Incidental Mutation 'R0652:Ctnnd1'
ID62266
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Namecatenin (cadherin associated protein), delta 1
SynonymsP120, p120-catenin, Ctnnd, Catns
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0652 (G1)
Quality Score82
Status Not validated
Chromosome2
Chromosomal Location84600071-84650765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84602896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 609 (I609T)
Ref Sequence ENSEMBL: ENSMUSP00000107304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111688] [ENSMUST00000111689] [ENSMUST00000111690] [ENSMUST00000111691] [ENSMUST00000111692] [ENSMUST00000111693] [ENSMUST00000111694] [ENSMUST00000111695] [ENSMUST00000111696] [ENSMUST00000111697] [ENSMUST00000111698] [ENSMUST00000189772]
Predicted Effect probably benign
Transcript: ENSMUST00000036811
AA Change: I917T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: I917T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066177
AA Change: I911T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: I911T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067232
AA Change: I938T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: I938T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099941
AA Change: I837T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101
AA Change: I837T

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111670
AA Change: I830T

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101
AA Change: I830T

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111675
AA Change: I609T

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101
AA Change: I609T

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111676
AA Change: I860T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101
AA Change: I860T

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111677
AA Change: I839T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101
AA Change: I839T

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111678
AA Change: I866T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101
AA Change: I866T

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111684
AA Change: I913T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: I913T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111685
AA Change: I892T
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: I892T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111686
AA Change: I878T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: I878T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111687
AA Change: I907T
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: I907T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111688
AA Change: I878T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: I878T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111689
AA Change: I884T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: I884T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111690
AA Change: I878T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: I878T

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111691
AA Change: I938T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: I938T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111692
AA Change: I932T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: I932T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111693
AA Change: I932T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: I932T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111694
AA Change: I967T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: I967T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111695
AA Change: I961T
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: I961T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111696
AA Change: I940T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: I940T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111697
AA Change: I917T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: I917T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111698
AA Change: I868T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: I868T

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150940
Predicted Effect probably benign
Transcript: ENSMUST00000189772
AA Change: I938T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: I938T

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr1463 A T 19: 13,234,535 Y95F possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wasf1 T A 10: 40,931,906 probably null Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84609625 missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84622010 critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84603752 missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84605256 splice site probably benign
IGL02035:Ctnnd1 APN 2 84620081 missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84605196 missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84619909 splice site probably benign
IGL03270:Ctnnd1 APN 2 84609727 splice site probably null
IGL02802:Ctnnd1 UTSW 2 84624462 start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84603262 missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84609067 missense probably damaging 1.00
R1503:Ctnnd1 UTSW 2 84605179 splice site probably null
R1701:Ctnnd1 UTSW 2 84608991 missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84615209 missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84612548 missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84609563 missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84616680 missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84624271 missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84616927 missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84619958 missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84603701 missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84619926 missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84622052 nonsense probably null
R4964:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R4966:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R5223:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5336:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5429:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84620915 nonsense probably null
R6018:Ctnnd1 UTSW 2 84650468 intron probably benign
R6285:Ctnnd1 UTSW 2 84613887 critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84624308 missense probably benign
R6661:Ctnnd1 UTSW 2 84609642 missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84624505 start gained probably benign
R6769:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6916:Ctnnd1 UTSW 2 84609646 missense probably benign 0.02
R7025:Ctnnd1 UTSW 2 84610606 missense possibly damaging 0.82
R7208:Ctnnd1 UTSW 2 84622046 missense possibly damaging 0.48
R7466:Ctnnd1 UTSW 2 84610785 missense probably benign 0.30
R7583:Ctnnd1 UTSW 2 84612061 missense probably damaging 0.99
X0062:Ctnnd1 UTSW 2 84615214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGGTAATTCACGGATGACGGCAG -3'
(R):5'- TGTCCTCCAGTCACCCCTAAGATG -3'

Sequencing Primer
(F):5'- CAGCCAATTTGGGCTACAAG -3'
(R):5'- AGTCACCCCTAAGATGGTCCTG -3'
Posted On2013-07-30