Incidental Mutation 'R0652:Sdk1'
ID62286
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0652 (G1)
Quality Score118
Status Not validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141954958 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 494 (T494A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: T234A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T234A

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: T494A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T494A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Ctnnd1 A G 2: 84,602,896 I609T probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr1463 A T 19: 13,234,535 Y95F possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wasf1 T A 10: 40,931,906 probably null Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTACACAGGCTGCATTTTATCCC -3'
(R):5'- ACACTGCACCCTGGCATCTAGTTC -3'

Sequencing Primer
(F):5'- TTGGAGCCACTCCAGAATG -3'
(R):5'- CTGGCATCTAGTTCCTGTCAGAG -3'
Posted On2013-07-30