Fshr C G 17: 89,046,667 A88P probably benign Het
Fsip1 G T 2: 118,136,483 L454I possibly damaging Het
Fsip2 G T 2: 82,989,665 M5247I probably benign Het
Fstl3 G C 10: 79,781,198 V192L probably benign Het
Fstl5 A T 3: 76,707,982 K783N probably damaging Het
Fubp1 G A 3: 152,222,087 G391D probably damaging Het
Fxn C G 19: 24,262,042 R162P probably damaging Het
Fyb2 G C 4: 104,913,660 Q57H probably damaging Het
Gabpb2 G T 3: 95,190,693 T223N probably benign Het
Gabra3 C T X: 72,445,353 S322N probably damaging Het
Gabra4 G T 5: 71,623,895 A391D probably benign Het
Gabrp T C 11: 33,552,673 E397G probably benign Het
Gabrr3 C A 16: 59,407,482 S34* probably null Het
Gadd45a C A 6: 67,036,736 G109V probably benign Het
Gal3st2b T G 1: 93,938,685 L36R probably damaging Het
Galm C G 17: 80,183,233 T273S possibly damaging Het
Galnt9 CG C 5: 110,596,146 probably null Het
Galntl5 C A 5: 25,203,189 P220T probably damaging Het
Galntl6 A C 8: 57,857,558 Y370D probably damaging Het
Garem1 T G 18: 21,129,792 K655T probably damaging Het
Garem1 G A 18: 21,148,325 H325Y probably damaging Het
Gatad2a T A 8: 69,936,038 probably null Het
Gba A T 3: 89,204,005 K26* probably null Het
Gbp3 G A 3: 142,561,863 V34M probably damaging Het
Gck C A 11: 5,906,526 M210I probably damaging Het
Gckr G T 5: 31,300,831 R172I probably damaging Het
Gdap1l1 G T 2: 163,447,670 R185L probably damaging Het
Gdf10 C T 14: 33,932,532 T332M possibly damaging Het
Gdf15 T C 8: 70,629,890 S189G probably benign Het
Gdf7 C T 12: 8,298,409 R304H unknown Het
Gdf7 G T 12: 8,298,578 P240T unknown Het
Gdf9 C A 11: 53,437,525 T436K probably damaging Het
Gemin4 G T 11: 76,217,579 probably benign Het
Gga3 T G 11: 115,587,603 Q454H probably benign Het
Ggt5 A G 10: 75,602,618 probably null Het
Ggt7 T A 2: 155,491,078 R622W probably damaging Het
Ggt7 T A 2: 155,499,063 N394I probably damaging Het
Gh G C 11: 106,301,184 R67G probably damaging Het
Ghdc A G 11: 100,769,417 L168P probably benign Het
Ghr A G 15: 3,347,485 Y85H probably benign Het
Gimap1 A C 6: 48,743,249 K265T probably damaging Het
Gimap1 T G 6: 48,743,356 *301E probably null Het
Gimap7 C A 6: 48,724,153 D224E probably benign Het
Gins3 G T 8: 95,633,520 probably benign Het
Gjc1 C A 11: 102,800,008 G390W unknown Het
Glcci1 A T 6: 8,582,674 Q345L possibly damaging Het
Glipr1 G T 10: 111,988,837 P155T probably benign Het
Glis3 G C 19: 28,283,768 P791R possibly damaging Het
Glra3 G T 8: 56,062,500 M203I probably benign Het
Gls C G 1: 52,214,488 D274H probably damaging Het
Gm10300 C G 4: 132,074,809 P38R unknown Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10324 G A 13: 66,122,469 R483K probably benign Het
Gm10324 T A 13: 66,122,673 F551Y probably benign Het
Gm10340 A G 14: 3,134,911 R60G possibly damaging Het
Gm10803 G C 2: 93,564,136 Q84H unknown Het
Gm11565 C T 11: 99,914,851 S23F possibly damaging Het
Gm11567 G A 11: 99,879,332 S32N unknown Het
Gm11567 C A 11: 99,879,421 Q62K unknown Het
Gm11567 C A 11: 99,879,625 Q130K unknown Het
Gm11639 G C 11: 105,001,967 G4247R probably benign Het
Gm11983 T G 11: 6,836,861 K89Q unknown Het
Gm11983 T C 11: 6,837,047 K27E unknown Het
Gm12185 T G 11: 48,908,086 I527L probably benign Het
Gm12888 G T 4: 121,324,808 P29H probably damaging Het
Gm13089 G C 4: 143,696,945 H425D probably benign Het
Gm13103 A G 4: 143,853,110 S422G probably benign Het
Gm13178 C A 4: 144,703,325 G365W probably damaging Het
Gm13212 G C 4: 145,622,968 S325T possibly damaging Het
Gm15130 A G 2: 111,144,587 probably null Het
Gm16503 A C 4: 147,541,156 T36P unknown Het
Gm17019 C T 5: 15,032,997 probably benign Het
Gm17124 A G 14: 42,597,223 probably null Het
Gm19410 G T 8: 35,792,611 W800L possibly damaging Het
Gm21083 T G 5: 15,577,458 V41G probably benign Het
Gm21149 G T 5: 15,472,148 A236D probably damaging Het
Gm21149 G C 5: 15,476,412 R18G not run Het
Gm21190 G A 5: 15,524,894 P242L probably benign Het
Gm21190 A C 5: 15,524,974 D215E not run Het
Gm21190 G T 5: 15,526,580 T136N probably benign Het
Gm21680 C T 5: 25,971,419 S60N probably benign Het
Gm21886 G C 18: 80,089,387 Y185* probably null Het
Gm21886 G T 18: 80,089,923 L14M probably damaging Het
Gm28729 C T 9: 96,492,088 R401H unknown Het
Gm29609 A T 5: 31,154,242 W852R probably benign Het
Gm29797 G C 2: 181,659,095 A128P probably damaging Het
Gm30302 T C 13: 49,785,384 D950G possibly damaging Het
Gm30302 T C 13: 49,786,462 R591G possibly damaging Het
Gm30302 A C 13: 49,787,848 L39V probably damaging Het
Gm3238 G T 10: 77,771,024 P101Q unknown Het
Gm32742 G A 9: 51,159,165 Q76* probably null Het
Gm3285 G A 10: 77,862,434 C139Y unknown Het
Gm3543 T G 14: 41,981,007 N60T probably damaging Het
Gm364 T A X: 57,417,721 N140K probably benign Het
Gm364 T C X: 57,463,184 F487L probably benign Het
Gm3776 T A 9: 78,258,763 C18S probably benign Het
Gm4450 G T 3: 98,456,455 Q25K probably benign Het
Gm45618 T C 7: 142,120,218 K171R unknown Het
Gm45861 G A 8: 27,584,869 G1416S unknown Het
Gm4737 T C 16: 46,154,229 M262V probably benign Het
Gm4779 G T X: 101,792,186 P504H unknown Het
Gm4788 G T 1: 139,698,256 R827S probably benign Het
Gm4788 G C 1: 139,733,448 C554W probably damaging Het
Gm47985 T C 1: 151,183,141 S178P possibly damaging Het
Gm4858 G T 3: 93,074,055 G53W probably damaging Het
Gm49336 C A 14: 60,239,502 C240F probably null Het
Gm5111 C A 6: 48,590,309 L153M unknown Het
Gm5538 C A 3: 59,747,194 Q150K probably benign Het
Gm5592 C G 7: 41,286,317 T81R probably damaging Het
Gm5592 G A 7: 41,286,319 E82K possibly damaging Het
Gm5592 C A 7: 41,288,681 D462E probably benign Het
Gm5862 TGGG TGG 5: 26,018,487 probably null Het
Gm5936 T G X: 74,842,035 V347G probably benign Het
Gm6377 T G X: 109,198,293 L160R probably damaging Het
Gm6588 T C 5: 112,449,875 V96A probably benign Het
Gm6614 A G 6: 141,990,348 F357S probably benign Het
Gm6871 C A 7: 41,546,413 G300V probably damaging Het
Gm7138 C G 10: 77,776,853 C31S unknown Het
Gm7145 A C 1: 117,986,351 K321T probably benign Het
Gm7298 A C 6: 121,764,870 E417A probably benign Het
Gm7298 G T 6: 121,764,875 D419Y possibly damaging Het
Gm732 A C X: 107,945,825 I494S possibly damaging Het
Gm7534 C G 4: 134,200,338 R368P possibly damaging Het
Gm7534 A G 4: 134,202,677 S106P probably benign Het
Gm7579 G T 7: 142,211,941 G28V unknown Het
Gm8369 G C 19: 11,511,624 A92P probably damaging Het
Gm853 T A 4: 130,221,704 H17L probably benign Het
Gm8693 T C 7: 22,691,842 K159R probably benign Het
Gm884 C T 11: 103,613,681 G2487D probably benign Het
Gm8879 C G 5: 11,130,351 N75K probably benign Het
Gm8994 G C 6: 136,329,023 A161P possibly damaging Het
Gm9112 G A X: 102,707,027 T72M probably benign Het
Gm9513 A C 9: 36,476,511 N31T probably damaging Het
Gm9573 G T 17: 35,621,245 S683Y unknown Het
Gm960 G T 19: 4,625,903 R734S unknown Het
Gm973 T G 1: 59,524,602 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9887 C A 12: 69,371,941 W173L not run Het
Gm9964 T C 11: 79,296,400 R74G unknown Het
Gm9992 C A 17: 7,376,530 G127W probably damaging Het
Gmip C T 8: 69,816,292 R496W probably damaging Het
Gmpr2 T G 14: 55,672,743 L10R probably benign Het
Gna12 T A 5: 140,760,553 Q379L probably damaging Het
Gna12 C A 5: 140,762,607 D185Y probably damaging Het
Gnas C A 2: 174,298,606 P249T unknown Het
Gnptab G T 10: 88,431,368 E440D probably damaging Het
Gpa33 C A 1: 166,164,671 C261* probably null Het
Gpat2 C A 2: 127,430,882 F171L probably benign Het
Gpat2 G C 2: 127,433,808 G502A probably damaging Het
Gpat4 C G 8: 23,179,798 S313T probably benign Het
Gpatch1 C A 7: 35,310,485 G55C probably damaging Het
Gpc5 T A 14: 115,369,964 L326Q probably damaging Het
Gpd1l C A 9: 114,904,780 G283W probably damaging Het
Gpnmb C A 6: 49,051,832 A428D possibly damaging Het
Gpr101 T G X: 57,501,274 H172P probably benign Het
Gpr158 G T 2: 21,810,690 probably null Het
Gpr179 G C 11: 97,336,648 S1560R probably benign Het
Gpr26 C A 7: 131,967,048 P41T probably damaging Het
Gpr26 C G 7: 131,967,225 L100V probably damaging Het
Gpr39 G T 1: 125,872,843 G444W probably damaging Het
Gprasp2 G T X: 135,842,893 G334W probably damaging Het
Gprin1 C A 13: 54,740,397 Q21H probably benign Het
Gpsm1 G T 2: 26,327,345 Q408H possibly damaging Het
Grb10 C A 11: 11,944,845 A359S possibly damaging Het
Grb7 G T 11: 98,453,971 probably null Het
Grb7 G C 11: 98,454,484 G456R probably damaging Het
Greb1 C A 12: 16,696,756 C1171F probably benign Het
Greb1l G C 18: 10,515,305 G699A probably damaging Het
Gria3 C A X: 41,478,647 A113D probably benign Het
Grid2 G A 6: 63,908,879 M86I possibly damaging Het
Grid2 A G 6: 64,663,228 Q810R probably benign Het
Grik5 T A 7: 25,013,804 D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,297,907 probably null Het
Grin3a A G 4: 49,770,622 S717P probably damaging Het
Grip1 C A 10: 119,819,483 probably benign Het
Grip2 G C 6: 91,763,510 P1023A possibly damaging Het
Grk2 C G 19: 4,287,645 M568I probably benign Het
Grk3 C A 5: 112,957,314 probably null Het
Grm5 G T 7: 87,602,715 G58W probably damaging Het
Grm6 C A 11: 50,859,537 P509H probably benign Het
Grm7 A G 6: 111,358,149 E507G probably benign Het
Grm7 G T 6: 111,358,490 V621F probably damaging Het
Grm8 G C 6: 28,126,027 S33R probably benign Het
Grpr A G X: 163,515,034 L338P probably damaging Het
Grtp1 T G 8: 13,200,199 I17L probably benign Het
Gsdma C A 11: 98,669,759 P179H probably damaging Het
Gsk3b A T 16: 38,208,070 K297* probably null Het
Gspt2 GC G X: 94,637,468 probably null Het
Gtf2h3 G T 5: 124,579,175 probably benign Het
Gtf2i C A 5: 134,263,645 G415V probably null Het
Gtf2ird1 T G 5: 134,409,312 probably null Het
Gtf3a G A 5: 146,951,204 C105Y probably damaging Het
Gtf3c1 T A 7: 125,703,964 I100F probably damaging Het
Gtse1 A G 15: 85,868,746 K354R possibly damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 K400T probably damaging Het
Gulp1 C A 1: 44,788,479 D260E probably damaging Het
Gxylt2 T G 6: 100,783,191 L229R probably damaging Het
Gykl1 A G 18: 52,694,547 K276E probably damaging Het
H2-Eb2 A C 17: 34,334,309 E156D possibly damaging Het
H2-M11 A C 17: 36,548,770 R218S possibly damaging Het
H2-Q2 A C 17: 35,345,675 Q351P probably damaging Het
H2-T3 C G 17: 36,186,580 L382F possibly damaging Het
H2-T3 A T 17: 36,186,582 L382M possibly damaging Het
Habp2 T C 19: 56,317,760 V426A probably damaging Het
Hacd1 C A 2: 14,035,795 M216I probably damaging Het
Hacd2 G T 16: 35,106,325 Q231H probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Hal G A 10: 93,489,893 M89I probably benign Het
Hbb-bt A G 7: 103,813,892 probably benign Het
Hc T A 2: 35,006,273 probably null Het
Hcar1 T A 5: 123,879,741 probably benign Het
Hcfc2 G C 10: 82,699,172 R10T probably damaging Het
Hcls1 G T 16: 36,961,492 R321M possibly damaging Het
Hcn4 G T 9: 58,858,148 G638C unknown Het
Hdac1 T A 4: 129,542,616 Q5L probably benign Het
Hdac9 G T 12: 34,373,987 T536K probably benign Het
Hdgfl2 G T 17: 56,079,825 R24L possibly damaging Het
Hdgfl2 G T 17: 56,097,016 A281S probably null Het
Heatr1 T G 13: 12,399,008 N155K possibly damaging Het
Hecw1 G A 13: 14,300,333 A540V possibly damaging Het
Hells G T 19: 38,965,407 R765S possibly damaging Het
Helq C A 5: 100,766,766 L953F possibly damaging Het
Helz2 G C 2: 181,237,564 P754A probably benign Het
Heph G C X: 96,554,922 E919Q probably damaging Het
Herc1 A C 9: 66,434,576 E1882D probably benign Het
Herc2 G A 7: 56,097,533 V473I possibly damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herc2 G T 7: 56,132,498 G1311V probably damaging Het
Herc3 G T 6: 58,843,858 E76* probably null Het
Herc4 T G 10: 63,307,749 I686S probably benign Het
Herc6 G T 6: 57,600,031 G243V probably damaging Het
Herpud2 C G 9: 25,130,622 V85L not run Het
Hexdc C A 11: 121,215,237 P117T probably damaging Het
Hip1r A G 5: 123,997,010 Q403R probably damaging Het
Hist1h1b T C 13: 21,780,094 K154R unknown Het
Hist1h4i C A 13: 22,041,214 R37L probably damaging Het
Hist2h2ab G T 3: 96,220,051 A46S probably benign Het
Hivep3 C T 4: 120,133,782 R2160W probably damaging Het
Hlcs A C 16: 94,262,659 L367R probably damaging Het
Hmcn1 G T 1: 150,586,445 Q5161K probably null Het
Hmcn1 A G 1: 150,655,921 V3199A possibly damaging Het
Hmcn1 A G 1: 150,663,917 V2941A probably benign Het
Hmcn2 G C 2: 31,344,029 D269H possibly damaging Het
Hmcn2 C A 2: 31,425,416 L3726M probably damaging Het
Hmcn2 G T 2: 31,429,091 R3934S probably damaging Het
Hmga2 G C 10: 120,370,671 P113A unknown Het
Hmgcs2 G A 3: 98,290,945 G55S probably damaging Het
Hmx2 A T 7: 131,554,467 E54V probably damaging Het
Hnf1a CA C 5: 114,950,124 probably null Het
Hnrnpa2b1 G T 6: 51,467,243 T20N probably damaging Het
Hnrnpf G A 6: 117,923,784 G10S probably benign Het
Hnrnph2 G T X: 134,605,133 E76* probably null Het
Hnrnpu T G 1: 178,332,215 N434H unknown Het
Hnrnpul1 C A 7: 25,724,664 S721I probably benign Het
Hnrnpul1 G C 7: 25,724,698 P710A unknown Het
Hoxb1 C A 11: 96,367,051 P269Q probably benign Het
Hoxd9 G C 2: 74,698,128 A25P probably damaging Het
Hp1bp3 C T 4: 138,221,673 L16F not run Het
Hpd C A 5: 123,181,475 G49V probably damaging Het
Hps1 C A 19: 42,766,686 R272S probably null Het
Hsd17b13 G T 5: 103,968,705 P184T probably benign Het
Hsd17b3 C T 13: 64,063,138 G182S possibly damaging Het
Hsd3b1 T G 3: 98,852,886 Q263P probably damaging Het
Hsd3b2 C T 3: 98,712,222 E136K probably benign Het
Hsd3b3 A G 3: 98,743,960 V58A probably benign Het
Hsdl2 A T 4: 59,617,706 K478* probably null Het
Hspa1l G C 17: 34,978,492 K502N possibly damaging Het
Htr1f G T 16: 64,926,077 S284* probably null Het
Htr1f G T 16: 64,926,874 N18K probably benign Het
Htr7 G T 19: 35,969,423 T397N probably damaging Het
Htra2 C A 6: 83,054,383 R15L probably benign Het
Hunk C A 16: 90,472,573 P335H probably damaging Het
Huwe1 C A X: 151,856,575 H356N probably damaging Het
Huwe1 A C X: 151,928,381 K3958T unknown Het
Hyal4 G A 6: 24,756,628 V282M probably damaging Het
Hydin T G 8: 110,541,600 F2904V possibly damaging Het
Hyou1 G T 9: 44,387,742 E621* probably null Het
Ice1 C A 13: 70,605,201 C922F probably damaging Het
Ide C T 19: 37,315,491 V238M Het
Idh3b T A 2: 130,281,542 probably null Het
Ifi204 C A 1: 173,751,628 K550N probably null Het
Ifi206 T G 1: 173,482,048 K127N Het
Ifi27l2b C A 12: 103,457,033 G7C unknown Het
Ifi44 A G 3: 151,732,453 L399P probably damaging Het
Ifih1 T G 2: 62,617,469 Q297P probably benign Het
Ifitm1 C A 7: 140,969,517 T71K probably benign Het
Ifna5 C T 4: 88,835,999 H159Y probably damaging Het
Ifnab T G 4: 88,690,718 E170D probably damaging Het
Ift122 A C 6: 115,915,994 D854A probably damaging Het
Ift172 C A 5: 31,276,924 W490L probably damaging Het
Igfbp4 C G 11: 99,051,515 P234R probably damaging Het
Igfn1 G T 1: 135,972,000 H524Q probably damaging Het
Ighv1-12 C A 12: 114,616,013 G63V possibly damaging Het
Ighv14-4 C A 12: 114,176,667 C41F probably damaging Het
Ighv14-4 C G 12: 114,176,672 L39F probably damaging Het
Ighv1-52 C A 12: 115,145,777 V21F probably damaging Het
Ighv1-63 C T 12: 115,495,645 A111T possibly damaging Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv1-9 T G 12: 114,583,834 E29A probably benign Het
Igkv1-35 C T 6: 70,011,034 G93R possibly damaging Het
Igkv1-99 T A 6: 68,542,262 S68T Het
Igkv3-12 A T 6: 70,518,611 I41F probably benign Het
Igkv4-74 T C 6: 69,185,345 Q6R possibly damaging Het
Igkv6-32 T A 6: 70,074,586 probably benign Het
Igsf21 A T 4: 140,067,215 C116S probably damaging Het
Igsf5 C G 16: 96,391,023 S274C probably damaging Het
Igsf8 G T 1: 172,318,354 A406S probably damaging Het
Igsf9 G C 1: 172,492,149 G337A probably damaging Het
Igsf9 G T 1: 172,495,226 A586S probably benign Het
Igsf9b A G 9: 27,317,353 probably null Het
Ihh T G 1: 74,946,094 S411R probably damaging Het
Ik G T 18: 36,753,515 D347Y possibly damaging Het
Ikbkap T A 4: 56,790,146 T315S probably benign Het
Ikzf1 G T 11: 11,758,194 probably null Het
Ikzf3 T G 11: 98,467,181 E443D probably benign Het
Ikzf4 G A 10: 128,634,230 P527S possibly damaging Het
Il10ra A C 9: 45,266,632 S67A possibly damaging Het
Il16 C G 7: 83,652,827 S727T probably benign Het
Il17rc G T 6: 113,476,795 probably null Het
Il1rap G T 16: 26,722,399 R463S probably damaging Het
Il27ra C A 8: 84,040,990 W101C probably damaging Het
Il2ra C A 2: 11,681,931 A191D probably damaging Het
Il6st A G 13: 112,493,618 K333E probably benign Het
Impg1 C G 9: 80,378,467 R418S probably benign Het
Incenp C A 19: 9,877,687 W620L unknown Het
Inhbb C A 1: 119,417,798 V254L probably benign Het
Inpp4b C G 8: 82,069,001 A818G possibly damaging Het
Inpp5b CA C 4: 124,797,840 probably null Het
Inpp5d T G 1: 87,669,709 F201V probably benign Het
Inpp5d T G 1: 87,703,131 L671W probably damaging Het
Inpp5j G T 11: 3,502,484 Y255* probably null Het
Insc C T 7: 114,811,639 Q244* probably null Het
Insm1 C T 2: 146,223,556 Q431* probably null Het
Ints12 A C 3: 133,102,464 D201A probably damaging Het
Ints6l G A X: 56,497,935 M527I probably damaging Het
Ints9 G A 14: 65,037,454 V620I probably benign Het
Ipo13 C A 4: 117,904,630 E458* probably null Het
Ipp G T 4: 116,537,885 G539V probably null Het
Iqca A T 1: 90,045,725 V775E probably benign Het
Iqcf3 G T 9: 106,560,988 P12Q unknown Het
Iqck C A 7: 118,941,654 R259S probably benign Het
Iqgap1 C A 7: 80,768,309 K104N probably benign Het
Iqgap2 A G 13: 95,731,443 I219T possibly damaging Het
Irgq G T 7: 24,531,801 G139V probably damaging Het
Irs2 T G 8: 11,006,185 D749A probably damaging Het
Irx6 C A 8: 92,678,371 P289H possibly damaging Het
Isl2 C A 9: 55,542,215 C58* probably null Het
Ism1 A C 2: 139,731,874 N48T probably benign Het
Itga7 A C 10: 128,953,827 K1012T probably benign Het
Itga8 A C 2: 12,247,518 F294V probably damaging Het
Itga8 C A 2: 12,262,136 A163S probably benign Het
Itga8 C A 2: 12,301,832 probably benign Het
Itga9 A C 9: 118,843,530 D790A probably benign Het
Itga9 G A 9: 118,887,839 V990M probably damaging Het
Itgad T A 7: 128,190,087 N574K probably damaging Het
Itgax G C 7: 128,144,872 R909T probably benign Het
Itgb2 A T 10: 77,557,962 Q412L probably benign Het
Itgb3 G T 11: 104,643,623 K435N possibly damaging Het
Itgb4 G A 11: 116,006,520 G1536R probably damaging Het
Itgb6 G C 2: 60,611,468 S666C possibly damaging Het
Itgbl1 G T 14: 123,954,672 G373C probably damaging Het
Itih4 GAA G 14: 30,899,462 probably null Het
Itm2c G A 1: 85,906,527 V188M possibly damaging Het
Itpka G C 2: 119,742,800 S141T probably damaging Het
Itpkc C A 7: 27,227,638 D284Y probably benign Het
Itpr1 T A 6: 108,499,149 W2275R probably damaging Het
Ivd G T 2: 118,876,344 K272N possibly damaging Het
Ivns1abp A G 1: 151,351,033 E12G probably damaging Het
Jak1 C A 4: 101,163,681 G654V probably damaging Het
Jak1 C T 4: 101,163,722 M640I probably benign Het
Jak2 G A 19: 29,271,398 E92K possibly damaging Het
Jak3 C G 8: 71,680,683 A340G possibly damaging Het
Jakmip3 G T 7: 139,020,133 R254L probably benign Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jph1 C T 1: 17,097,352 E85K possibly damaging Het
Jph4 G A 14: 55,113,648 R304C probably benign Het
Jun T A 4: 95,051,378 probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,778,294 probably null Het
Kat6a C G 8: 22,910,154 C310W probably damaging Het
Katna1 G T 10: 7,759,785 S328I probably damaging Het
Katnal2 T C 18: 77,012,057 K127R probably benign Het
Kbtbd2 T G 6: 56,780,309 E147D probably damaging Het
Kcna3 A T 3: 107,037,266 N282Y probably damaging Het
Kcna5 T A 6: 126,533,716 K483M probably damaging Het
Kcnb1 G T 2: 167,188,402 D74E probably damaging Het
Kcne2 C T 16: 92,296,591 A2V probably benign Het
Kcnh1 C A 1: 192,418,737 R573S probably damaging Het
Kcnh8 C A 17: 52,894,061 L508I probably damaging Het
Kcnj2 G T 11: 111,072,135 V118L probably benign Het
Kcnk18 G T 19: 59,234,959 A179S probably benign Het
Kcnq4 A C 4: 120,698,497 probably null Het
Kcns1 G A 2: 164,168,633 H69Y probably benign Het
Kcnt1 G C 2: 25,906,796 R809P probably benign Het
Kcnt2 G C 1: 140,376,361 W156C probably damaging Het
Kcnv2 G T 19: 27,323,438 A230S probably benign Het
Kcp T A 6: 29,485,012 E1247V probably benign Het
Kctd1 C T 18: 15,063,125 S147N unknown Het
Kctd12 C G 14: 102,981,918 G175R not run Het
Kctd19 A C 8: 105,385,136 F842V probably damaging Het
Kdm3b G T 18: 34,809,069 E738* probably null Het
Kdm4a C T 4: 118,153,190 E619K probably benign Het
Kdm4a T A 4: 118,177,502 S11C probably benign Het
Kdm5b G A 1: 134,625,035 D1250N probably damaging Het
Kel G T 6: 41,687,572 P644T probably damaging Het
Khdc1c G T 1: 21,369,563 E113* probably null Het
Khdrbs2 G T 1: 32,333,662 W139L unknown Het
Khdrbs3 T C 15: 69,017,467 L155P probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 T G 4: 63,171,997 E3D possibly damaging Het
Kif13b C G 14: 64,803,344 P1627R probably benign Het
Kif14 A T 1: 136,496,653 Q1002L probably damaging Het
Kif14 G T 1: 136,500,016 probably null Het
Kif18a G A 2: 109,318,053 G631R possibly damaging Het
Kif19a A T 11: 114,786,590 E600V probably damaging Het
Kif19a C A 11: 114,789,829 A925E probably benign Het
Kif1a G C 1: 93,021,316 L1495V probably damaging Het
Kif1a G A 1: 93,022,491 R1405W probably damaging Het
Kif1a G A 1: 93,055,697 P693S probably benign Het
Kif1b T G 4: 149,266,298 K273T possibly damaging Het
Kif20b C G 19: 34,952,875 S1260C probably benign Het
Kif21b C A 1: 136,154,137 T641K probably benign Het
Kif26a G C 12: 112,177,618 E1435D probably damaging Het
Kif28 T G 1: 179,733,134 K202T probably benign Het
Kif2b C A 11: 91,576,264 E398* probably null Het
Kirrel2 T C 7: 30,453,457 T379A probably benign Het
Klf17 G T 4: 117,760,351 R270S probably benign Het
Klhdc7a G T 4: 139,967,797 probably benign Het
Klhdc8b T A 9: 108,448,377 Q326L probably benign Het
Klhl18 C G 9: 110,437,347 A300P probably null Het
Klhl2 C A 8: 64,758,126 R296L probably damaging Het
Klhl22 G A 16: 17,776,696 D230N probably benign Het
Klhl30 C G 1: 91,359,465 A491G probably damaging Het
Klhl6 G T 16: 19,953,674 T307N probably damaging Het
Klk8 C A 7: 43,803,725 R247S possibly damaging Het
Klkb1 G T 8: 45,273,629 R446S probably damaging Het
Klra1 C G 6: 130,372,851 W208S probably damaging Het
Klra3 C A 6: 130,335,721 E27* probably null Het
Klra5 G C 6: 129,911,452 P4A not run Het
Klrb1a GT G 6: 128,618,585 probably null Het
Kmt2a C A 9: 44,847,979 D858Y probably damaging Het
Kmt2b C A 7: 30,577,370 R1674L probably damaging Het
Kmt2c G C 5: 25,354,413 A1076G probably damaging Het
Kmt5b G T 19: 3,793,118 G72* probably null Het
Kng1 G T 16: 23,079,616 V589L probably benign Het
Kpna6 T A 4: 129,648,078 S509C possibly damaging Het
Kpna6 C A 4: 129,655,548 W147L probably damaging Het
Krt12 C A 11: 99,420,761 E205* probably null Het
Krt17 T G 11: 100,260,923 K15Q probably benign Het
Krt222 A T 11: 99,238,552 L143Q probably damaging Het
Krt24 C G 11: 99,284,886 G108R unknown Het
Krt25 C G 11: 99,322,822 A24P probably benign Het
Krt27 C A 11: 99,348,978 E253D probably damaging Het
Krt33a C A 11: 100,011,914 E361D probably benign Het
Krt34 G T 11: 100,041,434 C21* probably null Het
Krt82 C T 15: 101,541,852 V470I probably benign Het
Krtap1-3 A G 11: 99,590,995 C109R possibly damaging Het
Krtap16-1 C T 11: 99,985,597 R327Q possibly damaging Het
Krtap21-1 C A 16: 89,403,581 G58C unknown Het
Krtap28-13 G T 1: 83,061,090 C32F unknown Het
Krtap3-1 G C 11: 99,566,567 A6G probably benign Het
Krtap4-2 C A 11: 99,634,976 G17C unknown Het
Krtap6-1 G C 16: 89,031,809 C31S unknown Het
Krtap7-1 C A 16: 89,508,260 M1I probably null Het
Ksr1 C A 11: 79,020,751 R735L possibly damaging Het
Ksr1 C A 11: 79,027,600 R576L probably benign Het
Kyat1 G T 2: 30,187,732 T175N probably damaging Het
L2hgdh C T 12: 69,707,132 S233N probably benign Het
L3mbtl4 G T 17: 68,425,687 W54L probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lamb1 A T 12: 31,327,702 S1697C possibly damaging Het
Lamb2 G T 9: 108,482,901 G419C probably damaging Het
Lamc2 C A 1: 153,133,621 V813L probably benign Het
Lamp2 T C X: 38,424,381 S332G probably damaging Het
Lao1 C A 4: 118,968,440 H486N probably damaging Het
Large2 G C 2: 92,370,198 T87R probably benign Het
Lats1 G T 10: 7,705,809 G786V probably damaging Het
Lbp T A 2: 158,325,762 L402Q probably damaging Het
Lcn11 G T 2: 25,777,724 K41N probably benign Het
Lct C A 1: 128,287,611 E1743* probably null Het
Ldb3 C G 14: 34,555,365 A351P probably benign Het
Ldhd G T 8: 111,627,520 T382N probably damaging Het
Lect2 A T 13: 56,548,361 M1K probably null Het
Lef1 C A 3: 131,200,323 A344D probably damaging Het
Lep G C 6: 29,070,970 A98P possibly damaging Het
Lepr C A 4: 101,745,614 P200T probably damaging Het
Lexm G T 4: 106,607,300 D387E probably benign Het
Lgr5 C A 10: 115,460,876 R382M probably damaging Het
Lhcgr T G 17: 88,742,270 K609N probably damaging Het
Lhx3 G T 2: 26,203,987 R77S probably damaging Het
Lhx4 C A 1: 155,705,255 A175S probably damaging Het
Lilra6 C T 7: 3,915,074 probably null Het
Lingo3 G C 10: 80,834,855 Q414E possibly damaging Het
Lins1 C G 7: 66,710,264 A263G possibly damaging Het
Lipf T A 19: 33,965,595 L101Q probably damaging Het
Lipo3 A C 19: 33,584,928 L14R probably null Het
Lipo4 C A 19: 33,503,184 M261I probably benign Het
Lipt1 G A 1: 37,875,903 V347I probably benign Het
Llgl2 G T 11: 115,849,554 E359* probably null Het
Lman2l C A 1: 36,428,376 G197V probably damaging Het
Lmnb2 C G 10: 80,903,238 G594R probably damaging Het
Lmo7 C A 14: 101,884,306 P269Q probably damaging Het
Lmo7 A T 14: 101,919,281 T1296S probably benign Het
Lmo7 G A 14: 101,919,443 E1350K unknown Het
Lmo7 T C 14: 101,929,228 S1548P unknown Het
Lmx1a A T 1: 167,691,999 K32M possibly damaging Het
Lnp1 C T 16: 56,927,903 D9N possibly damaging Het
Lox T G 18: 52,520,834 T397P probably damaging Het
Lpar5 C A 6: 125,081,379 T21K possibly damaging Het
Lpar5 T G 6: 125,082,072 L252R probably damaging Het
Lpgat1 T G 1: 191,778,475 F391V probably benign Het
Lpin2 C G 17: 71,225,211 S225* probably null Het
Lpin3 C G 2: 160,899,785 P492A probably damaging Het
Lpp G C 16: 24,761,603 S148T probably benign Het
Lpxn C A 19: 12,824,947 A212D probably damaging Het
Lrba G C 3: 86,715,538 C2409S probably benign Het
Lrba G T 3: 86,751,532 G2569C possibly damaging Het
Lrch3 A C 16: 32,914,316 T59P possibly damaging Het
Lrfn1 A G 7: 28,459,115 E153G possibly damaging Het
Lrig1 G T 6: 94,609,026 T727N possibly damaging Het
Lrp1 C G 10: 127,554,962 C3022S probably damaging Het
Lrp12 A T 15: 39,878,123 F418I probably damaging Het
Lrp1b A C 2: 40,677,506 L4070V Het
Lrp1b T A 2: 40,697,582 D3887V Het
Lrp1b C A 2: 40,922,383 E2517D Het
Lrp1b G T 2: 41,728,710 N231K Het
Lrp2 C G 2: 69,480,042 G2729A possibly damaging Het
Lrp2 A T 2: 69,507,881 V1185E possibly damaging Het
Lrp6 C T 6: 134,456,157 G1404R possibly damaging Het
Lrpprc C G 17: 84,770,431 A359P possibly damaging Het
Lrrc15 C G 16: 30,274,252 A90P probably benign Het
Lrrc18 C G 14: 33,009,200 P232R probably benign Het
Lrrc20 A G 10: 61,527,165 K63R probably damaging Het
Lrrc27 C A 7: 139,242,720 P509Q probably damaging Het
Lrrc30 C T 17: 67,632,436 V50I probably benign Het
Lrrc37a C A 11: 103,456,486 D3128Y probably damaging Het
Lrrc37a G T 11: 103,499,034 A1855D possibly damaging Het
Lrrc37a T G 11: 103,501,094 E1168D probably benign Het
Lrrc49 T A 9: 60,677,221 Q186L probably damaging Het
Lrrc4b G A 7: 44,445,123 V72M probably damaging Het
Lrrc4b GC G 7: 44,461,312 probably null Het
Lrrc59 A C 11: 94,643,321 K235T probably benign Het
Lrrc8e A T 8: 4,234,822 E349V probably damaging Het
Lrrc9 A G 12: 72,477,393 K791R probably damaging Het
Lrrd1 C T 5: 3,850,025 P110L probably benign Het
Lrrfip1 G T 1: 91,101,199 M68I possibly damaging Het
Lrrfip2 C A 9: 111,161,340 A43E probably damaging Het
Lrriq1 T A 10: 103,202,359 Q861L probably damaging Het
Lrriq1 G T 10: 103,202,360 Q861K probably damaging Het
Lrriq1 G T 10: 103,234,085 S23R probably damaging Het
Lrrtm2 T C 18: 35,214,659 probably benign Het
Lrrtm3 C A 10: 64,089,355 G11V probably damaging Het
Lrsam1 C G 2: 32,941,814 R383P probably damaging Het
Lrwd1 G A 5: 136,134,008 R120C probably damaging Het
Ltbp2 G C 12: 84,875,853 R147G probably benign Het
Luc7l2 G T 6: 38,551,908 G21* probably null Het
Ly9 G T 1: 171,594,060 T541K probably damaging Het
Lyg1 C A 1: 37,947,177 G159C probably null Het
Lyg2 C A 1: 37,911,127 C40F probably damaging Het
Lyst T C 13: 13,640,107 L1149S probably damaging Het
Lyst C G 13: 13,777,079 A3755G probably benign Het
M1ap A T 6: 82,968,042 R106* probably null Het
Macrod2 G T 2: 140,706,208 G93V probably damaging Het
Macrod2 T A 2: 141,024,090 C123S probably damaging Het
Madd C A 2: 91,159,272 G1129V probably damaging Het
Mafg T G 11: 120,629,528 Q82P probably damaging Het
Mageb18 G A X: 92,119,896 P247S probably damaging Het
Magi2 C A 5: 20,702,109 Q1094K probably benign Het
Magohb C A 6: 131,288,063 W79C probably damaging Het
Malrd1 C A 2: 16,217,845 Q2015K unknown Het
Mamdc2 A C 19: 23,334,057 F478V possibly damaging Het
Man1a G T 10: 53,919,315 P523Q probably damaging Het
Man1b1 G C 2: 25,344,983 R270T possibly damaging Het
Man2b1 A C 8: 85,093,938 D618A probably damaging Het
Manba G T 3: 135,563,274 G647* probably null Het
Map1a G T 2: 121,303,238 G1512C possibly damaging Het
Map2k5 C A 9: 63,358,038 R69S probably damaging Het
Map3k13 G T 16: 21,905,162 G298V probably damaging Het
Map3k14 G T 11: 103,225,496 T702K probably benign Het
Map3k14 T G 11: 103,231,073 E506A probably benign Het
Map3k7 T G 4: 32,015,963 I496S probably damaging Het
Map3k9 C A 12: 81,772,782 D233Y possibly damaging Het
Map4k3 C G 17: 80,618,337 A410P possibly damaging Het
Map6 G C 7: 99,317,660 E565D probably damaging Het
Mapk10 A T 5: 102,991,887 L166Q probably damaging Het
Mapk4 A G 18: 73,937,184 W213R probably damaging Het
Mapk8 G T 14: 33,410,886 P31H probably damaging Het
March4 C T 1: 72,452,500 C204Y probably damaging Het
Marf1 C A 16: 14,115,777 Q1582H probably benign Het
Mast1 T G 8: 84,912,459 S1414R probably damaging Het
Mast1 G C 8: 84,918,681 R712G probably damaging Het
Mast4 C G 13: 102,738,460 E1467Q probably damaging Het
Mat1a A T 14: 41,105,510 probably benign Het
Mat2b C G 11: 40,682,485 Q233H probably damaging Het
Mat2b T A 11: 40,687,777 S28C probably benign Het
Matn1 T A 4: 130,946,105 L128Q probably damaging Het
Mavs G T 2: 131,240,401 W68C probably damaging Het
Mbd5 A C 2: 49,279,308 N1497T probably benign Het
Mbip T G 12: 56,340,385 E156D probably damaging Het
Mbnl2 G C 14: 120,403,359 A346P probably benign Het
Mboat2 G T 12: 24,948,344 A282S possibly damaging Het
Mcm3 C A 1: 20,820,181 V10L probably benign Het
Mcm8 G T 2: 132,827,567 G319* probably null Het
Mcm9 C A 10: 53,537,507 R492S unknown Het
Mcoln3 C G 3: 146,140,466 H510Q probably benign Het
Mcts1 A C X: 38,601,941 K8N possibly damaging Het
Mdga2 C A 12: 66,689,443 G337V probably damaging Het
Mdh1b G T 1: 63,711,531 T426K probably benign Het
Mdh2 C A 5: 135,789,629 S246Y probably damaging Het
Mdn1 A G 4: 32,667,102 N189S probably benign Het
Mdn1 G T 4: 32,668,944 G334V probably damaging Het
Mdn1 A C 4: 32,696,244 N1209T probably damaging Het
Med1 C A 11: 98,161,183 V452L possibly damaging Het
Med12 G T X: 101,281,225 D679Y probably damaging Het
Med12 G T X: 101,293,573 Q1902H possibly damaging Het
Med12l C A 3: 59,091,417 N599K probably damaging Het
Med12l C A 3: 59,244,943 L1050I probably damaging Het
Med12l C A 3: 59,296,117 P2020Q probably benign Het
Med13 T A 11: 86,328,544 S359C possibly damaging Het
Med13 T A 11: 86,345,862 K156N probably benign Het
Med13 T G 11: 86,355,423 D51A probably damaging Het
Medag G T 5: 149,427,507 probably null Het
Mef2b G C 8: 70,166,375 R202S probably damaging Het
Mefv C A 16: 3,715,455 E317D possibly damaging Het
Megf10 C G 18: 57,277,694 P692A probably damaging Het
Meis1 C A 11: 19,014,317 G105V probably damaging Het
Mep1a C G 17: 43,477,320 R628T probably benign Het
Mepce C A 5: 137,785,842 G74V probably damaging Het
Mettl25 C A 10: 105,826,098 R337I possibly damaging Het
Mettl4 T G 17: 94,733,563 T388P probably benign Het
Mettl7b G T 10: 128,958,748 P236T probably damaging Het
Mex3d C G 10: 80,386,713 E236D Het
Mfsd11 G C 11: 116,863,940 A226P probably damaging Het
Mfsd13b G A 7: 120,991,677 V214I probably benign Het
Mfsd2a G C 4: 122,951,839 T173S probably benign Het
Mfsd2a G T 4: 122,959,311 L62M possibly damaging Het
Mfsd2b C A 12: 4,866,530 probably null Het
Mfsd4b2 C T 10: 39,921,600 S253N probably benign Het
Mfsd4b4 G T 10: 39,892,599 P212H possibly damaging Het
Mfsd4b5 G C 10: 39,986,390 L46V probably damaging Het
Mgam G T 6: 40,677,644 probably null Het
Mgam G T 6: 40,729,066 R23L probably damaging Het
Mgat4d G C 8: 83,348,521 V13L probably benign Het
Mgat4d A C 8: 83,368,112 K259N probably benign Het
Mia2 G T 12: 59,108,124 D208Y probably benign Het
Mia2 C G 12: 59,108,801 D433E probably damaging Het
Mib2 G C 4: 155,661,141 A71G probably benign Het
Midn G A 10: 80,153,628 G142E probably benign Het
Mier2 C A 10: 79,540,501 V197L unknown Het
Mill1 A T 7: 18,245,499 probably benign Het
Mkln1 A C 6: 31,398,921 K22T possibly damaging Het
Mkln1 G T 6: 31,451,554 G273C probably damaging Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mkrn3 C T 7: 62,419,810 G78R probably benign Het
Mmel1 C T 4: 154,895,208 R762* probably null Het
Mmp10 G T 9: 7,508,205 probably null Het
Mmp24 G A 2: 155,810,392 G340E probably damaging Het
Mmp25 C G 17: 23,630,659 C586S probably damaging Het
Mmp7 G C 9: 7,695,602 G160A probably damaging Het
Mmrn1 C G 6: 60,945,034 D158E probably benign Het
Mn1 C G 5: 111,420,379 S738R probably benign Het
Mn1 A C 5: 111,454,706 K1270T possibly damaging Het
Mnt C T 11: 74,836,675 P129L probably damaging Het
Mnx1 C A 5: 29,474,088 E332D unknown Het
Mnx1 C A 5: 29,474,174 E304* probably null Het
Moap1 C G 12: 102,743,075 E72Q probably damaging Het
Mocos A T 18: 24,670,633 H337L probably benign Het
Mogs G T 6: 83,116,213 G181W probably damaging Het
Mon1b G C 8: 113,637,809 E73Q probably benign Het
Morc1 G T 16: 48,587,058 V646L probably benign Het
Mpig6b C A 17: 35,065,340 G158V probably damaging Het
Mpp3 G T 11: 102,008,356 H419N probably damaging Het
Mprip G T 11: 59,737,404 G226W possibly damaging Het
Mprip A T 11: 59,759,484 Q1338L probably benign Het
Mpv17l G T 16: 13,940,829 R39L probably benign Het
Mrc2 G C 11: 105,341,376 W886S possibly damaging Het
Mrc2 G T 11: 105,347,360 E1153* probably null Het
Mrgprd T A 7: 145,321,953 L187H probably damaging Het
Mrgprx2 A C 7: 48,482,342 F243V probably damaging Het
Mrpl37 C A 4: 107,057,426 Q380H probably damaging Het
Mrpl39 C T 16: 84,723,972 V260I probably benign Het
Mrpl45 G T 11: 97,321,559 A121S probably benign Het
Mrps14 A C 1: 160,197,027 M43L probably benign Het
Mrps24 T A 11: 5,704,538 S139C possibly damaging Het
Mrvi1 C T 7: 110,923,999 R79H probably benign Het
Ms4a6b A T 19: 11,529,486 probably null Het
Ms4a8a G A 19: 11,070,760 S202L possibly damaging Het
Msc A T 1: 14,755,239 C39S unknown Het
Msi2 C A 11: 88,348,792 G331C probably damaging Het
Msln G T 17: 25,753,794 Q38K possibly damaging Het
Mss51 C T 14: 20,486,146 probably null Het
Mtcl1 T C 17: 66,379,460 E817G probably benign Het
Mtf2 G C 5: 108,087,944 G163R probably damaging Het
Mtfr1l C G 4: 134,530,679 probably null Het
Mthfd1 G A 12: 76,303,967 G708R possibly damaging Het
Mtmr2 A C 9: 13,799,281 E375D probably benign Het
Mtmr3 G C 11: 4,485,913 A1098G probably damaging Het
Mtor A T 4: 148,550,125 H2401L probably benign Het
Mtor G C 4: 148,550,130 V2403L possibly damaging Het
Mttp C A 3: 138,104,779 R625L probably benign Het
Mtus2 A G 5: 148,076,742 K115R probably benign Het
Mtus2 G T 5: 148,077,258 R287L probably benign Het
Muc13 A C 16: 33,799,087 Q68H unknown Het
Muc13 T C 16: 33,815,850 M568T possibly damaging Het
Muc2 T G 7: 141,746,714 I258S Het
Muc4 G A 16: 32,768,730 V754I possibly damaging Het
Muc5b C A 7: 141,842,705 L185I unknown Het
Mug1 G A 6: 121,841,294 M151I probably benign Het
Mug1 T G 6: 121,880,493 F1059V probably damaging Het
Mup11 C A 4: 60,660,215 M121I probably benign Het
Mup8 T C 4: 60,222,378 E31G probably benign Het
Mup8 C A 4: 60,222,542 probably benign Het
Mvb12b A T 2: 33,874,370 S56T probably damaging Het
Mybl1 C A 1: 9,685,769 R185L probably damaging Het
Mybpc1 G T 10: 88,560,327 N205K probably benign Het
Mybpc2 A C 7: 44,521,696 S144A probably benign Het
Mybpc3 C A 2: 91,120,403 P192Q possibly damaging Het
Mycbp2 C A 14: 103,156,637 K2829N probably benign Het
Mycbp2 T A 14: 103,346,249 Q90L probably benign Het
Myf6 G T 10: 107,494,260 H149N probably benign Het
Myh11 C A 16: 14,239,396 A345S probably null Het
Myh11 T A 16: 14,277,775 E41V Het
Myh13 T A 11: 67,329,295 S157T possibly damaging Het
Myh14 G T 7: 44,608,515 R1858S probably damaging Het
Myh14 A G 7: 44,638,309 V592A probably damaging Het
Myh15 A C 16: 49,096,531 S405R probably damaging Het
Myh3 G C 11: 67,082,415 W113S possibly damaging Het
Myh4 G T 11: 67,248,641 G595C probably damaging Het
Myh4 G T 11: 67,253,505 D1234Y probably damaging Het
Myh4 G A 11: 67,256,271 A1581T probably benign Het
Myh8 A C 11: 67,303,674 Q1570H probably damaging Het
Mylk3 A T 8: 85,365,179 Het
Myo15 G C 11: 60,488,258 A232P Het
Myo15 G C 11: 60,498,403 R873P Het
Myo15 G T 11: 60,524,441 V3410L probably damaging Het
Myo15b C T 11: 115,883,452 P339S possibly damaging Het
Myo15b A T 11: 115,887,925 T2582S unknown Het
Myo18b C T 5: 112,762,721 R1935H not run Het
Myo18b A T 5: 112,809,738 L1453Q possibly damaging Het
Myo18b C A 5: 112,831,190 G1186W probably damaging Het
Myo19 G A 11: 84,885,278 G30E probably benign Het
Myo19 GCACACAC GCACAC 11: 84,909,350 probably null Het
Myo1g C G 11: 6,519,045 A86P probably damaging Het
Myo7a C G 7: 98,095,727 R291P probably damaging Het
Myo7b C A 18: 31,980,998 R1100L possibly damaging Het
Myo9a A C 9: 59,895,259 T2010P probably damaging Het
Myoc G T 1: 162,639,636 E125* probably null Het
Myoc G C 1: 162,649,154 D476H probably damaging Het
Myom3 G T 4: 135,764,820 V92L probably benign Het
Myot G T 18: 44,346,085 M296I probably damaging Het
N4bp2l2 C A 5: 150,662,320 R65L probably benign Het
Nab2 C A 10: 127,663,132 E426* probably null Het
Nabp1 T A 1: 51,477,725 probably benign Het
Nacad G T 11: 6,602,297 S298Y probably damaging Het
Nagpa C G 16: 5,203,933 G17A probably damaging Het
Naip2 T G 13: 100,161,593 E645A probably benign Het
Naip2 A T 13: 100,161,909 Y540N probably benign Het
Nanog G A 6: 122,713,231 W198* probably null Het
Nars2 G T 7: 96,951,897 D32Y probably benign Het
Nat2 A G 8: 67,501,264 R9G probably damaging Het
Nat3 G T 8: 67,547,814 S115I possibly damaging Het
Nat8f2 T C 6: 85,868,044 E112G probably damaging Het
Nat8f5 T C 6: 85,817,685 T98A probably benign Het
Nat8l C T 5: 33,996,811 probably benign Het
Nav1 C A 1: 135,452,886 V1432L unknown Het
Nav1 T A 1: 135,472,420 S471C probably damaging Het
Nbas G T 12: 13,483,876 Q1837H probably benign Het
Nbeal2 G C 9: 110,625,816 Q2645E probably benign Het
Nbeal2 C A 9: 110,638,835 M455I probably benign Het
Nbr1 G C 11: 101,572,554 G616R probably benign Het
Ncdn C A 4: 126,750,151 G293C probably damaging Het
Ncdn C A 4: 126,750,153 C292F probably benign Het
Nckap1 A C 2: 80,540,508 probably null Het
Nckap5 C T 1: 126,528,681 probably null Het
Ncoa6 T A 2: 155,421,302 Q404L probably damaging Het
Ncor1 C A 11: 62,438,516 probably null Het
Ndc1 G C 4: 107,386,602 A332P probably damaging Het
Ndfip2 G T 14: 105,258,709 A13S probably benign Het
Ndn C A 7: 62,348,544 P46Q probably benign Het
Ndst3 A C 3: 123,552,630 F665C probably damaging Het
Ndst3 T G 3: 123,627,969 K405T possibly damaging Het
Ndst3 C A 3: 123,671,494 L276F probably damaging Het
Ndufa9 C A 6: 126,844,815 G66C probably damaging Het
Ndufs1 C A 1: 63,163,836 A190S probably damaging Het
Ndufs6 A G 13: 73,328,436 V4A probably benign Het
Neb C G 2: 52,267,782 W2271S probably benign Het
Neb C T 2: 52,279,631 probably null Het
Nectin2 C A 7: 19,738,363 V34L probably benign Het
Neil2 A C 14: 63,188,496 F142V probably damaging Het
Nek11 G C 9: 105,293,669 A389G probably benign Het
Nek2 G T 1: 191,827,239 R285S probably benign Het
Nell1 C G 7: 50,560,882 S377C unknown Het
Neu4 G T 1: 94,025,250 G447V probably benign Het
Neurl1a C A 19: 47,239,873 L53M probably damaging Het
Nfasc C A 1: 132,634,638 R133L probably benign Het
Nfatc2 G A 2: 168,571,349 Q139* probably null Het
Nfe2l2 T A 2: 75,679,164 Q104L probably null Het
Nfkbil1 C A 17: 35,234,961 G110C probably damaging Het
Nfkbil1 C A 17: 35,234,962 Q109H probably benign Het
Nfxl1 T G 5: 72,538,150 Q450H probably null Het
Nfyc C A 4: 120,790,487 probably benign Het
Ngb C A 12: 87,098,429 G151C probably damaging Het
Nhlrc4 C A 17: 25,943,744 A10S possibly damaging Het
Nin T A 12: 70,049,164 probably null Het
Nipbl G C 15: 8,338,699 P1180A possibly damaging Het
Nipsnap3a G T 4: 52,997,216 E161* probably null Het
Nkain2 C A 10: 32,402,271 G53* probably null Het
Nkapl C G 13: 21,468,303 G47R unknown Het
Nkx2-1 G T 12: 56,533,684 P157H probably benign Het
Nkx2-1 C A 12: 56,534,964 G33C probably damaging Het
Nle1 C A 11: 82,904,312 D298Y probably damaging Het
Nlgn1 G T 3: 25,436,604 L320I probably benign Het
Nlgn3 G T X: 101,317,982 V300L probably benign Het
Nlgn3 T C X: 101,319,877 L698P probably damaging Het
Nlk C G 11: 78,583,399 G358A probably damaging Het
Nlrp12 T C 7: 3,222,537 K1034R probably benign Het
Nlrp14 A G 7: 107,182,714 T373A probably benign Het
Nlrp1b T G 11: 71,182,270 K249T probably damaging Het
Nlrp6 T A 7: 140,922,721 W247R probably damaging Het
Nlrp9a G T 7: 26,558,229 W424L probably damaging Het
Nlrx1 A C 9: 44,256,923 V559G possibly damaging Het
Nme9 G A 9: 99,470,795 R266Q possibly damaging Het
Nmur2 T G 11: 56,027,101 K354T probably benign Het
Nos3 C A 5: 24,377,654 R627S probably benign Het
Notch3 A T 17: 32,141,516 F1480L probably benign Het
Notch3 A T 17: 32,151,370 C739S probably damaging Het
Nova2 G T 7: 18,958,449 G501V unknown Het
Noxa1 T A 2: 25,090,273 Q170L possibly damaging Het
Noxred1 A C 12: 87,223,057 L300W probably damaging Het
Npas2 T A 1: 39,336,010 S470T probably benign Het
Npas3 T C 12: 53,501,180 L103P probably damaging Het
Npm1 C A 11: 33,160,831 V117L probably benign Het
Npr2 A T 4: 43,650,720 H1000L probably damaging Het
Nr1h4 G C 10: 89,498,350 Y59* probably null Het
Nr2f2 C A 7: 70,357,778 V319F probably damaging Het
Nr3c2 G A 8: 76,909,700 V477M probably damaging Het
Nrap CTGTGTGT CTGTGT 19: 56,345,517 probably null Het
Nrcam G T 12: 44,571,570 R781L probably damaging Het
Nrg2 G T 18: 36,018,470 P673H probably damaging Het
Nrg3 C G 14: 39,472,533 V90L possibly damaging Het
Nrn1l G T 8: 105,894,416 A47S probably damaging Het
Nrxn3 C A 12: 89,187,055 S264* probably null Het
Nrxn3 C A 12: 89,517,909 A676E possibly damaging Het
Nsd1 A T 13: 55,245,525 Q416L probably damaging Het
Nsf C G 11: 103,910,554 D212H probably damaging Het
Nsrp1 C A 11: 77,050,695 Q62H probably damaging Het
Ntmt1 G C 2: 30,822,428 G161A probably damaging Het
Ntn4 G C 10: 93,741,153 R561P probably damaging Het
Ntrk2 A G 13: 58,874,333 T401A probably benign Het
Nudt8 G T 19: 4,001,690 R130S not run Het
Nufip2 G C 11: 77,741,791 *711S probably null Het
Nup214 G T 2: 32,010,258 R866S possibly damaging Het
Nup214 G T 2: 32,034,225 E1589* probably null Het
Nwd1 T G 8: 72,672,300 L696R not run Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Nwd2 C A 5: 63,806,157 T1028K probably damaging Het
Oas1d T C 5: 120,914,914 W11R probably benign Het
Obox2 C T 7: 15,397,196 P76S possibly damaging Het
Obox3 C A 7: 15,626,224 E173D probably benign Het
Obscn G T 11: 58,994,372 A8020E unknown Het
Obscn A T 11: 58,995,530 Y7835N unknown Het
Obscn T G 11: 59,038,807 D5194A probably damaging Het
Obscn G T 11: 59,040,347 A5018E probably benign Het
Obscn G T 11: 59,049,725 N4614K probably benign Het
Obscn A G 11: 59,082,823 I1894T probably benign Het
Obscn G C 11: 59,136,286 C30W probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfm4 T G 14: 80,021,219 D302E probably benign Het
Olfr1015 T C 2: 85,786,120 V203A probably damaging Het
Olfr1018 G A 2: 85,823,021 G17R probably damaging Het
Olfr1025-ps1 C A 2: 85,918,501 T192N probably damaging Het
Olfr1048 C T 2: 86,236,458 A119T probably damaging Het
Olfr1052 T C 2: 86,298,226 S137P probably damaging Het
Olfr1054 A T 2: 86,332,706 Y217N probably damaging Het
Olfr1055 G T 2: 86,346,883 N294K possibly damaging Het
Olfr1057 G C 2: 86,375,115 T99R possibly damaging Het
Olfr1061 T A 2: 86,413,528 S175C probably damaging Het
Olfr1062 G C 2: 86,423,374 L101V probably benign Het
Olfr109 T A 17: 37,466,661 F152I possibly damaging Het
Olfr1095 T G 2: 86,850,940 S253R Het
Olfr1102 T A 2: 87,002,610 C214S probably benign Het
Olfr1102 G T 2: 87,002,611 C214F probably benign Het
Olfr1105 G T 2: 87,033,487 L245I probably damaging Het
Olfr1109 G T 2: 87,093,224 P58T possibly damaging Het
Olfr1128 A C 2: 87,544,621 L308V probably benign Het
Olfr1130 C T 2: 87,607,754 A122V probably benign Het
Olfr1131 T A 2: 87,629,315 L168Q probably damaging Het
Olfr1136 G T 2: 87,693,151 H244N probably damaging Het
Olfr1155 G T 2: 87,943,209 Q140K possibly damaging Het
Olfr1155 T G 2: 87,943,467 N54H probably damaging Het
Olfr1160 A C 2: 88,006,437 C105G probably damaging Het
Olfr1164 A T 2: 88,093,334 C201S probably damaging Het
Olfr1168 T C 2: 88,185,071 S65P probably damaging Het
Olfr1178 C A 2: 88,392,033 T262K probably damaging Het
Olfr1179 G C 2: 88,402,122 L271V probably damaging Het
Olfr1180 G T 2: 88,411,986 P224H probably damaging Het
Olfr1183 C A 2: 88,462,114 P277Q probably damaging Het
Olfr1199 T G 2: 88,755,797 K293Q probably damaging Het
Olfr1205 T A 2: 88,831,578 S154T probably damaging Het
Olfr1208 A T 2: 88,897,061 F179I probably damaging Het
Olfr121 G T 17: 37,752,767 K304N probably damaging Het
Olfr1217 A T 2: 89,023,795 D69E possibly damaging Het
Olfr1217 T G 2: 89,023,896 T36P probably damaging Het
Olfr1219 C A 2: 89,074,438 G218C probably benign Het
Olfr1224-ps1 A G 2: 89,156,467 L236P probably damaging Het
Olfr1229 C A 2: 89,282,537 V199F probably benign Het
Olfr1229 TGGG TGGGG 2: 89,282,897 probably null Het
Olfr1230 C T 2: 89,296,953 G106S probably damaging Het
Olfr1262 T A 2: 90,003,048 V214E probably damaging Het
Olfr1287 C A 2: 111,449,784 L215M probably damaging Het
Olfr1290 A G 2: 111,489,877 F94L probably damaging Het
Olfr1294 C A 2: 111,538,285 M1I probably null Het
Olfr1297 A G 2: 111,621,261 L271P probably damaging Het
Olfr1300-ps1 T A 2: 111,692,429 F304I unknown Het
Olfr1303 C A 2: 111,814,034 G231C probably benign Het
Olfr1309 A C 2: 111,983,753 V107G probably benign Het
Olfr1310 T A 2: 112,008,457 H243L probably damaging Het
Olfr1328 T G 4: 118,933,918 H310P probably benign Het
Olfr1329 C T 4: 118,917,027 G147R probably benign Het
Olfr1329 T G 4: 118,917,135 T111P probably damaging Het
Olfr1333 G T 4: 118,830,050 P129Q probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr1342 G T 4: 118,690,272 T60K probably benign Het
Olfr1347 A T 7: 6,488,692 C54S probably benign Het
Olfr1347 G T 7: 6,488,698 L52I probably damaging Het
Olfr1350 C A 7: 6,570,048 P19H probably damaging Het
Olfr1351 G C 10: 79,018,205 R294S probably damaging Het
Olfr1356 T A 10: 78,847,021 Q298L possibly damaging Het
Olfr1357 T G 10: 78,612,056 N195T probably damaging Het
Olfr136 A C 17: 38,335,352 N65T probably damaging Het
Olfr1369-ps1 A T 13: 21,116,601 K303I probably damaging Het
Olfr1375 T G 11: 51,048,835 C243G probably damaging Het
Olfr1382 C G 11: 49,535,253 L23V probably damaging Het
Olfr1385 G C 11: 49,495,067 C178S probably damaging Het
Olfr140 G T 2: 90,052,265 Q20K probably benign Het
Olfr1410 G T 1: 92,607,751 probably benign Het
Olfr1425 G T 19: 12,073,840 P264H probably damaging Het
Olfr1425 G T 19: 12,073,910 H241N probably damaging Het
Olfr143 G T 9: 38,253,852 C142F probably benign Het
Olfr1437 T G 19: 12,322,267 N187H possibly damaging Het
Olfr1442 C A 19: 12,674,310 T35N probably benign Het
Olfr1454 A T 19: 13,063,646 K78N probably benign Het
Olfr1467 T G 19: 13,364,915 C96G probably damaging Het
Olfr1467 G C 19: 13,364,916 C96S probably damaging Het
Olfr1487 T G 19: 13,619,662 F124V probably damaging Het
Olfr1490 C A 19: 13,654,463 H11Q probably benign Het
Olfr1491 C G 19: 13,705,203 D125E probably damaging Het
Olfr1500 G T 19: 13,827,899 L166I probably damaging Het
Olfr152 C A 2: 87,783,024 H161Q probably damaging Het
Olfr159 A C 4: 43,770,267 V248G probably damaging Het
Olfr161 T A 16: 3,592,540 L48Q probably damaging Het
Olfr161 G A 16: 3,593,133 A246T probably benign Het
Olfr165 T A 16: 19,407,735 M94L probably benign Het
Olfr173 C A 16: 58,797,423 C141F probably damaging Het
Olfr173 G C 16: 58,797,673 P58A probably damaging Het
Olfr175-ps1 GT GTT 16: 58,824,307 probably null Het
Olfr197 C A 16: 59,186,485 probably benign Het
Olfr203 G T 16: 59,303,169 R5S probably benign Het
Olfr211 T C 6: 116,494,376 Y256H probably damaging Het
Olfr218 C A 1: 173,203,797 S147Y probably benign Het
Olfr266 C G 3: 106,822,043 C172S probably damaging Het
Olfr301 T G 7: 86,412,698 F112C probably benign Het
Olfr310 G A 7: 86,268,947 P281S probably damaging Het
Olfr354 C A 2: 36,907,701 L252I possibly damaging Het
Olfr361 C G 2: 37,085,636 M37I probably benign Het
Olfr362 G A 2: 37,105,636 P5S probably benign Het
Olfr387-ps1 C A 11: 73,664,774 T55K not run Het
Olfr397 TC T 11: 73,965,297 probably null Het
Olfr404-ps1 T A 11: 74,239,747 F61Y probably damaging Het
Olfr404-ps1 G A 11: 74,240,120 M185I possibly damaging Het
Olfr404-ps1 T G 11: 74,240,203 L213R probably damaging Het
Olfr414 C G 1: 174,430,591 S54R probably benign Het
Olfr430 A T 1: 174,069,331 E11V probably damaging Het
Olfr430 G T 1: 174,069,514 W72L probably damaging Het
Olfr444 A C 6: 42,955,690 H64P probably damaging Het
Olfr444 G C 6: 42,956,298 E267Q probably benign Het
Olfr449 T C 6: 42,837,977 L32P probably damaging Het
Olfr469 C T 7: 107,822,993 A159T probably benign Het
Olfr472 T G 7: 107,903,058 L114V probably damaging Het
Olfr478 T C 7: 108,031,446 E299G probably damaging Het
Olfr482 C A 7: 108,094,994 C192F probably damaging Het
Olfr484 G T 7: 108,124,879 A128E probably damaging Het
Olfr498 T A 7: 108,465,371 F16I probably benign Het
Olfr509 T A 7: 108,645,767 T270S possibly damaging Het
Olfr560 T A 7: 102,753,414 S172C probably benign Het
Olfr560 C G 7: 102,753,416 C171S possibly damaging Het
Olfr577 C T 7: 102,973,309 V228I not run Het
Olfr62 A C 4: 118,665,826 Q103P probably damaging Het
Olfr625-ps1 A T 7: 103,683,105 Y129F probably benign Het
Olfr628 T C 7: 103,732,781 L285P probably damaging Het
Olfr631 G A 7: 103,929,777 W318* probably null Het
Olfr642 T A 7: 104,050,273 H27L probably benign Het
Olfr67 C A 7: 103,787,453 V275F probably benign Het
Olfr675 G T 7: 105,024,099 P294T probably damaging Het
Olfr681 C A 7: 105,122,120 S221Y probably damaging Het
Olfr681 T A 7: 105,122,122 Y222N probably damaging Het
Olfr688 T A 7: 105,288,722 W210R probably damaging Het
Olfr716 G T 7: 107,148,155 V280L probably benign Het
Olfr721-ps1 G T 14: 14,407,732 C168F probably damaging Het
Olfr742 C G 14: 50,516,065 P287R probably damaging Het
Olfr780 G A 10: 129,322,219 G199S probably benign Het
Olfr788 T A 10: 129,473,615 S308T probably benign Het
Olfr794 G T 10: 129,571,236 E194* probably null Het
Olfr796 G T 10: 129,608,103 A126D probably damaging Het
Olfr8 A T 10: 78,955,219 N5Y probably damaging Het
Olfr807 A G 10: 129,754,688 F254S probably damaging Het
Olfr807 C A 10: 129,754,824 A209S possibly damaging Het
Olfr809 A T 10: 129,776,042 I43F probably damaging Het
Olfr822 G T 10: 130,075,104 Q231H probably benign Het
Olfr826 A C 10: 130,179,965 L305R possibly damaging Het
Olfr828 AGG AG 9: 18,815,980 probably null Het
Olfr854 T A 9: 19,566,526 Q286L probably damaging Het
Olfr871 G T 9: 20,212,844 R165L possibly damaging Het
Olfr890 G A 9: 38,143,431 A94T probably benign Het
Olfr912 G T 9: 38,581,885 G203W probably damaging Het
Olfr919 C T 9: 38,697,928 G146D possibly damaging Het
Olfr936 T G 9: 39,046,919 T167P probably damaging Het
Olfr969 C A 9: 39,795,929 L185M possibly damaging Het
Olfr970 A T 9: 39,820,355 S239C probably damaging Het
Olfr987 C T 2: 85,331,893 E2K probably benign Het
Olfr99 A T 17: 37,279,674 Y249N probably damaging Het
Olfr993 C G 2: 85,414,663 C72S probably damaging Het
Olfr993 G C 2: 85,414,685 H65D possibly damaging Het
Omt2b T A 9: 78,329,330 W113R probably damaging Het
Oog1 G C 12: 87,608,364 E427D probably damaging Het
Opn1sw C G 6: 29,379,456 G183A probably damaging Het
Oprk1 G A 1: 5,602,702 R354H probably benign Het
Osbpl7 G A 11: 97,060,153 G609S probably damaging Het
Otof G T 5: 30,371,586 A1826E probably damaging Het
Otogl C T 10: 107,777,213 R2046H probably benign Het
Otogl A T 10: 107,778,873 C1973S probably damaging Het
Otogl G T 10: 107,789,032 H1582N probably benign Het
Otop3 T A 11: 115,339,844 L147Q probably damaging Het
Otop3 C G 11: 115,341,012 H234Q probably damaging Het
Otud4 C T 8: 79,658,929 T217I probably benign Het
Otud6a C A X: 100,429,391 R127S possibly damaging Het
Otud7a G T 7: 63,758,700 R917L unknown Het
Oxct2a G T 4: 123,322,538 P350Q probably damaging Het
Oxtr T A 6: 112,489,695 N35Y probably damaging Het
P2rx6 G C 16: 17,568,055 D223H probably damaging Het
P2ry14 A C 3: 59,115,737 F101V probably damaging Het
P2ry4 G A X: 100,593,321 R324C probably benign Het
Pabpc4 G A 4: 123,295,274 G469D probably benign Het
Padi3 G T 4: 140,795,671 A330E possibly damaging Het
Padi3 A G 4: 140,798,123 L193P not run Het
Pafah1b1 C A 11: 74,689,119 G86V probably benign Het
Pafah1b1 T G 11: 74,690,241 K54T probably damaging Het
Pak7 A C 2: 136,083,246 L712R probably damaging Het
Pam C A 1: 97,934,723 R99L probably benign Het
Pam16 C A 16: 4,624,906 probably benign Het
Pappa2 C G 1: 158,814,814 G1287A probably damaging Het
Pappa2 A T 1: 158,814,816 D1286E probably damaging Het
Pappa2 A C 1: 158,956,933 I169S probably benign Het
Paqr8 G T 1: 20,934,798 G59W probably damaging Het
Paqr9 G C 9: 95,560,306 W116C possibly damaging Het
Pard3b G T 1: 62,238,892 V694L probably benign Het
Patj C T 4: 98,611,130 S1347L probably benign Het
Patj A T 4: 98,676,318 K1636* probably null Het
Pax3 C A 1: 78,122,590 probably null Het
Pax5 C A 4: 44,697,678 G19V probably damaging Het
Paxip1 C T 5: 27,783,729 probably null Het
Pcdh1 C A 18: 38,198,688 V560L possibly damaging Het
Pcdh15 G A 10: 74,630,701 D1517N probably benign Het
Pcdh19 C T X: 133,682,092 R763K probably null Het
Pcdh8 G A 14: 79,769,077 P682L probably benign Het
Pcdha7 G C 18: 36,975,840 E639D probably benign Het
Pcdhb10 AC A 18: 37,413,395 probably null Het
Pcdhb13 C A 18: 37,443,235 S222* probably null Het
Pcdhb16 C A 18: 37,479,160 P391H probably damaging Het
Pcdhgb1 A T 18: 37,681,840 Q461H probably benign Het
Pcgf2 T G 11: 97,690,021 K332T probably damaging Het
Pck2 G T 14: 55,545,269 A387S probably benign Het
Pclo C A 5: 14,681,516 S218Y possibly damaging Het
Pclo G C 5: 14,681,779 E306Q Het
Pclo C A 5: 14,712,648 Q427K probably damaging Het
Pcna-ps2 G T 19: 9,284,112 G245V probably damaging Het
Pcnt C A 10: 76,382,157 E2095* probably null Het
Pcnx2 G A 8: 125,761,654 P1717L probably damaging Het
Pcnx2 A C 8: 125,838,014 L1047V probably benign Het
Pcnx3 T A 19: 5,687,220 probably null Het
Pcolce2 G C 9: 95,637,836 A15P possibly damaging Het
Pcsk1 A T 13: 75,098,042 N180Y probably damaging Het
Pcsk4 G T 10: 80,322,726 T564K possibly damaging Het
Pcsk9 G T 4: 106,458,941 Q102K probably damaging Het
Pcx G T 19: 4,619,073 V701L possibly damaging Het
Pcyt2 C G 11: 120,614,373 G122A probably damaging Het
Pde11a C T 2: 76,194,905 A451T probably benign Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Pde6c G T 19: 38,132,881 probably benign Het
Pdk2 A C 11: 95,027,918 L344V probably damaging Het
Pdk4 G T 6: 5,487,170 S292Y probably damaging Het
Pds5a G C 5: 65,659,727 S177R possibly damaging Het
Pdxdc1 C A 16: 13,903,043 probably benign Het
Pdxk T G 10: 78,441,188 T259P probably damaging Het
Pdzk1 A G 3: 96,854,557 N162D probably benign Het
Pdzrn3 T A 6: 101,151,999 S569C probably damaging Het
Pdzrn4 G A 15: 92,396,957 A15T probably benign Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Peli3 C A 19: 4,934,967 R172L probably benign Het
Penk G T 4: 4,138,106 A13E probably damaging Het
Per2 T A 1: 91,421,493 N1052I possibly damaging Het
Pfas T C 11: 68,990,070 M198V Het
Pfas C T 11: 69,002,487 G91R probably damaging Het
Pfkl C A 10: 78,000,136 G213W probably damaging Het
Pfpl G T 19: 12,429,941 E519* probably null Het
Pga5 T C 19: 10,669,159 T372A probably damaging Het
Pgc C G 17: 47,728,868 Y62* probably null Het
Pgd C A 4: 149,166,679 probably benign Het
Pglyrp3 A T 3: 92,028,085 H214L probably damaging Het
Pglyrp4 A G 3: 90,739,005 Q282R probably damaging Het
Pgm2 C T 4: 99,978,997 T444I probably damaging Het
Pgm2l1 G T 7: 100,270,455 G586V possibly damaging Het
Phactr3 C A 2: 178,269,374 P139Q probably damaging Het
Phax G T 18: 56,586,952 G322W probably damaging Het
Phc3 C G 3: 30,936,597 M478I probably benign Het
Phf2 T A 13: 48,807,707 T836S unknown Het
Phldb2 C A 16: 45,825,826 A86S probably benign Het
Phldb2 C A 16: 45,825,827 L85F probably benign Het
Phldb2 T A 16: 45,953,508 probably benign Het
Phrf1 G C 7: 141,243,883 G46R unknown Het
Phrf1 G T 7: 141,258,818 R642L unknown Het
Picalm A T 7: 90,196,967 S639C probably damaging Het
Pidd1 T A 7: 141,440,361 S551C probably benign Het
Pigb C G 9: 73,034,572 G135A probably benign Het
Pigr A C 1: 130,850,815 E745D possibly damaging Het
Pigx T G 16: 32,087,425 Q130P probably benign Het
Pik3c2b C A 1: 133,066,553 S85Y probably damaging Het
Pik3c2b G T 1: 133,099,686 E1308* probably null Het
Pik3cd TG T 4: 149,654,847 probably null Het
Pik3cg T C 12: 32,204,795 R398G probably damaging Het
Pik3r6 G A 11: 68,520,200 probably benign Het
Pik3r6 G T 11: 68,544,765 A614S probably benign Het
Pja2 C A 17: 64,292,869 S540I probably damaging Het
Pkd1l1 C A 11: 8,826,801 G2513C Het
Pkd1l2 G C 8: 117,054,914 C797W probably damaging Het
Pkd1l3 C A 8: 109,623,242 P240T unknown Het
Pkd2 G A 5: 104,460,049 G138E probably benign Het
Pkd2l1 G T 19: 44,149,271 T708K probably benign Het
Pkhd1 A C 1: 20,523,747 F1381V possibly damaging Het
Pklr C G 3: 89,144,855 P489R probably damaging Het
Pkn1 C T 8: 83,673,497 R632Q probably damaging Het
Pkp2 T C 16: 16,230,700 V323A probably benign Het
Pkp4 G C 2: 59,342,244 probably null Het
Pla2g7 C G 17: 43,602,919 A251G probably benign Het
Plagl1 A G 10: 13,128,716 Q576R unknown Het
Plau A C 14: 20,839,481 S205R probably damaging Het
Plcb2 T A 2: 118,723,128 K171N probably damaging Het
Plcd4 T A 1: 74,548,126 L15Q probably benign Het
Plcd4 C A 1: 74,557,792 H398N probably damaging Het
Plce1 C T 19: 38,701,894 A674V probably damaging Het
Plce1 G T 19: 38,724,980 E1231* probably null Het
Plce1 A G 19: 38,769,460 H1959R probably damaging Het
Plcg1 A T 2: 160,758,127 R936W probably damaging Het
Plcl1 G A 1: 55,696,040 G180D probably benign Het
Plcl1 C T 1: 55,751,284 Q1038* probably null Het
Plcl2 T G 17: 50,608,456 V831G probably damaging Het
Plcz1 C G 6: 140,013,676 V252L possibly damaging Het
Pld1 T C 3: 28,076,533 L494P probably damaging Het
Pld1 A T 3: 28,131,577 K984* probably null Het
Pld6 G C 11: 59,787,438 C66W probably damaging Het
Plekha6 G T 1: 133,263,813 R40L probably benign Het
Plekha6 G T 1: 133,272,471 G263W probably damaging Het
Plekhg3 G T 12: 76,575,856 probably null Het
Plekhn1 C G 4: 156,223,431 G346A possibly damaging Het
Plekho1 C G 3: 95,995,715 G3A unknown Het
Plg A C 17: 12,414,185 T678P probably benign Het
Plk1 C T 7: 122,167,650 R364W not run Het
Plod1 C A 4: 147,923,200 G342C probably damaging Het
Plppr4 T C 3: 117,322,849 K453R probably damaging Het
Plxdc2 G A 2: 16,565,403 G180E possibly damaging Het
Plxna1 C A 6: 89,321,052 W1748L probably damaging Het
Plxna3 G T X: 74,336,020 W788C probably damaging Het
Plxnb3 T A X: 73,759,165 V213E probably damaging Het
Plxnc1 G T 10: 94,865,029 P598T probably benign Het
Pm20d1 G T 1: 131,797,558 E47D possibly damaging Het
Pmch T C 10: 88,091,833 I132T not run Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Pnisr C G 4: 21,873,684 R476G probably benign Het
Pnmal2 C A 7: 16,946,810 A573D possibly damaging Het
Pnpla8 CAGA CA 12: 44,295,990 probably null Het
Pnpt1 C T 11: 29,145,475 S408L probably benign Het
Pnpt1 G A 11: 29,145,477 D409N possibly damaging Het
Poc5 G T 13: 96,401,722 Q298H probably benign Het
Podxl T A 6: 31,528,634 K158M probably damaging Het
Pola1 T G X: 93,480,604 T1144P probably damaging Het
Pold1 C A 7: 44,541,780 R209L probably benign Het
Pold1 G A 7: 44,542,232 P110L probably benign Het
Pold4 G T 19: 4,232,172 E27D probably benign Het
Polg G T 7: 79,453,741 A960D probably damaging Het
Polg2 C A 11: 106,773,429 V357F probably damaging Het
Polq G T 16: 37,042,257 probably null Het
Polr2b A C 5: 77,331,971 K524Q probably damaging Het
Pom121l12 C A 11: 14,599,639 A115E probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Pop7 C A 5: 137,502,187 probably benign Het
Poteg G T 8: 27,447,954 R46I possibly damaging Het
Pou5f2 G C 13: 78,025,097 V53L probably benign Het
Pou6f2 T C 13: 18,378,635 Q38R unknown Het
Ppfia2 A T 10: 106,474,645 E4D probably damaging Het
Ppfia4 C A 1: 134,327,379 R246L probably benign Het
Ppia G T 11: 6,419,600 G162V possibly damaging Het
Ppip5k1 A C 2: 121,337,866 L685R probably damaging Het
Ppl A T 16: 5,106,778 L141Q probably damaging Het
Ppm1b G T 17: 84,994,265 R191L probably damaging Het
Ppm1d G C 11: 85,339,573 C339S probably benign Het
Ppm1g T A 5: 31,220,436 probably benign Het
Ppm1n C A 7: 19,279,245 E260D probably damaging Het
Ppp1r26 G T 2: 28,452,847 G830W probably damaging Het
Ppp1r7 C A 1: 93,354,354 T209N possibly damaging Het
Ppp2r1b AGGG AGG 9: 50,873,645 probably null Het
Ppp2r2c C G 5: 36,931,277 S163R probably benign Het
Ppp2r3a C G 9: 101,126,389 A427P possibly damaging Het
Ppp4r1 G A 17: 65,838,926 A887T probably damaging Het
Pramef25 C A 4: 143,950,123 G137V probably benign Het
Pramef6 T A 4: 143,895,684 Q367L probably damaging Het
Pramel4 G T 4: 144,068,521 G496W unknown Het
Pramel5 G T 4: 144,273,860 R49S probably benign Het
Pramel6 G T 2: 87,508,722 V89L probably benign Het
Prc1 C G 7: 80,306,485 S311R probably damaging Het
Prcd C A 11: 116,659,368 A74D probably damaging Het
Prdm1 A C 10: 44,446,833 L207R probably damaging Het
Prdm10 A T 9: 31,316,168 Q19L possibly damaging Het
Prdm10 G T 9: 31,316,293 E65* probably null Het
Prdm13 A T 4: 21,679,518 L324Q unknown Het
Prdm16 C A 4: 154,341,786 G514V probably damaging Het
Prdx1 C G 4: 116,687,481 P22A probably benign Het
Prelp G C 1: 133,914,881 S175R probably damaging Het
Prep G T 10: 45,150,468 G496V probably damaging Het
Prex1 C A 2: 166,572,970 E1490* probably null Het
Prkar1a G C 11: 109,660,013 Q64H probably benign Het
Prkcd T G 14: 30,610,249 Q18H possibly damaging Het
Prkcsh A C 9: 22,013,055 T494P probably damaging Het
Prkcz G C 4: 155,354,680 P103R probably damaging Het
Prkcz C T 4: 155,356,468 R81H probably damaging Het
Prkdc G T 16: 15,687,422 G863* probably null Het
Prlr A G 15: 10,314,255 S13G probably benign Het
Prmt6 C A 3: 110,250,130 S281I probably benign Het
Proc C A 18: 32,134,979 Q35H probably benign Het
Prom2 C A 2: 127,532,775 G614W probably damaging Het
Prp2 A T 6: 132,600,237 Q162H unknown Het
Prpf40a C G 2: 53,144,875 R767P probably damaging Het
Prpsap1 C A 11: 116,478,618 M162I possibly damaging Het
Prpsap1 G T 11: 116,479,768 A116D possibly damaging Het
Prr11 C G 11: 87,097,142 V312L possibly damaging Het
Prr12 C G 7: 45,052,856 G9A unknown Het
Prr15l G A 11: 96,934,763 G73D probably damaging Het
Prr16 C A 18: 51,303,150 H234N probably damaging Het
Prr29 C T 11: 106,376,941 L171F possibly damaging Het
Prrt1 G T 17: 34,630,833 G74C probably damaging Het
Prss16 G T 13: 22,006,054 C311* probably null Het
Prss16 C A 13: 22,006,400 probably benign Het
Prss30 G T 17: 23,974,584 Q19K unknown Het
Prss30 A T 17: 23,974,586 L18Q unknown Het
Prss38 G T 11: 59,374,334 P135T probably damaging Het
Prss40 T G 1: 34,559,779 K101T possibly damaging Het
Prss44 G T 9: 110,814,067 G10V probably benign Het
Prtg G A 9: 72,893,968 G860E probably damaging Het
Prune1 T G 3: 95,255,000 K454T probably damaging Het
Psapl1 A G 5: 36,205,164 I367V probably damaging Het
Psg18 C A 7: 18,354,787 G11W probably benign Het
Psip1 G A 4: 83,459,874 P462S possibly damaging Het
Psmb8 G C 17: 34,200,856 G228A probably benign Het
Psmc2 A C 5: 21,801,317 D276A probably damaging Het
Psmd11 G T 11: 80,428,648 probably benign Het
Psmd13 G T 7: 140,882,426 probably benign Het
Psmd2 G A 16: 20,662,660 V822I probably benign Het
Psme4 G A 11: 30,843,522 V1208I possibly damaging Het
Ptafr A G 4: 132,579,962 Q221R probably benign Het
Ptchd3 T G 11: 121,836,476 L392R possibly damaging Het
Pten G A 19: 32,798,115 probably null Het
Ptges3 G T 10: 128,074,270 D142Y probably damaging Het
Ptgfr C A 3: 151,835,641 D77Y probably damaging Het
Ptgs1 G T 2: 36,240,776 G229V probably damaging Het
Ptgs2 A T 1: 150,105,721 H585L probably benign Het
Pth2r C G 1: 65,363,308 A322G probably benign Het
Ptp4a1 C T 1: 30,944,569 C99Y probably benign Het
Ptpn11 C A 5: 121,143,094 G507V probably damaging Het
Ptpn5 T A 7: 47,086,122 I283F probably damaging Het
Ptpn6 G T 6: 124,725,076 Y416* probably null Het
Ptpn7 A C 1: 135,134,511 N65T probably benign Het
Ptprb AGGG AGGGGG 10: 116,302,156 probably null Het
Ptprd C A 4: 76,133,214 M23I probably benign Het
Ptprn A C 1: 75,251,818 F872V probably damaging Het
Ptprq C A 10: 107,526,070 M2090I probably damaging Het
Ptprs T A 17: 56,417,050 S1648C possibly damaging Het
Ptprs C A 17: 56,422,211 E1256* probably null Het
Ptprs G T 17: 56,434,468 R599S possibly damaging Het
Ptprz1 A C 6: 23,051,995 K2274N probably damaging Het
Ptx3 G T 3: 66,220,835 G106C possibly damaging Het
Pxk C G 14: 8,146,271 P394A probably damaging Het
Pxylp1 A T 9: 96,824,956 L391H probably damaging Het
Pygl G T 12: 70,222,874 T99N probably benign Het
Qrfpr T C 3: 36,182,610 Y214C probably damaging Het
Qrich2 A C 11: 116,456,378 L1207V probably benign Het
Qrsl1 A T 10: 43,884,948 V240E probably damaging Het
Qsox2 C A 2: 26,217,666 A272S probably damaging Het
Rab14 C A 2: 35,186,707 L106F Het
Rabgap1 G A 2: 37,560,544 D895N probably benign Het
Rabif G T 1: 134,494,757 R25L probably benign Het
Rabif G T 1: 134,506,232 A95S possibly damaging Het
Rad17 G C 13: 100,627,632 P444A probably benign Het
Rad21l G T 2: 151,655,232 L321I probably damaging Het
Rag1 C A 2: 101,643,259 G513C probably damaging Het
Ralgapa1 G A 12: 55,709,080 L1104F probably damaging Het
Ralgps2 C A 1: 156,829,075 A320S probably benign Het
Ran C T 5: 129,022,102 P116L probably damaging Het
Ranbp17 T C 11: 33,481,108 R290G probably damaging Het
Ranbp2 G T 10: 58,461,886 V372F probably damaging Het
Rap1gap2 TCCCC TCCCCC 11: 74,610,877 probably null Het
Rapgef5 T C 12: 117,595,288 L173P probably damaging Het
Rapgefl1 G A 11: 98,845,981 D314N probably damaging Het
Rapsn C G 2: 91,036,598 L82V probably benign Het
Rasal1 C T 5: 120,652,816 S23F probably damaging Het
Rasal1 A G 5: 120,664,849 N390S probably benign Het
Rasgrp1 A T 2: 117,301,974 C126S probably damaging Het
Rassf5 G T 1: 131,182,217 P201H probably damaging Het
Rassf8 G T 6: 145,816,642 E380* probably null Het
Rbak C A 5: 143,176,547 E20D probably damaging Het
Rbbp8 G A 18: 11,732,262 C736Y probably benign Het
Rbm17 C A 2: 11,596,768 G90W probably damaging Het
Rbm25 G T 12: 83,672,884 R559S possibly damaging Het
Rbm27 TGGGG TGGG 18: 42,333,234 probably null Het
Rbm28 C A 6: 29,128,547 G633C probably damaging Het
Rbm44 G A 1: 91,153,400 A437T probably benign Het
Rbm47 C T 5: 66,022,672 A500T probably benign Het
Rbm47 C A 5: 66,026,979 V94L probably benign Het
Rbms2 G C 10: 128,137,988 P224A probably benign Het
Rcl1 G C 19: 29,101,617 R38T probably benign Het
Reg3b G T 6: 78,372,828 G117V probably benign Het
Rel T G 11: 23,745,472 E270D probably damaging Het
Rela A T 19: 5,641,649 M284L probably benign Het
Reln A C 5: 21,979,024 V1659G probably damaging Het
Reps1 A C 10: 18,123,125 K722T probably damaging Het
Reps2 A C X: 162,522,968 F296V probably damaging Het
Rere A G 4: 150,468,783 D144G probably damaging Het
Ret T G 6: 118,163,207 K1008T probably damaging Het
Retreg2 G C 1: 75,145,743 A310P probably damaging Het
Rftn1 C G 17: 50,169,003 A49P probably damaging Het
Rfwd3 G C 8: 111,273,095 C750W probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rfx6 G T 10: 51,718,093 V370L probably benign Het
Rfx6 G T 10: 51,725,831 G749* probably null Het
Rgl3 C A 9: 21,981,403 V296L possibly damaging Het
Rgs12 G C 5: 34,965,769 A299P probably damaging Het
Rgs20 G T 1: 5,070,114 Q22K probably benign Het
Rhbdf1 T A 11: 32,215,125 probably null Het
Rhd G T 4: 134,879,975 V140L probably benign Het
Rhd C A 4: 134,884,524 L218I probably damaging Het
Rhob C T 12: 8,499,326 V103I probably benign Het
Rhobtb1 G T 10: 69,289,551 W650C probably damaging Het
Rhot1 A T 11: 80,242,621 K243* probably null Het
Rhox2a G T X: 37,249,484 E183D probably benign Het
Rhox3h C A X: 37,661,078 R112L possibly damaging Het
Rhox4g C T X: 37,650,763 A50T probably benign Het
Ric8b A C 10: 84,947,544 M89L probably benign Het
Rimbp3 G A 16: 17,209,474 S254N possibly damaging Het
Rims1 T A 1: 22,484,671 K445* probably null Het
Rims3 G C 4: 120,889,072 G185A probably damaging Het
Riok1 T A 13: 38,058,723 D474E possibly damaging Het
Ripk2 C A 4: 16,151,943 R205S probably damaging Het
Ripk4 G C 16: 97,750,102 P222A probably damaging Het
Rlf C T 4: 121,150,428 E562K probably damaging Het
Rnase11 T A 14: 51,049,888 T70S possibly damaging Het
Rnase2a C G 14: 51,255,829 Q26H probably damaging Het
Rnaset2b C G 17: 6,991,786 D150E possibly damaging Het
Rnf123 C G 9: 108,058,395 A962P probably damaging Het
Rnf123 C A 9: 108,062,981 G738W probably damaging Het
Rnf138rt1 G C X: 163,760,710 Q92E probably benign Het
Rnf19b A T 4: 129,078,905 probably null Het
Rnf213 G C 11: 119,441,410 A2483P Het
Rnf213 A C 11: 119,482,998 E4970A Het
Rnf216 C A 5: 143,098,443 M1I probably null Het
Rnf32 C A 5: 29,225,250 L356I probably damaging Het
Rnpep C A 1: 135,271,755 L288F probably benign Het
Rnpep C A 1: 135,283,836 G58V probably benign Het
Robo1 A T 16: 72,977,800 H655L probably benign Het
Robo2 G T 16: 73,933,591 N1044K probably benign Het
Rora G T 9: 69,364,372 G211C probably damaging Het
Ros1 T G 10: 52,091,109 K1688N possibly damaging Het
Rp1l1 A C 14: 64,029,144 Q726H probably damaging Het
Rpf2 C A 10: 40,243,872 G60* probably null Het
Rpl18 G T 7: 45,718,096 probably benign Het
Rpl37 C G 15: 5,118,592 P84A probably benign Het
Rpp38 T G 2: 3,329,522 E114D probably damaging Het
Rps6kl1 C A 12: 85,139,355 R326S probably benign Het
Rpsa A T 9: 120,130,346 I161F probably damaging Het
Rptn G A 3: 93,395,018 V14I probably benign Het
Rrn3 G A 16: 13,813,156 G619S probably damaging Het
Rsph4a A C 10: 33,911,643 E598D probably damaging Het
Rsrc1 G C 3: 67,349,982 Q242H probably damaging Het
Rtca T G 3: 116,489,303 E345D probably benign Het
Rubcn C A 16: 32,843,163 A368S probably benign Het
Rubcnl A T 14: 75,036,197 H283L probably benign Het
Rundc1 G T 11: 101,432,122 E302D probably benign Het
Rundc1 A C 11: 101,433,734 D422A probably damaging Het
Rundc3a G T 11: 102,400,991 G397C probably benign Het
Runx1 G C 16: 92,689,101 T115S possibly damaging Het
Rwdd2a C A 9: 86,574,559 L263M probably damaging Het
Ryr1 T A 7: 29,020,214 E4256V probably damaging Het
Ryr1 G C 7: 29,086,035 R1751G probably benign Het
Ryr1 C A 7: 29,103,498 W710C probably damaging Het
Ryr2 C G 13: 11,598,611 probably null Het
Ryr2 C A 13: 11,643,803 probably null Het
Ryr2 C A 13: 11,794,549 G797* probably null Het
Ryr3 G T 2: 112,675,920 D3452E probably benign Het
Ryr3 C A 2: 112,712,374 W3163C probably damaging Het
Ryr3 G T 2: 112,728,924 S3038R probably benign Het
S100pbp T C 4: 129,150,957 Q395R probably benign Het
Saa3 A T 7: 46,714,955 L49H unknown Het
Sacs G T 14: 61,210,830 E3442* probably null Het
Sacs G A 14: 61,213,200 G4232S