Incidental Mutation 'R0651:Steap4'
ID 62249
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tnfaip9, Tiarp
MMRRC Submission 038836-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R0651 (G1)
Quality Score 95
Status Not validated
Chromosome 5
Chromosomal Location 8010472-8032213 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 8030348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 401 (Y401*)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect probably null
Transcript: ENSMUST00000115421
AA Change: Y401*
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: Y401*

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T C 12: 72,956,830 (GRCm39) D120G probably damaging Het
Arid2 T A 15: 96,299,930 (GRCm39) F1814L possibly damaging Het
Huwe1 T C X: 150,659,309 (GRCm39) S921P probably damaging Het
Krt18 A G 15: 101,937,920 (GRCm39) D139G possibly damaging Het
Naa16 T C 14: 79,588,832 (GRCm39) K507R probably damaging Het
Pidd1 A T 7: 141,020,726 (GRCm39) L457* probably null Het
Rps6kc1 A T 1: 190,531,693 (GRCm39) F770I possibly damaging Het
Sigirr A T 7: 140,672,980 (GRCm39) V69D possibly damaging Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Zfp616 C T 11: 73,974,555 (GRCm39) Q275* probably null Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 8,026,979 (GRCm39) missense probably damaging 1.00
IGL00827:Steap4 APN 5 8,026,712 (GRCm39) missense probably damaging 1.00
IGL01481:Steap4 APN 5 8,026,858 (GRCm39) missense probably damaging 0.98
IGL02378:Steap4 APN 5 8,026,741 (GRCm39) missense probably benign 0.00
IGL03058:Steap4 APN 5 8,025,664 (GRCm39) missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 8,030,337 (GRCm39) missense probably benign 0.03
R0329:Steap4 UTSW 5 8,025,829 (GRCm39) missense possibly damaging 0.92
R0546:Steap4 UTSW 5 8,025,870 (GRCm39) missense probably damaging 0.99
R0637:Steap4 UTSW 5 8,028,398 (GRCm39) splice site probably benign
R0638:Steap4 UTSW 5 8,027,030 (GRCm39) splice site probably benign
R0881:Steap4 UTSW 5 8,030,388 (GRCm39) missense probably benign
R1167:Steap4 UTSW 5 8,026,520 (GRCm39) missense probably benign 0.34
R1543:Steap4 UTSW 5 8,025,902 (GRCm39) splice site probably benign
R1889:Steap4 UTSW 5 8,025,892 (GRCm39) missense probably damaging 1.00
R3803:Steap4 UTSW 5 8,026,979 (GRCm39) missense probably damaging 1.00
R3811:Steap4 UTSW 5 8,027,017 (GRCm39) missense probably benign 0.18
R3885:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R3887:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R4051:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R4208:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R5016:Steap4 UTSW 5 8,026,699 (GRCm39) nonsense probably null
R5302:Steap4 UTSW 5 8,025,547 (GRCm39) nonsense probably null
R5951:Steap4 UTSW 5 8,025,769 (GRCm39) missense probably benign 0.00
R6136:Steap4 UTSW 5 8,028,562 (GRCm39) missense probably damaging 0.99
R6527:Steap4 UTSW 5 8,028,502 (GRCm39) missense probably damaging 0.99
R6631:Steap4 UTSW 5 8,026,995 (GRCm39) nonsense probably null
R6964:Steap4 UTSW 5 8,025,568 (GRCm39) missense probably damaging 1.00
R7055:Steap4 UTSW 5 8,026,858 (GRCm39) missense probably damaging 1.00
R7408:Steap4 UTSW 5 8,028,453 (GRCm39) missense probably benign 0.07
R7692:Steap4 UTSW 5 8,026,976 (GRCm39) missense probably benign 0.32
R8205:Steap4 UTSW 5 8,026,795 (GRCm39) missense possibly damaging 0.65
R8861:Steap4 UTSW 5 8,025,672 (GRCm39) missense probably benign 0.00
R9287:Steap4 UTSW 5 8,026,683 (GRCm39) missense probably benign 0.05
R9423:Steap4 UTSW 5 8,026,720 (GRCm39) missense probably damaging 0.99
R9504:Steap4 UTSW 5 8,030,538 (GRCm39) missense probably benign 0.00
R9531:Steap4 UTSW 5 8,028,424 (GRCm39) missense probably benign 0.20
R9566:Steap4 UTSW 5 8,025,646 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCTCTGTGGACAGAAATGGTGCATTC -3'
(R):5'- GTGAGGCAACACTTCCTACTGTGATG -3'

Sequencing Primer
(F):5'- CAGAAATGGTGCATTCATGTCTCC -3'
(R):5'- TCCTGGCAAATTCAACTGTAGC -3'
Posted On 2013-07-30