Incidental Mutation 'Z1176:Zbtb42'
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #Z1176 ()
Quality Score225.009
Status Not validated
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 112680199 bp
Amino Acid Change Serine to Arginine at position 269 (S269R)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably benign
Transcript: ENSMUST00000169593
AA Change: S269R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: S269R

low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173942
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638

Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

Pfam:BTB 1 40 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 3316 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C A 2: 32,381,764 G3C possibly damaging Het
1110032A03Rik C A 9: 50,768,219 probably benign Het
1520401A03Rik G C 17: 23,715,763 A96G possibly damaging Het
1600015I10Rik A C 6: 48,932,468 K549T probably benign Het
1700001C19Rik T G 17: 47,413,734 N154T probably benign Het
1700003E16Rik A C 6: 83,161,115 K74N probably damaging Het
1700013G24Rik C A 4: 137,454,992 P153T probably damaging Het
1700016C15Rik A T 1: 177,741,017 R27W possibly damaging Het
1700017N19Rik T G 10: 100,612,429 M274R probably damaging Het
1700019N19Rik T G 19: 58,787,706 K105T probably damaging Het
1700030J22Rik G T 8: 116,973,597 T22K probably benign Het
1700123K08Rik G T 5: 138,563,553 Q124K probably damaging Het
1810046K07Rik G T 9: 51,291,564 P97T probably benign Het
2310035C23Rik G T 1: 105,719,615 R734M probably benign Het
2310050C09Rik T C 3: 92,869,274 Q34R probably benign Het
2610021A01Rik G C 7: 41,625,342 L156F probably benign Het
2610028H24Rik C A 10: 76,452,863 P85Q probably damaging Het
2610042L04Rik A G 14: 4,348,869 E10G probably damaging Het
2700081O15Rik C G 19: 7,422,747 P193A unknown Het
2900011O08Rik C A 16: 14,049,481 R68S probably damaging Het
3100002H09Rik T A 4: 124,610,705 D18V unknown Het
3110018I06Rik C G 12: 107,488,855 R67G unknown Het
3110082J24Rik G C 5: 30,105,067 A98G unknown Het
4833420G17Rik C A 13: 119,477,808 T484K not run Het
4833423E24Rik C T 2: 85,518,462 R102Q probably benign Het
4921501E09Rik C A 17: 33,065,657 D724Y possibly damaging Het
4921507P07Rik G T 6: 50,574,021 L483I possibly damaging Het
4921511C20Rik A G X: 127,394,842 K135E probably damaging Het
4930415L06Rik A C X: 89,930,241 N783K unknown Het
4930447C04Rik G C 12: 72,916,726 F18L probably benign Het
4930503B20Rik C T 3: 146,650,956 D66N probably damaging Het
4930516K23Rik A T 7: 104,059,288 F105I probably damaging Het
4930562C15Rik G A 16: 4,866,248 V236M possibly damaging Het
4930595M18Rik C T X: 81,420,272 G610R probably damaging Het
4932415D10Rik G T 10: 82,282,537 L4880I unknown Het
4932415D10Rik A C 10: 82,289,896 L2427V possibly damaging Het
4932415D10Rik A G 10: 82,293,228 I1316T probably benign Het
4933402D24Rik T A 1: 63,756,335 K90* probably null Het
4933402J07Rik G T 8: 87,568,574 M113I probably benign Het
4933403O08Rik C A X: 112,241,313 R213S probably benign Het
4933425L06Rik G A 13: 105,111,144 G324D probably damaging Het
4933427D14Rik C T 11: 72,159,000 V852I probably benign Het
4933427I04Rik T C 4: 123,860,875 L194P probably damaging Het
5330417C22Rik C A 3: 108,471,435 W349L probably damaging Het
5330417C22Rik C A 3: 108,471,978 G345C probably damaging Het
5730559C18Rik C A 1: 136,219,783 R399L possibly damaging Het
6430571L13Rik G T 9: 107,342,527 G60C probably damaging Het
9430015G10Rik G C 4: 156,122,011 G76A probably benign Het
9530053A07Rik G A 7: 28,142,386 S582N probably benign Het
9530053A07Rik G A 7: 28,154,762 G1717D probably benign Het
A1cf A C 19: 31,918,017 I167L probably benign Het
A2ml1 A G 6: 128,571,977 F281L probably benign Het
A430005L14Rik CG C 4: 153,960,665 probably null Het
A730049H05Rik C A 6: 92,828,066 S69* probably null Het
A830018L16Rik C G 1: 11,518,625 Q89E probably damaging Het
AA986860 A C 1: 130,742,991 S317R probably benign Het
Aasdh C G 5: 76,891,796 probably null Het
Aass T C 6: 23,078,857 T719A probably damaging Het
Aatf C T 11: 84,442,585 A500T probably benign Het
Abca12 A C 1: 71,284,070 Y1618D probably damaging Het
Abca13 G T 11: 9,251,376 G153C possibly damaging Het
Abca13 C A 11: 9,267,461 P301H probably damaging Het
Abca13 G T 11: 9,294,342 W2068C probably benign Het
Abca13 G T 11: 9,335,181 A3272S probably damaging Het
Abca13 C A 11: 9,335,182 A3272E probably damaging Het
Abca14 G T 7: 120,246,923 G599V probably damaging Het
Abca15 T G 7: 120,346,026 F442V probably benign Het
Abca15 G T 7: 120,382,505 G1061W probably damaging Het
Abca2 G T 2: 25,444,110 V1800L probably benign Het
Abca4 G T 3: 122,103,488 W605C probably damaging Het
Abca4 C A 3: 122,156,443 S1805R probably damaging Het
Abca7 C T 10: 79,999,432 R208* probably null Het
Abca7 T C 10: 80,006,559 L1109P probably damaging Het
Abca8b A T 11: 109,961,908 C761S possibly damaging Het
Abca8b G A 11: 109,974,644 T329I possibly damaging Het
Abca9 G A 11: 110,135,375 A953V probably benign Het
Abcb10 C A 8: 123,982,663 G51C possibly damaging Het
Abcb11 C A 2: 69,291,981 G386V probably damaging Het
Abcb1b A G 5: 8,827,441 Y667C probably benign Het
Abcb4 C A 5: 8,959,005 R1221S probably damaging Het
Abcb5 C A 12: 118,918,272 G574V probably damaging Het
Abcb8 A T 5: 24,400,995 D226V probably damaging Het
Abcc10 G A 17: 46,313,700 H784Y probably damaging Het
Abcc10 C T 17: 46,324,262 A272T probably benign Het
Abcc12 T G 8: 86,550,601 K389T probably damaging Het
Abcc3 C G 11: 94,361,275 Q827H probably benign Het
Abcc6 C T 7: 45,979,734 D1363N probably damaging Het
Abcc6 A T 7: 45,992,306 probably null Het
Abcc8 T C 7: 46,106,965 S1439G possibly damaging Het
Abhd12b G A 12: 70,163,451 D134N probably damaging Het
Abhd13 A C 8: 9,987,413 K3N probably damaging Het
Abl1 A C 2: 31,689,827 K7N probably damaging Het
Ablim2 C T 5: 35,848,858 P409L possibly damaging Het
Abo C G 2: 26,848,258 V45L probably benign Het
Abtb2 G T 2: 103,708,172 E649* probably null Het
Acaca G C 11: 84,260,720 A815P probably damaging Het
Acacb G T 5: 114,248,948 R2386L probably benign Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Acap3 C G 4: 155,905,179 N693K probably damaging Het
Acmsd G T 1: 127,745,802 V76F probably damaging Het
Actc1 C A 2: 114,051,997 C12F probably benign Het
Actl11 T G 9: 107,931,700 V1074G probably benign Het
Actl6a A C 3: 32,726,543 I411L probably benign Het
Actl9 C A 17: 33,433,101 P45Q possibly damaging Het
Actr10 C A 12: 70,962,029 A412E probably damaging Het
Actr1b T A 1: 36,701,208 H284L probably benign Het
Actrt2 G T 4: 154,666,832 N282K probably benign Het
Acvr1 C A 2: 58,479,868 G43V probably benign Het
Acy3 G T 19: 3,987,107 R13L probably damaging Het
Adam17 T G 12: 21,361,737 Q51P possibly damaging Het
Adam21 T G 12: 81,559,743 N415T probably damaging Het
Adam30 A G 3: 98,162,360 Y503C possibly damaging Het
Adam32 C A 8: 24,948,750 E16* probably null Het
Adam6a A G 12: 113,545,321 K438R possibly damaging Het
Adam7 A T 14: 68,527,701 S82R probably benign Het
Adamts10 C T 17: 33,528,787 R66W probably damaging Het
Adamts10 G T 17: 33,528,788 R66L probably damaging Het
Adamts12 G T 15: 11,336,383 C1518F not run Het
Adamts15 G C 9: 30,910,700 C480W probably damaging Het
Adamts16 C T 13: 70,761,773 R887K probably benign Het
Adamts18 A T 8: 113,743,168 I634N possibly damaging Het
Adamts2 G T 11: 50,792,708 R939L probably damaging Het
Adamts3 C T 5: 89,775,351 V199I not run Het
Adamts4 G A 1: 171,258,783 A715T probably benign Het
Adamts4 C G 1: 171,258,784 A715G probably benign Het
Adamtsl1 C T 4: 86,342,177 P883L probably damaging Het
Adamtsl1 T G 4: 86,342,693 M1055R probably benign Het
Adamtsl2 C A 2: 27,081,720 Q6K probably benign Het
Adcy1 G A 11: 7,109,098 D335N probably damaging Het
Adcy1 C A 11: 7,149,536 T672N probably damaging Het
Adcy1 G A 11: 7,150,857 R802K probably damaging Het
Adcy1 G T 11: 7,150,858 R802S possibly damaging Het
Adcy5 G T 16: 35,156,321 G75C unknown Het
Adcy5 C G 16: 35,290,185 F907L probably benign Het
Adcy5 G A 16: 35,291,544 V924M not run Het
Adcy8 T C 15: 64,725,518 T895A probably benign Het
Adcy9 G T 16: 4,307,232 P745Q probably damaging Het
Add2 G T 6: 86,098,590 K240N probably damaging Het
Adgb G T 10: 10,378,742 T1159N probably benign Het
Adgrb2 G T 4: 130,017,563 C1126F probably damaging Het
Adgrb3 C T 1: 25,093,914 D1364N probably benign Het
Adgre1 T G 17: 57,361,729 L30R possibly damaging Het
Adgrg4 G T X: 56,894,702 V174L probably benign Het
Adgrg4 C A X: 56,914,259 P601H probably benign Het
Adgrg5 G C 8: 94,935,151 W173C Het
Adgrv1 C A 13: 81,559,634 A1218S possibly damaging Het
Adh7 G A 3: 138,223,731 G87D probably benign Het
Adora2a C A 10: 75,333,328 Q209K probably benign Het
Adprhl1 C G 8: 13,225,613 A382P probably benign Het
Adprhl2 C G 4: 126,321,567 G35A probably damaging Het
Adprhl2 C G 4: 126,321,661 A4P unknown Het
Adra1a C A 14: 66,727,628 L356M probably benign Het
Adra2b C A 2: 127,364,038 D158E probably benign Het
Adra2c G C 5: 35,280,904 R340P probably damaging Het
Adss C A 1: 177,776,493 C182F probably damaging Het
Adss C A 1: 177,796,498 probably benign Het
Aff3 T A 1: 38,329,872 K347* probably null Het
Afg1l TGCGCGCG TGCGCG 10: 42,478,353 probably null Het
Afg3l2 C A 18: 67,431,707 L232F probably benign Het
Afmid G A 11: 117,834,966 D129N probably benign Het
Agap2 G C 10: 127,080,225 G202R unknown Het
Agbl1 T G 7: 76,418,685 L333R Het
Agbl4 T A 4: 110,660,839 L109Q probably damaging Het
Agbl4 G T 4: 111,526,643 G232W probably damaging Het
Ago4 C A 4: 126,520,190 probably null Het
Ahnak G T 19: 9,008,856 M2501I probably damaging Het
AI593442 C A 9: 52,677,945 G111C probably damaging Het
AI597479 A G 1: 43,113,190 H216R probably benign Het
Aipl1 G T 11: 72,030,533 P179T possibly damaging Het
Ak9 G C 10: 41,348,251 G524R Het
Ak9 G T 10: 41,423,023 W1573C unknown Het
Akap1 G T 11: 88,837,167 T663N probably benign Het
Akap13 G T 7: 75,730,552 R491L probably damaging Het
Akap14 G T X: 37,163,245 P279H unknown Het
Akap4 G T X: 7,078,360 E831* probably null Het
Akap6 C G 12: 53,140,444 T1547R possibly damaging Het
Akap8 C A 17: 32,306,549 V519L probably damaging Het
Akap9 G T 5: 3,962,251 G985W probably damaging Het
Akirin1 C T 4: 123,750,067 G33D probably damaging Het
Akr1cl C A 1: 65,016,687 G219C probably damaging Het
Alas1 G A 9: 106,238,769 R349C probably benign Het
Alas1 C A 9: 106,243,367 Q76H probably benign Het
Aldh1l1 GAA GA 6: 90,557,284 probably null Het
Aldh1l1 G T 6: 90,583,173 V601L probably benign Het
Aldh3a2 T G 11: 61,264,283 K145T probably benign Het
Aldoart1 C A 4: 72,852,004 R189L probably benign Het
Alg8 T G 7: 97,383,761 F285V probably benign Het
Alkbh8 G C 9: 3,345,820 G180A probably damaging Het
Alms1 C G 6: 85,678,418 N2846K probably benign Het
Alox12b T A 11: 69,157,323 I26N possibly damaging Het
Alox12b G C 11: 69,157,325 V27L possibly damaging Het
Aloxe3 C A 11: 69,133,079 L279M probably damaging Het
Alpi T C 1: 87,099,072 N428S probably benign Het
Alpk1 T A 3: 127,673,438 H1064L probably damaging Het
Alpk2 G C 18: 65,305,611 L904V probably damaging Het
Alpk3 G T 7: 81,078,626 L501F probably benign Het
Alpl G C 4: 137,754,010 S110R probably damaging Het
Alppl2 G A 1: 87,087,666 S391F probably damaging Het
Alppl2 G T 1: 87,087,704 H378Q probably damaging Het
Amer3 G T 1: 34,589,013 V778L probably benign Het
Ampd2 C A 3: 108,080,064 G151V probably damaging Het
Amz1 G T 5: 140,744,073 E121* probably null Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Ank3 T G 10: 69,932,474 L941R possibly damaging Het
Ank3 C T 10: 69,951,010 A968V possibly damaging Het
Ank3 G C 10: 69,991,215 E1905Q Het
Ankar G T 1: 72,689,961 L342I possibly damaging Het
Ankib1 G A 5: 3,692,763 S1084L probably benign Het
Ankk1 T A 9: 49,416,643 Q412L probably benign Het
Ankk1 T G 9: 49,421,911 K91T probably damaging Het
Ankle2 G C 5: 110,234,499 E114Q possibly damaging Het
Ankmy1 C T 1: 92,878,437 G780E probably damaging Het
Ankmy2 T G 12: 36,186,859 M222R probably damaging Het
Ankrd11 C T 8: 122,895,803 V437M possibly damaging Het
Ankrd12 C A 17: 65,970,338 probably null Het
Ankrd36 T A 11: 5,615,538 F457L probably benign Het
Ankrd39 C G 1: 36,542,005 A88P probably damaging Het
Ankrd45 C T 1: 161,163,283 A202V possibly damaging Het
Ankrd49 C G 9: 14,781,428 A147P probably damaging Het
Ankrd6 C T 4: 32,806,229 E675K possibly damaging Het
Ankrd6 G T 4: 32,806,326 S642R probably benign Het
Ankrd6 G C 4: 32,824,486 N142K probably damaging Het
Anks3 T G 16: 4,950,714 Q255P probably benign Het
Ano2 G T 6: 125,710,707 Q58H probably benign Het
Ano2 T G 6: 125,863,453 Y362* probably null Het
Ano4 A T 10: 89,112,945 V101E probably benign Het
Ano5 T A 7: 51,574,703 V469E probably damaging Het
Ano6 C A 15: 95,913,460 P147Q probably damaging Het
Ano7 C A 1: 93,394,465 D398E probably benign Het
Anpep G C 7: 79,827,639 P727A possibly damaging Het
Anxa10 T G 8: 62,063,070 probably null Het
Aoc2 G T 11: 101,326,420 G443V probably benign Het
Aox4 G C 1: 58,246,351 E665Q possibly damaging Het
Ap1m2 G A 9: 21,298,256 R375* probably null Het
Ap1s1 G A 5: 137,037,470 T126I probably damaging Het
Apba1 C A 19: 23,944,115 S767R probably damaging Het
Apex2 C A X: 150,572,099 G414V probably benign Het
Apoa4 C A 9: 46,242,589 R163S possibly damaging Het
Apob G C 12: 7,998,011 G997R probably damaging Het
Apob G T 12: 8,004,978 V1326L probably benign Het
Apobr A T 7: 126,587,264 E649V probably damaging Het
Apoh G T 11: 108,343,459 probably benign Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
App A G 16: 85,024,917 L390P probably damaging Het
Aqr C A 2: 114,108,122 R1283M probably damaging Het
Aqr C G 2: 114,109,991 A1225P probably benign Het
Ar G T X: 98,151,009 G410W probably damaging Het
Arfgef2 G A 2: 166,894,712 R1768Q probably damaging Het
Arfgef3 T A 10: 18,591,437 K2005M probably damaging Het
Arfgef3 C A 10: 18,608,358 C1383F probably damaging Het
Arfgef3 T A 10: 18,634,852 H787L probably benign Het
Arhgap1 C T 2: 91,650,214 A27V possibly damaging Het
Arhgap10 C A 8: 77,277,175 G667V probably benign Het
Arhgap10 T G 8: 77,432,805 S107R probably damaging Het
Arhgap11a C G 2: 113,833,758 A727P probably benign Het
Arhgap22 A T 14: 33,362,522 R253W probably damaging Het
Arhgap24 G T 5: 102,875,759 V220F probably damaging Het
Arhgap24 G A 5: 102,880,807 A283T probably benign Het
Arhgap25 G T 6: 87,476,186 L211M probably damaging Het
Arhgap31 G C 16: 38,623,893 Q201E possibly damaging Het
Arhgap33 C A 7: 30,522,717 R1263S probably benign Het
Arhgap40 C A 2: 158,534,885 P317T probably benign Het
Arhgap45 C A 10: 80,025,536 T511N probably damaging Het
Arhgap45 C G 10: 80,029,052 R950G probably damaging Het
Arhgap5 G A 12: 52,518,463 R739H possibly damaging Het
Arhgap9 C A 10: 127,327,689 T452N probably damaging Het
Arhgef11 C T 3: 87,735,462 P1434L not run Het
Arhgef12 T A 9: 42,971,072 Q1492L probably benign Het
Arhgef18 G T 8: 3,453,224 V877L probably damaging Het
Arhgef4 G T 1: 34,723,729 D689Y unknown Het
Arhgef4 G T 1: 34,804,926 G1358C probably damaging Het
Arid1a C A 4: 133,720,550 Q217H probably null Het
Arid4a A C 12: 71,039,920 K177N possibly damaging Het
Arid5a CGGG CGGGG 1: 36,319,355 probably null Het
Arl10 C G 13: 54,580,724 L188V probably benign Het
Arl14 C A 3: 69,222,648 P43T probably damaging Het
Arl4c T C 1: 88,701,450 Q72R possibly damaging Het
Arl6ip5 C A 6: 97,229,555 N65K probably benign Het
Armc2 C A 10: 41,927,044 Q544H probably damaging Het
Armc2 C G 10: 41,963,656 G438R probably damaging Het
Armc4 G C 18: 7,129,487 A897G probably damaging Het
Armc4 C A 18: 7,216,973 E680* probably null Het
Armcx4 C A X: 134,693,042 A1233D not run Het
Armcx4 G A X: 134,694,091 E1583K possibly damaging Het
Arnt2 G A 7: 84,263,196 P579S probably benign Het
Arpc3 C T 5: 122,404,230 P120L probably damaging Het
Arrdc5 C G 17: 56,300,189 A19P probably damaging Het
Arsi C A 18: 60,916,780 P245H probably damaging Het
Art2b T A 7: 101,578,882 Q283L not run Het
Arx G T X: 93,289,184 A280S probably damaging Het
Asap3 TGGG TGG 4: 136,240,201 probably benign Het
Asap3 C A 4: 136,241,503 P753Q probably damaging Het
Asb15 G T 6: 24,566,331 D428Y probably damaging Het
Ascc1 G T 10: 60,007,793 R59L possibly damaging Het
Ascc2 G T 11: 4,646,653 R58L probably benign Het
Ascc2 G C 11: 4,672,487 G518R probably benign Het
Ash1l G A 3: 89,043,217 R2139Q probably damaging Het
Asic2 A T 11: 80,889,832 L417Q possibly damaging Het
Asic2 T G 11: 81,967,670 K172T probably benign Het
Aspg C G 12: 112,113,081 Q98E possibly damaging Het
Asphd1 A T 7: 126,948,636 L165Q probably damaging Het
Astl C T 2: 127,356,545 A360V probably benign Het
Asxl3 G T 18: 22,522,220 G1096C probably damaging Het
Atad5 A C 11: 80,094,896 S270R probably damaging Het
Ate1 C A 7: 130,504,714 D306Y probably benign Het
Atg7 G T 6: 114,673,050 V63F possibly damaging Het
Atg9a A T 1: 75,186,559 L299Q probably damaging Het
Atl1 C G 12: 69,937,075 L192V possibly damaging Het
Atl3 T G 19: 7,510,037 F106V probably damaging Het
Atp10a G T 7: 58,788,447 probably null Het
Atp12a G C 14: 56,372,706 G221A probably damaging Het
Atp13a2 A T 4: 141,005,117 S898C probably benign Het
Atp13a4 C A 16: 29,422,587 Q754H probably null Het
Atp1a2 A T 1: 172,279,754 I733N possibly damaging Het
Atp1a3 C A 7: 24,998,688 A198S probably benign Het
Atp1a4 C G 1: 172,231,954 R857P probably benign Het
Atp1b2 G T 11: 69,601,315 A269D possibly damaging Het
Atp2a3 G T 11: 72,980,622 G650C possibly damaging Het
Atp2a3 C A 11: 72,989,540 H1016N probably benign Het
Atp2b3 G A X: 73,535,424 E343K possibly damaging Het
Atp6v0a4 G A 6: 38,049,036 S819F possibly damaging Het
Atp6v1e1 T C 6: 120,804,119 E97G probably benign Het
Atp6v1e1 T A 6: 120,822,449 probably benign Het
Atp6v1h G C 1: 5,095,628 R107P probably damaging Het
Atp7b G T 8: 22,028,714 P36H probably benign Het
Atp8b4 C A 2: 126,414,429 E203D possibly damaging Het
Atp8b5 A T 4: 43,361,903 R650W probably benign Het
Atp9b T A 18: 80,765,865 Q613L Het
Atpaf2 C A 11: 60,416,775 A46S probably benign Het
Atrn G T 2: 130,946,193 G305V probably benign Het
Atxn2 A T 5: 121,777,990 S420C probably damaging Het
Atxn7l1 G T 12: 33,367,645 A602S probably benign Het
Atxn7l1 G C 12: 33,368,017 A726P probably benign Het
Atxn7l2 A C 3: 108,205,666 S309A probably benign Het
AU022751 G T X: 6,082,314 P216T unknown Het
AU022751 T G X: 6,082,321 E213D unknown Het
Aup1 G T 6: 83,056,633 R306L probably benign Het
Aurkaip1 G T 4: 155,832,763 R156L probably damaging Het
Aurkc TGG TG 7: 6,995,514 probably null Het
Avl9 G C 6: 56,736,764 D336H probably damaging Het
Avpr1b C A 1: 131,609,573 S365Y probably damaging Het
Axdnd1 A T 1: 156,349,063 L714Q probably damaging Het
Azin2 C A 4: 128,934,659 D347Y possibly damaging Het
B3gnt5 A T 16: 19,769,810 R260* probably null Het
B3gnt6 C G 7: 98,193,889 R288P probably benign Het
Bag6 G T 17: 35,139,310 probably null Het
Bahcc1 G T 11: 120,276,609 G1279W possibly damaging Het
Bahcc1 G T 11: 120,284,394 V1765L probably benign Het
Bahd1 G A 2: 118,922,403 R717H probably damaging Het
Baiap3 C A 17: 25,244,768 R934S probably benign Het
Bbs10 G C 10: 111,298,908 probably null Het
Bbs10 G T 10: 111,299,657 L210F probably benign Het
Bbs10 G T 10: 111,301,124 R699S probably damaging Het
BC005561 T C 5: 104,520,192 V860A possibly damaging Het
BC024063 G T 10: 82,109,050 G168V probably damaging Het
BC080695 T C 4: 143,572,252 I255T probably benign Het
Bcan C A 3: 87,990,750 G635W probably damaging Het
Bcan T G 3: 87,990,755 N633T probably damaging Het
Bcan C T 3: 87,995,650 D274N probably benign Het
Bckdha T C 7: 25,631,143 S343G probably damaging Het
Bcl10 T G 3: 145,930,513 I55M probably damaging Het
Bcl11a G T 11: 24,165,010 K784N probably damaging Het
Bcl6 C G 16: 23,969,958 Q553H probably damaging Het
Bcorl1 T G X: 48,367,842 L84R unknown Het
Bcorl1 GAAAA GAAA X: 48,375,090 probably null Het
Bend6 C A 1: 33,864,523 Q173H probably null Het
Best3 T G 10: 117,024,622 L596V probably benign Het
Bmp4 A C 14: 46,384,628 V153G possibly damaging Het
Bmpr1b C A 3: 141,842,954 E438D probably benign Het
Bmpr2 G A 1: 59,847,167 R321Q not run Het
Bnc1 T G 7: 81,974,542 E312D probably damaging Het
Bok ACTCTCTCTCTCT ACTCTCTCTCTCTCT 1: 93,694,045 probably benign Het
Borcs5 A T 6: 134,710,123 Q147L probably benign Het
Borcs8 C G 8: 70,141,971 H49D probably damaging Het
Bpi G T 2: 158,272,102 G307W possibly damaging Het
Bpifa3 A T 2: 154,130,471 probably benign Het
Bpifb4 A C 2: 153,942,832 E153D probably benign Het
Bpifc C A 10: 85,965,228 A419S probably benign Het
Bptf C A 11: 107,058,684 G2270W probably damaging Het
Braf C A 6: 39,643,182 W487C probably damaging Het
Brap A G 5: 121,675,377 T298A possibly damaging Het
Brd2 C A 17: 34,113,688 G573W possibly damaging Het
Brd9 G C 13: 73,944,751 A287P probably damaging Het
Brdt G T 5: 107,359,898 S664I possibly damaging Het
Brinp1 C A 4: 68,798,751 E287* probably null Het
Brinp2 C G 1: 158,247,039 G504A probably damaging Het
Brinp2 A T 1: 158,247,171 L460* probably null Het
Brinp3 C T 1: 146,902,076 P754S probably damaging Het
Btg4 G A 9: 51,119,175 D192N probably benign Het
Btla G T 16: 45,239,358 V142L probably damaging Het
Bub1 C A 2: 127,829,565 W33L probably damaging Het
C130026I21Rik G T 1: 85,113,523 D71E probably damaging Het
C1qb C G 4: 136,882,145 G55R probably damaging Het
C1ql2 C G 1: 120,341,624 H169Q possibly damaging Het
C2cd4a C G 9: 67,831,413 G116A probably damaging Het
C2cd4c G A 10: 79,612,465 P283S possibly damaging Het
C4b A T 17: 34,731,147 L1383Q probably damaging Het
C530008M17Rik C A 5: 76,857,246 P485T unknown Het
C77080 G T 4: 129,223,704 S434Y probably damaging Het
C87977 A G 4: 144,207,461 F359L probably benign Het
C8a C A 4: 104,862,686 G76C probably damaging Het
Cabp7 T G 11: 4,746,669 N20T probably benign Het
Cacna1a G T 8: 84,415,676 R11L unknown Het
Cacna1b A T 2: 24,626,884 L54* probably null Het
Cacna1c T G 6: 118,697,737 K547T Het
Cacna1d C T 14: 30,111,116 A923T probably benign Het
Cacna1d A G 14: 30,179,188 F325S probably benign Het
Cacna1e T A 1: 154,635,850 T176S probably damaging Het
Cacna1g A T 11: 94,438,111 L1020M probably benign Het
Cacna1h G C 17: 25,391,250 P761A probably benign Het
Cacna1s G T 1: 136,107,084 E1322* probably null Het
Cacna2d2 G C 9: 107,517,293 A585P probably damaging Het
Cacna2d2 C A 9: 107,526,102 L921M probably benign Het
Cacna2d4 G T 6: 119,312,450 R815M probably benign Het
Cacnb1 C A 11: 98,022,555 probably benign Het
Cacnb4 C A 2: 52,675,812 probably null Het
Cacng5 G T 11: 107,877,546 P212T probably damaging Het
Cacng5 C G 11: 107,884,346 G66R probably null Het
Cadps2 A C 6: 23,321,801 L1031V probably benign Het
Calcoco2 C A 11: 96,103,520 W69L probably damaging Het
Calr C A 8: 84,844,064 probably null Het
Camk1g C A 1: 193,362,100 G2V probably damaging Het
Camk2b G C 11: 5,977,940 S447C possibly damaging Het
Camk2g C A 14: 20,764,912 W215C probably damaging Het
Camsap1 C T 2: 25,936,639 A1260T probably damaging Het
Camsap1 G C 2: 25,940,881 P461A probably benign Het
Camta1 G T 4: 151,144,385 H663Q probably benign Het
Cand1 A C 10: 119,239,194 I16S probably benign Het
Capg G T 6: 72,555,476 probably null Het
Capn1 C G 19: 6,014,278 V64L probably benign Het
Capn13 G T 17: 73,341,110 S298R probably benign Het
Capn6 C G X: 143,810,907 G79R probably damaging Het
Car5b G T X: 164,000,310 A90D probably benign Het
Car7 G T 8: 104,548,959 C180F possibly damaging Het
Card9 T A 2: 26,357,796 E181V probably damaging Het
Carnmt1 C G 19: 18,679,213 A170G possibly damaging Het
Carnmt1 G C 19: 18,704,090 C391S probably benign Het
Cartpt C A 13: 99,899,983 E86* probably null Het
Casc1 C A 6: 145,205,293 E18* probably null Het
Cask C T X: 13,533,489 V785I probably benign Het
Caskin1 C A 17: 24,505,038 N933K probably damaging Het
Caskin2 A G 11: 115,802,096 L621P probably damaging Het
Caskin2 C G 11: 115,802,103 A619P probably damaging Het
Caskin2 C A 11: 115,803,620 G385V probably benign Het
Casq1 G T 1: 172,215,914 S191* probably null Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catip A C 1: 74,367,789 H240P probably damaging Het
Catsper2 C A 2: 121,407,385 W171C probably damaging Het
Cav2 G T 6: 17,281,433 V25F probably benign Het
Cavin2 G T 1: 51,301,156 G331C probably damaging Het
Cbfa2t3 G C 8: 122,698,895 probably benign Het
Cbx8 G A 11: 119,039,119 A216V possibly damaging Het
Ccdc113 G T 8: 95,538,219 R119L probably damaging Het
Ccdc121 C T 1: 181,510,875 E171K possibly damaging Het
Ccdc14 G T 16: 34,706,498 G306C probably damaging Het
Ccdc144b T C 3: 36,018,888 Q415R possibly damaging Het
Ccdc149 TTCTCTC TTCTC 5: 52,420,813 probably null Het
Ccdc151 C A 9: 21,990,424 V547F possibly damaging Het
Ccdc155 C G 7: 45,184,254 probably null Het
Ccdc158 T C 5: 92,608,491 M1086V probably damaging Het
Ccdc162 C T 10: 41,553,131 R645H probably benign Het
Ccdc162 C T 10: 41,605,108 D1318N possibly damaging Het
Ccdc162 G A 10: 41,654,997 T571I possibly damaging Het
Ccdc162 T G 10: 41,690,092 K85T probably benign Het
Ccdc171 G A 4: 83,795,230 A1169T probably damaging Het
Ccdc175 C A 12: 72,112,308 R619L possibly damaging Het
Ccdc180 A C 4: 45,916,406 K869T probably damaging Het
Ccdc180 A C 4: 45,920,910 K952T probably damaging Het
Ccdc187 G T 2: 26,281,507 Q320K probably benign Het
Ccdc28b C A 4: 129,621,104 G71C probably damaging Het
Ccdc33 G A 9: 58,117,416 P176S probably benign Het
Ccdc40 G A 11: 119,252,008 R864H probably damaging Het
Ccdc51 G T 9: 109,092,148 E368* probably null Het
Ccdc51 G C 9: 109,092,226 A394P probably damaging Het
Ccdc57 C G 11: 120,860,488 A919P possibly damaging Het
Ccdc57 C A 11: 120,861,138 Q872H probably null Het
Ccdc7a G T 8: 129,026,663 R196S probably benign Het
Ccdc80 G T 16: 45,095,786 G302* probably null Het
Ccdc80 G A 16: 45,096,207 S442N probably benign Het
Ccdc80 T C 16: 45,116,344 F711L probably damaging Het
Ccdc87 G A 19: 4,841,923 W814* probably null Het
Ccdc88b C A 19: 6,849,740 A1020S possibly damaging Het
Ccdc88c T C 12: 100,945,770 K602E possibly damaging Het
Ccdc94 T C 17: 55,960,732 F15S probably damaging Het
Ccdc96 C G 5: 36,485,594 R315G probably benign Het
Ccin A T 4: 43,985,018 Q475L probably damaging Het
Ccnb1ip1 C A 14: 50,792,104 R167L probably benign Het
Ccnb3 T C X: 7,009,375 T322A possibly damaging Het
Ccr10 C G 11: 101,174,323 G127A probably damaging Het
Ccr10 CG C 11: 101,174,340 probably null Het
Ccr7 G T 11: 99,144,980 T372N probably damaging Het
Cct6b C T 11: 82,723,939 V408I probably damaging Het
Cct6b C A 11: 82,764,065 probably benign Het
Cd163l1 A T 7: 140,224,857 H591L probably benign Het
Cd164 G T 10: 41,519,565 A11S probably damaging Het
Cd177 G T 7: 24,746,171 Q616K probably benign Het
Cd180 C T 13: 102,705,766 P440L probably damaging Het
Cd200r1 A T 16: 44,792,759 I243F probably damaging Het
Cd209e C T 8: 3,849,196 G172E probably benign Het
Cd22 T G 7: 30,867,963 K732T probably benign Het
Cd22 G T 7: 30,869,530 P693H probably damaging Het
Cd3d A G 9: 44,985,628 D100G probably damaging Het
Cd59a C A 2: 104,104,198 Q4K probably benign Het
Cd69 G T 6: 129,268,342 C173* probably null Het
Cdc123 T G 2: 5,804,985 Q205P probably damaging Het
Cdc14b C G 13: 64,274,669 V28L possibly damaging Het
Cdc42bpa A G 1: 180,065,093 E274G probably damaging Het
Cdc42ep2 A G 19: 5,918,492 F62L probably benign Het
Cdc42ep5 A T 7: 4,151,726 L21H probably damaging Het
Cdh15 G C 8: 122,864,259 D416H probably damaging Het
Cdh16 G C 8: 104,615,185 P783A probably damaging Het
Cdh19 T G 1: 110,893,306 Q567H probably benign Het
Cdh19 A T 1: 110,895,387 N522K probably damaging Het
Cdh19 C G 1: 110,932,214 G179A probably damaging Het
Cdh22 G T 2: 165,116,184 P621H probably damaging Het
Cdh23 T A 10: 60,310,770 N2877Y probably damaging Het
Cdh23 T C 10: 60,428,321 N683D probably benign Het
Cdh7 G T 1: 110,108,736 G549C probably damaging Het
Cdh8 G A 8: 99,171,323 P453S probably benign Het
Cdh8 C A 8: 99,190,205 R426M probably null Het
Cdhr3 G T 12: 33,060,322 P321H probably damaging Het
Cdhr3 C A 12: 33,080,324 G171W probably benign Het
Cdk12 G T 11: 98,203,941 G192* probably null Het
Cdk14 G T 5: 5,135,322 Y212* probably null Het
Cdk5r2 C G 1: 74,855,350 P85A probably damaging Het
Cdk5rap2 C T 4: 70,266,743 G1157R probably damaging Het
Cdk6 T A 5: 3,390,694 C83S possibly damaging Het
Cdsn T G 17: 35,555,825 V417G possibly damaging Het
Cdsn T A 17: 35,556,071 L499Q probably damaging Het
Cdyl C T 13: 35,815,966 R77W probably damaging Het
Ceacam15 G T 7: 16,675,583 P9H possibly damaging Het
Cela2a G T 4: 141,821,391 P145T probably damaging Het
Celsr1 A C 15: 85,963,100 F1479V probably damaging Het
Celsr2 C A 3: 108,393,131 R2871L probably benign Het
Celsr2 G T 3: 108,412,341 H1052N probably benign Het
Cenpf G A 1: 189,659,472 T704I probably damaging Het
Cenpv A C 11: 62,527,525 F201V probably damaging Het
Cep112 G A 11: 108,425,310 G36D probably damaging Het
Cep152 C A 2: 125,583,971 G825C probably benign Het
Cep170b G T 12: 112,741,012 probably null Het
Cep192 A T 18: 67,881,288 K2451M probably damaging Het
Cep290 AGG AG 10: 100,549,374 probably benign Het
Cep295 G T 9: 15,357,697 P16Q probably damaging Het
Cep295nl T C 11: 118,333,019 E333G possibly damaging Het
Cep295nl T G 11: 118,333,873 Q48H probably damaging Het
Cep44 C G 8: 56,544,128 G125A possibly damaging Het
Cep97 C A 16: 55,927,735 G111C probably damaging Het
Cerkl C A 2: 79,368,765 Q160H probably benign Het
Cers1 C G 8: 70,318,318 P126R probably benign Het
Ces1a C A 8: 93,036,085 R186L probably benign Het
Ces1g G T 8: 93,325,811 H283Q probably benign Het
Ces2a C A 8: 104,734,006 probably benign Het
Ces2a A T 8: 104,734,850 E77V probably damaging Het
Ces3a A C 8: 105,053,602 K327T possibly damaging Het
Ces4a A G 8: 105,131,977 K9R probably benign Het
Cetn2 T G X: 72,914,889 K127T probably damaging Het
Cfap100 G C 6: 90,406,150 A347G unknown Het
Cfap20 C T 8: 95,434,525 S16N possibly damaging Het
Cfap206 G C 4: 34,719,661 P251R possibly damaging Het
Cfap221 G T 1: 119,995,141 L24I probably benign Het
Cfap45 G T 1: 172,545,284 E515D probably benign Het
Cfap46 A C 7: 139,639,548 L1334V Het
Cfap65 G A 1: 74,910,747 R1200C probably damaging Het
Cfap74 C G 4: 155,426,118 R387G Het
Cflar C G 1: 58,731,229 C160W Het
Cflar G T 1: 58,740,313 probably null Het
Cgn A T 3: 94,774,273 V504E possibly damaging Het
Cgn T C 3: 94,774,346 R480G probably damaging Het
Cgn G T 3: 94,776,178 A389D probably benign Het
Chd1 G T 17: 15,766,347 V1482L probably damaging Het
Chd1 G T 17: 15,768,733 G1583C probably damaging Het
Chd4 G T 6: 125,100,860 R95L possibly damaging Het
Chd4 G T 6: 125,101,598 A228S probably benign Het
Chd5 G A 4: 152,378,479 R1363K probably damaging Het
Chd7 C G 4: 8,844,313 A1502G probably damaging Het
Cherp C T 8: 72,470,953 G101D Het
Chfr C G 5: 110,144,895 S176* probably null Het
Chil1 G T 1: 134,182,779 probably null Het
Chil1 C G 1: 134,189,230 R319G probably damaging Het
Chml C A 1: 175,687,762 G198C possibly damaging Het
Chmp3 A C 6: 71,560,964 E58D probably benign Het
Chmp3 G C 6: 71,579,775 A220P probably damaging Het
Chpf C G 1: 75,475,458 A613P probably benign Het
Chpf G C 1: 75,475,470 L609V probably damaging Het
Chrna2 C A 14: 66,149,304 L300M probably damaging Het
Chrna5 G T 9: 55,004,482 G189C probably damaging Het
Chrna7 A T 7: 63,212,184 L40Q probably damaging Het
Chst3 T A 10: 60,185,676 R450W possibly damaging Het
Chst4 A C 8: 110,030,092 F380V probably damaging Het
Chsy1 C G 7: 66,172,226 S736R probably damaging Het
Cic A C 7: 25,271,019 E58D possibly damaging Het
Cidea A G 18: 67,358,853 K61R probably null Het
Ciita C A 16: 10,508,700 P252T probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cipc G T 12: 86,960,337 G103C probably damaging Het
Cit G C 5: 115,986,603 G1526R probably damaging Het
Cited4 C A 4: 120,666,814 H4Q probably damaging Het
Ckap2 G A 8: 22,169,794 P557L probably damaging Het
Ckap2l C A 2: 129,285,362 D299Y probably damaging Het
Clca1 G T 3: 145,013,921 S429R probably damaging Het
Clcn1 T C 6: 42,307,567 V613A probably damaging Het
Cldn11 T A 3: 31,150,306 W53R probably damaging Het
Cldn18 T A 9: 99,698,847 K116M possibly damaging Het
Cldn23 A T 8: 35,826,277 L19Q probably damaging Het
Cldn34b1 T G X: 154,887,708 K5T probably benign Het
Clec4d T G 6: 123,274,686 F176V probably benign Het
Clic1 G T 17: 35,052,459 G22W probably damaging Het
Clic6 G A 16: 92,498,895 D148N probably benign Het
Clip3 A C 7: 30,298,838 E236D probably benign Het
Clk1 C A 1: 58,417,372 R186L probably benign Het
Clstn3 C T 6: 124,459,200 V234M probably damaging Het
Cltc A G 11: 86,702,632 V1525A probably benign Het
Cmklr1 T A 5: 113,613,891 S350C probably damaging Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
Cmya5 C G 13: 93,096,790 D597H unknown Het
Cnksr1 A T 4: 134,232,135 L396Q probably damaging Het
Cnksr3 C T 10: 7,134,544 R308Q probably damaging Het
Cnnm4 G T 1: 36,505,751 R697L possibly damaging Het
Cnot1 C G 8: 95,748,277 Q1103H possibly damaging Het
Cnot8 C G 11: 58,113,090 A117G probably benign Het
Cnppd1 C A 1: 75,140,951 G42V probably damaging Het
Cntn2 C A 1: 132,527,788 R237L probably damaging Het
Cntn3 T G 6: 102,437,931 probably null Het
Cntn4 T G 6: 106,509,464 N284K probably benign Het
Cntn4 T G 6: 106,523,563 F334V probably benign Het
Cntnap1 C A 11: 101,182,898 T625K probably damaging Het
Cntnap2 A C 6: 47,271,148 K1163Q probably benign Het
Cntnap3 AC A 13: 64,740,872 probably null Het
Cntnap3 T G 13: 64,792,388 N332H probably damaging Het
Cntnap4 A T 8: 112,858,189 K1086M possibly damaging Het
Cntnap5a T A 1: 116,428,516 V759E probably damaging Het
Cntnap5b C A 1: 99,967,270 T89K probably damaging Het
Cntnap5b C A 1: 100,164,228 S231R possibly damaging Het
Cntnap5b C G 1: 100,446,840 Q734E probably benign Het
Cobl G T 11: 12,253,433 Q1090K probably benign Het
Cobl C A 11: 12,369,645 E244D probably damaging Het
Cobl G A 11: 12,375,827 A223V probably damaging Het
Cog1 C A 11: 113,651,982 H151Q probably damaging Het
Coil C A 11: 88,981,976 P388T probably damaging Het
Col10a1 C A 10: 34,395,178 P382H probably damaging Het
Col11a2 G T 17: 34,056,402 G420C unknown Het
Col16a1 G C 4: 130,072,878 G882A unknown Het
Col17a1 CCCTGGTGGGCCTGG CCCTGG 19: 47,649,429 probably benign Het
Col18a1 G C 10: 77,055,709 A1097G possibly damaging Het
Col18a1 C A 10: 77,112,851 A276S unknown Het
Col1a2 A C 6: 4,532,750 T792P unknown Het
Col23a1 G T 11: 51,549,708 D142Y unknown Het
Col24a1 G A 3: 145,342,498 G619S probably damaging Het
Col25a1 AC A 3: 130,182,795 probably null Het
Col27a1 C G 4: 63,225,788 S571C probably damaging Het
Col5a1 G A 2: 28,002,517 R1014H unknown Het
Col5a2 C A 1: 45,376,146 V1478L possibly damaging Het
Col5a2 C A 1: 45,383,680 G1126C probably damaging Het
Col5a2 C G 1: 45,396,484 G697A probably benign Het
Col6a4 T C 9: 106,000,797 S1994G probably benign Het
Col6a4 G C 9: 106,000,870 C1969W probably damaging Het
Col6a6 G C 9: 105,780,952 A687G probably damaging Het
Col9a1 C A 1: 24,214,588 P464H probably damaging Het
Col9a2 C G 4: 121,053,797 A543G probably damaging Het
Colec11 C A 12: 28,595,284 Q129H probably damaging Het
Commd10 G T 18: 46,990,566 G163* probably null Het
Commd2 C A 3: 57,646,857 R141L probably damaging Het
Copb2 A C 9: 98,586,146 K737T probably benign Het
Coq3 C A 4: 21,899,102 P145H probably damaging Het
Coq4 G T 2: 29,795,449 Q158H probably null Het
Coq6 G C 12: 84,370,963 A226P possibly damaging Het
Coro6 ACCC ACC 11: 77,467,865 probably null Het
Cox6a1 C T 5: 115,345,908 G92S probably damaging Het
Cox6b2 C A 7: 4,752,147 V43L probably benign Het
Cpeb1 C A 7: 81,359,728 probably null Het
Cpeb2 G T 5: 43,234,717 G419C Het
Cpne1 C A 2: 156,077,644 D302Y probably damaging Het
Cpq A C 15: 33,381,391 D300A probably damaging Het
Cps1 G T 1: 67,123,268 G35V possibly damaging Het
Cps1 CTT CT 1: 67,148,719 probably null Het
Cpsf4 A T 5: 145,167,415 E20V possibly damaging Het
Cr2 G T 1: 195,154,153 Q901K probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crb2 C T 2: 37,776,371 P11S probably benign Het
Crebl2 G T 6: 134,849,289 E68* probably null Het
Crem T A 18: 3,267,730 E258V probably damaging Het
Crispld1 C A 1: 17,728,613 probably benign Het
Crispld1 G T 1: 17,752,851 A381S possibly damaging Het
Crtac1 T G 19: 42,287,926 E521A probably benign Het
Cry1 C A 10: 85,144,197 V416L probably benign Het
Crybg2 C A 4: 134,082,660 P1241H probably damaging Het
Cryz A T 3: 154,621,769 T277S probably benign Het
Csmd1 T C 8: 15,998,814 D2296G probably damaging Het
Csmd1 T A 8: 16,037,198 T1946S probably damaging Het
Cspg5 G T 9: 110,251,050 A429S probably damaging Het
Ctbp2 C A 7: 133,015,290 probably benign Het
Ctf2 T A 7: 127,719,456 I124F possibly damaging Het
Ctps G C 4: 120,542,743 D472E probably benign Het
Ctsf C A 19: 4,856,306 Q155K probably benign Het
Ctsj C T 13: 61,004,115 E43K probably damaging Het
Ctsq C A 13: 61,037,123 V250L probably benign Het
Cttnbp2 C A 6: 18,408,709 S971I probably benign Het
Cttnbp2 C A 6: 18,408,725 G966C possibly damaging Het
Cttnbp2 G T 6: 18,420,836 A892E possibly damaging Het
Cttnbp2 C A 6: 18,501,960 E60* probably null Het
Cubn T A 2: 13,381,825 E1543V probably damaging Het
Cul9 C A 17: 46,520,576 G1571* probably null Het
Cul9 C A 17: 46,520,585 G1568* probably null Het
Cutal G T 2: 34,882,425 R67I probably damaging Het
Cux2 C A 5: 121,873,813 G520* probably null Het
Cux2 G T 5: 121,885,934 T92K probably benign Het
Cxcr1 A T 1: 74,192,392 L157* probably null Het
Cyb561d2 G C 9: 107,540,296 C85W probably damaging Het
Cybb T C X: 9,438,240 I564V probably damaging Het
Cybb G A X: 9,440,001 H494Y probably damaging Het
Cyfip2 G A 11: 46,222,615 S968F not run Het
Cylc1 G A X: 111,123,146 V399I unknown Het
Cyp11b1 T A 15: 74,839,355 K158I probably damaging Het
Cyp19a1 T A 9: 54,176,599 K169* probably null Het
Cyp1a1 C A 9: 57,700,594 S168R probably benign Het
Cyp26b1 T C 6: 84,577,114 S174G probably benign Het
Cyp2a4 G T 7: 26,307,323 G36* probably null Het
Cyp2a4 C T 7: 26,310,841 P264S probably damaging Het
Cyp2a5 A C 7: 26,835,497 N45T probably damaging Het
Cyp2a5 G A 7: 26,836,774 R148H probably damaging Het
Cyp2c29 G A 19: 39,324,997 M351I probably benign Het
Cyp2c54 G A 19: 40,046,215 P337L probably damaging Het
Cyp2c55 C T 19: 39,035,513 R344C probably benign Het
Cyp2j11 T G 4: 96,307,303 E385D probably damaging Het
Cyp2j11 G T 4: 96,307,436 S341Y probably damaging Het
Cyp2j5 G T 4: 96,629,506 P490T probably damaging Het
Cyp2j6 C A 4: 96,536,068 G151* probably null Het
Cyp39a1 A C 17: 43,725,577 I333L probably benign Het
Cyp39a1 A C 17: 43,731,048 E382A probably damaging Het
Cyp3a44 T C 5: 145,791,664 K250R probably benign Het
Cyp4a10 G T 4: 115,518,326 S2I probably damaging Het
Cyp4a12a G T 4: 115,329,003 probably null Het
Cyp4a14 G C 4: 115,490,017 A408G probably benign Het
Cyp4a30b G T 4: 115,470,959 R475L possibly damaging Het
Cypt14 T C X: 39,863,555 K10R possibly damaging Het
Cypt15 A C X: 39,346,384 K33T possibly damaging Het
Cypt2 G T X: 105,499,799 R3L probably benign Het
Cyth2 C A 7: 45,813,105 R24L possibly damaging Het
Cytip C A 2: 58,134,037 S257I probably damaging Het
Cytl1 G T 5: 37,735,695 A50S probably benign Het
D430041D05Rik C A 2: 104,154,935 L1262F probably damaging Het
D430041D05Rik C A 2: 104,256,856 A592S probably benign Het
D5Ertd579e C G 5: 36,615,762 E430Q probably benign Het
D930020B18Rik C A 10: 121,667,616 A232D probably benign Het
Dab1 G C 4: 104,728,078 V472L probably benign Het
Dab2ip G T 2: 35,708,868 D191Y probably damaging Het
Dapk1 AC A 13: 60,760,804 probably null Het
Dars C A 1: 128,372,207 E347* probably null Het
Daw1 C G 1: 83,180,391 L54V probably damaging Het
Daw1 C A 1: 83,183,300 T121K probably damaging Het
Daw1 A C 1: 83,209,255 K262T probably damaging Het
Dbh T A 2: 27,177,727 L454Q probably damaging Het
Dcaf12l1 G A X: 44,789,897 T8M probably benign Het
Dcaf8 G T 1: 172,172,929 R218L probably benign Het
Dcdc2c G T 12: 28,524,707 P139T probably benign Het
Dcxr GA G 11: 120,727,208 probably null Het
Ddhd2 C T 8: 25,735,829 M500I possibly damaging Het
Ddo C A 10: 40,647,933 H306Q probably damaging Het
Ddr2 T C 1: 169,984,955 Y656C probably damaging Het
Ddr2 G T 1: 169,998,083 T316N probably benign Het
Ddr2 T G 1: 169,998,084 T316P probably benign Het
Ddx51 G T 5: 110,654,558 E176* probably null Het
Deaf1 C T 7: 141,301,474 W573* probably null Het
Dedd2 C A 7: 25,203,598 R312L probably damaging Het
Def8 G T 8: 123,459,966 E428D possibly damaging Het
Defa21 T G 8: 21,025,723 F46V probably benign Het
Defa27 C A 8: 21,315,597 Q18K probably damaging Het
Defa27 A G 8: 21,315,598 Q18R probably damaging Het
Defb14 G T 8: 19,195,120 G38C probably damaging Het
Defb21 C A 2: 152,573,833 P22H unknown Het
Defb26 C T 2: 152,508,301 probably null Het
Dennd4b T G 3: 90,279,495 L1425R probably damaging Het
Depdc5 A T 5: 32,943,282 M846L possibly damaging Het
Dffb G T 4: 153,972,843 L126M probably damaging Het
Dgat2l6 C A X: 100,524,950 Q10K probably benign Het
Dgcr14 C T 16: 17,902,310 G393S possibly damaging Het
Dgcr8 C T 16: 18,278,318 probably null Het
Dgkb A G 12: 37,981,996 Q19R possibly damaging Het
Dgkb C A 12: 38,136,613 L254M probably damaging Het
Dgkd A C 1: 87,927,810 S725R probably benign Het
Dgkg C A 16: 22,588,398 A146S probably benign Het
Dglucy A C 12: 100,853,304 K425T probably benign Het
Dhx30 C A 9: 110,086,965 G722C probably damaging Het
Dhx34 G A 7: 16,218,644 R19* probably null Het
Dhx57 T G 17: 80,245,805 K1231T probably damaging Het
Diaph3 C A 14: 86,656,432 C1136F probably benign Het
Dicer1 C G 12: 104,731,020 A93P probably null Het
Dip2a T A 10: 76,266,323 S1446C possibly damaging Het
Dip2a T G 10: 76,280,820 T890P probably damaging Het
Disp3 G T 4: 148,250,957 P908T probably damaging Het
Dlc1 C A 8: 36,584,211 G338C probably damaging Het
Dlec1 C A 9: 119,138,786 P1218T probably benign Het
Dlg4 G A 11: 70,041,920 G512E probably benign Het
Dlgap1 C T 17: 70,815,209 P878S probably damaging Het
Dll4 G T 2: 119,326,052 probably benign Het
Dmbt1 T G 7: 131,088,812 I925S unknown Het
Dmd A G X: 83,627,286 K225R probably damaging Het
Dmd A T X: 83,878,484 L1453F possibly damaging Het
Dmkn G T 7: 30,776,497 W25L possibly damaging Het
Dmrt1 C T 19: 25,559,970 T307I possibly damaging Het
Dmrt2 T C 19: 25,678,000 L321P probably damaging Het
Dmrtb1 T A 4: 107,680,830 D47V probably damaging Het
Dnaaf1 A C 8: 119,575,441 D27A possibly damaging Het
Dnaaf2 G C 12: 69,197,850 H146D probably damaging Het
Dnah10 G T 5: 124,775,355 A1883S probably benign Het
Dnah11 C T 12: 117,931,177 R3645H possibly damaging Het
Dnah11 A C 12: 118,127,119 I1030S probably benign Het
Dnah11 A T 12: 118,130,799 L845M probably damaging Het
Dnah14 G C 1: 181,757,351 E3216Q possibly damaging Het
Dnah17 G T 11: 118,127,166 L168M probably benign Het
Dnah2 G A 11: 69,421,821 A4306V possibly damaging Het
Dnah2 G T 11: 69,451,120 Q2986K probably benign Het
Dnah2 G C 11: 69,487,054 N1317K possibly damaging Het
Dnah2 G A 11: 69,498,667 H800Y probably benign Het
Dnah2 T G 11: 69,516,481 Y492S probably damaging Het
Dnah2 C G 11: 69,516,523 G478A probably damaging Het
Dnah3 A G 7: 119,967,803 V13A Het
Dnah6 T A 6: 73,087,783 E2605D possibly damaging Het
Dnah6 G T 6: 73,133,559 T1681K probably benign Het
Dnah7a A C 1: 53,419,699 L3760R probably damaging Het
Dnah7a T G 1: 53,483,463 K2872T probably damaging Het
Dnah7c T A 1: 46,467,302 L180M probably benign Het
Dnah7c G T 1: 46,615,281 G107V probably damaging Het
Dnah7c G C 1: 46,639,665 V1790L probably benign Het
Dnah7c A T 1: 46,646,992 probably null Het
Dnah7c T C 1: 46,760,316 F3379L possibly damaging Het
Dnah8 A G 17: 30,648,540 K322R probably benign Het
Dnah9 T A 11: 65,895,972 I3612F probably damaging Het
Dnah9 G T 11: 65,927,853 L3220M probably damaging Het
Dnah9 A T 11: 65,970,084 L2820Q probably damaging Het
Dnah9 T A 11: 66,037,474 Q2123L probably damaging Het
Dnah9 C A 11: 66,072,835 G1764V probably damaging Het
Dnaic1 G T 4: 41,614,323 R333L probably benign Het
Dnajb6 G A 5: 29,752,445 G75D possibly damaging Het
Dnajb8 A T 6: 88,222,910 M143L possibly damaging Het
Dnajc1 C T 2: 18,293,987 A259T possibly damaging Het
Dnajc11 G A 4: 151,933,783 D11N probably benign Het
Dnajc28 G A 16: 91,617,033 H108Y probably benign Het
Dner C A 1: 84,383,980 R636L possibly damaging Het
Dnhd1 A T 7: 105,668,547 K483M probably damaging Het
Dnhd1 G T 7: 105,678,299 K50N probably benign Het
Dnhd1 A T 7: 105,703,036 probably null Het
Dnhd1 GT GTT 7: 105,703,580 probably null Het
Dnmbp T A 19: 43,866,688 K265N probably damaging Het
Dnmbp T A 19: 43,889,367 T422S probably benign Het
Dnmt1 T G 9: 20,915,863 K979T probably damaging Het
Dnmt1 C A 9: 20,926,554 V381L probably benign Het
Dnmt3a G T 12: 3,904,201 W791L probably damaging Het
Doc2b A T 11: 75,777,072 L284Q probably benign Het
Dock10 A C 1: 80,560,954 L959V probably benign Het
Dock11 G T X: 35,984,848 A699S possibly damaging Het
Dock2 A C 11: 34,718,924 F230V probably benign Het
Dock4 A T 12: 40,631,614 Y104F probably benign Het
Dock4 G C 12: 40,631,616 V105L probably benign Het
Dock7 C A 4: 98,945,225 G1945V unknown Het
Dock9 C A 14: 121,651,782 G308C probably benign Het
Dopey2 T A 16: 93,769,581 S1083R probably benign Het
Dopey2 G T 16: 93,803,546 S2037I probably damaging Het
Dopey2 G A 16: 93,807,868 G2132E possibly damaging Het
Dpagt1 G T 9: 44,329,125 V213L probably benign Het
Dpp10 C A 1: 123,353,440 E627* probably null Het
Dpp3 T G 19: 4,922,341 Q185P probably damaging Het
Dpp6 C A 5: 27,398,998 A142E probably damaging Het
Dpysl5 G T 5: 30,778,120 R189L probably benign Het
Drd2 G T 9: 49,395,655 E14* probably null Het
Dsc1 C A 18: 20,114,538 A7S probably benign Het
Dsc2 A T 18: 20,035,299 L701Q probably damaging Het
Dsg1c G T 18: 20,283,573 G844C probably damaging Het
Dsg2 C A 18: 20,580,621 F216L probably damaging Het
Dsp C G 13: 38,197,190 T2637R possibly damaging Het
Dst C G 1: 34,165,143 A806G probably benign Het
Dst G T 1: 34,188,467 E1714* probably null Het
Dst G C 1: 34,244,445 E3330D probably benign Het
Dst A G 1: 34,275,208 K4397E probably damaging Het
Dtx1 T C 5: 120,683,295 S396G probably benign Het
Dtx3l C G 16: 35,932,457 C593S probably damaging Het
Dtx3l G C 16: 35,933,183 S351C probably damaging Het
Dtx4 C G 19: 12,491,909 A285P probably benign Het
Duox1 G T 2: 122,333,038 G784W probably damaging Het
Duox2 T C 2: 122,296,507 T176A probably damaging Het
Dusp8 C A 7: 142,081,943 G637W unknown Het
Dusp8 C G 7: 142,090,077 R33P probably damaging Het
Dvl1 G T 4: 155,855,611 G400V probably benign Het
Dvl3 G C 16: 20,530,881 A535P probably damaging Het
Dydc2 C A 14: 41,061,983 R61L probably benign Het
Dync1i2 G T 2: 71,247,884 V306L probably benign Het
Dync2h1 G T 9: 7,142,361 P1195T probably damaging Het
Dync2h1 ACCC ACC 9: 7,168,730 probably null Het
Dyrk1a A T 16: 94,691,762 H618L probably benign Het
Dyrk4 T G 6: 126,892,128 K240N probably damaging Het
Dysf T A 6: 84,072,685 L372H probably damaging Het
Dzip1l G T 9: 99,641,761 G205V possibly damaging Het
E030025P04Rik C A 11: 109,143,971 Q30H unknown Het
E130114P18Rik G T 4: 97,569,200 P151Q unknown Het
E130308A19Rik G T 4: 59,720,313 C615F probably damaging Het
E230025N22Rik T A 18: 36,695,824 probably benign Het
E2f6 A C 12: 16,820,273 K142T possibly damaging Het
E4f1 G A 17: 24,446,145 S355L probably benign Het
Ears2 C G 7: 122,044,581 G385R probably damaging Het
Ears2 C G 7: 122,055,710 A112P possibly damaging Het
Ebna1bp2 A C 4: 118,621,146 K44T probably damaging Het
Ece1 T G 4: 137,921,027 F32V probably benign Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Edil3 G C 13: 88,944,870 G40R probably benign Het
Eef2 G T 10: 81,181,158 probably null Het
Efcab3 C A 11: 105,100,046 A93D probably damaging Het
Efcab3 T G 11: 105,108,772 Y162* probably null Het
Efcab5 C G 11: 77,132,139 D583H probably damaging Het
Efcc1 G T 6: 87,732,796 E257D probably benign Het
Efs C A 14: 54,920,336 V173L probably benign Het
Egf C A 3: 129,697,717 probably null Het
Ehbp1 G C 11: 22,095,590 P720A probably benign Het
Ehbp1l1 T A 19: 5,717,889 M1129L probably benign Het
Ehd3 C A 17: 73,805,285 P15T probably benign Het
Ehf C A 2: 103,279,518 G115C probably null Het
Eif2a G T 3: 58,548,884 V435L probably benign Het
Eif2d A T 1: 131,164,465 K324N probably damaging Het
Eif2d C G 1: 131,164,502 P337A probably damaging Het
Eif3i C A 4: 129,600,575 probably benign Het
Eif4e2 G A 1: 87,225,939 M155I probably benign Het
Eif4g1 G T 16: 20,673,408 probably benign Het
Eipr1 G T 12: 28,859,287 Q184H probably benign Het
Ell A C 8: 70,578,927 S92R probably damaging Het
Ell2 A C 13: 75,756,452 K220T probably damaging Het
Ell2 A T 13: 75,770,689 N605Y probably damaging Het
Elmod1 T G 9: 53,946,860 K2T probably benign Het
Elmsan1 T A 12: 84,173,499 Q227L probably damaging Het
Elmsan1 G T 12: 84,173,501 H226Q probably damaging Het
Elovl5 G C 9: 77,976,755 R111P possibly damaging Het
Eme1 A C 11: 94,650,696 I100S possibly damaging Het
Eml4 G C 17: 83,445,965 R355T probably damaging Het
Enam C A 5: 88,492,971 P164H probably damaging Het
Eng C G 2: 32,671,422 I148M possibly damaging Het
Eng G T 2: 32,673,424 G331C probably null Het
Eng G C 2: 32,681,452 R618P probably damaging Het
Enpp3 T G 10: 24,787,793 T557P probably benign Het
Entpd1 G T 19: 40,738,964 A519S probably benign Het
Entpd7 G C 19: 43,725,358 L385F probably benign Het
Ep400 A C 5: 110,756,635 L33V unknown Het
Epas1 C T 17: 86,827,946 S669L possibly damaging Het
Epb41l2 G T 10: 25,441,720 G45V probably benign Het
Epb41l2 A T 10: 25,499,902 R80* probably null Het
Epc2 G T 2: 49,535,300 G396C probably damaging Het
Epha10 T C 4: 124,883,942 W50R probably damaging Het
Epha10 G C 4: 124,885,775 G138A probably damaging Het
Epha3 G T 16: 63,585,012 P695Q probably damaging Het
Epha4 T C 1: 77,373,733 *987W probably null Het
Epha4 T G 1: 77,383,011 K735T probably damaging Het
Epha5 C T 5: 84,071,120 D765N possibly damaging Het
Epha8 C A 4: 136,938,696 R383L probably benign Het
Ephb1 G A 9: 102,223,398 P38L probably damaging Het
Ephb3 G T 16: 21,218,036 G337V possibly damaging Het
Ephx3 T G 17: 32,185,237 N343T probably damaging Het
Epop C A 11: 97,628,410 R291L probably damaging Het
Eral1 T G 11: 78,075,620 K244T probably damaging Het
Erap1 T A 13: 74,657,638 L166H probably damaging Het
Erbb4 CA CAA 1: 68,298,402 probably null Het
Erbb4 G T 1: 68,328,259 S433* probably null Het
Ercc2 A C 7: 19,385,668 S136R probably benign Het
Ercc6 A T 14: 32,526,487 S332C probably benign Het
Ereg G T 5: 91,090,120 G155V possibly damaging Het
Erg T G 16: 95,361,317 Q317P probably damaging Het
Erg T G 16: 95,409,750 Q81P possibly damaging Het
Erh C A 12: 80,642,804 L15F probably benign Het
Erich2 C A 2: 70,509,114 D4E possibly damaging Het
Erich3 T G 3: 154,698,701 I65S Het
Erich3 G T 3: 154,762,430 V840L Het
Ero1l G A 14: 45,299,890 P193L probably damaging Het
Esp18 C T 17: 39,408,166 L19F probably damaging Het
Esrp1 C T 4: 11,384,396 G96R probably damaging Het
Esrp1 A T 4: 11,385,765 L34Q possibly damaging Het
Etv4 C T 11: 101,770,590 V412M probably damaging Het
Exoc3l G T 8: 105,290,794 S546Y possibly damaging Het
Exoc3l2 C A 7: 19,480,061 L471M probably null Het
Exoc3l4 G T 12: 111,423,720 W243L probably damaging Het
Exoc8 C T 8: 124,896,666 V321I possibly damaging Het
Eya1 G C 1: 14,252,430 A270G probably benign Het
Eya1 G T 1: 14,302,868 P9Q probably damaging Het
F5 C G 1: 164,184,516 F434L probably damaging Het
F830045P16Rik G T 2: 129,536,530 probably benign Het
Fabp1 A T 6: 71,199,955 Q10L possibly damaging Het
Fads1 T A 19: 10,193,704 L299M probably damaging Het
Fads3 A T 19: 10,041,807 I26F probably benign Het
Faf1 A G 4: 109,840,356 D293G probably damaging Het
Fam109a G C 5: 121,852,907 A111P probably damaging Het
Fam124a T C 14: 62,606,408 M455T probably benign Het
Fam124b A C 1: 80,213,403 F88V possibly damaging Het
Fam149a C A 8: 45,342,458 R672L possibly damaging Het
Fam160a1 G T 3: 85,673,201 L566I probably benign Het
Fam160b2 G T 14: 70,586,204 S575R not run Het
Fam161b G T 12: 84,356,053 Q268K probably benign Het
Fam166b G T 4: 43,427,171 S87Y Het
Fam166b A G 4: 43,427,172 S87P Het
Fam170a C A 18: 50,281,584 A99D possibly damaging Het
Fam170b A C 14: 32,835,804 N199H probably damaging Het
Fam171a2 C G 11: 102,447,446 A24P unknown Het
Fam196a G T 7: 134,918,706 L32I probably damaging Het
Fam208a G A 14: 27,429,208 G47D probably damaging Het
Fam208a T G 14: 27,477,148 L1341R probably damaging Het
Fam208b C A 13: 3,576,636 V1105L probably benign Het
Fam208b C A 13: 3,588,429 R434M probably damaging Het
Fam213b A C 4: 154,898,989 L6R probably damaging Het
Fam240a T G 9: 110,916,509 K29T probably damaging Het
Fam3b C A 16: 97,481,844 R77L probably damaging Het
Fam46b G T 4: 133,486,682 R288L probably damaging Het
Fam47e G T 5: 92,579,668 R145L possibly damaging Het
Fam71a C T 1: 191,163,745 V234I probably benign Het
Fam83g C A 11: 61,707,470 P728T probably benign Het
Fance T G 17: 28,318,064 L14R probably damaging Het
Fancm A C 12: 65,094,926 E440D probably benign Het
Fap C A 2: 62,528,774 S428I possibly damaging Het
Farp2 T C 1: 93,580,136 F519L probably benign Het
Farp2 G C 1: 93,580,461 G627A probably benign Het
Farp2 G T 1: 93,580,467 G629V probably benign Het
Fat1 G A 8: 44,950,598 D129N probably benign Het
Fat1 A C 8: 45,023,596 H1893P possibly damaging Het
Fat1 G T 8: 45,036,838 D3596Y probably damaging Het
Fat2 A G 11: 55,282,795 L2364P probably damaging Het
Fat2 G T 11: 55,284,991 A1632E probably damaging Het
Fat2 T G 11: 55,303,700 K1171T probably damaging Het
Fat2 T G 11: 55,310,121 H709P probably damaging Het
Fat3 G T 9: 15,947,526 P3798Q probably damaging Het
Fat3 G T 9: 16,375,429 P933T probably damaging Het
Fat3 T G 9: 16,375,617 H870P probably benign Het
Fat4 G T 3: 38,983,359 G3720V probably benign Het
Fat4 C G 3: 38,983,815 P3872R probably damaging Het
Fblim1 C T 4: 141,595,371 A34T possibly damaging Het
Fbn1 C T 2: 125,387,350 G504S possibly damaging Het
Fbxl16 G C 17: 25,817,011 G194A possibly damaging Het
Fbxl18 T G 5: 142,886,424 K352T possibly damaging Het
Fbxl19 CT C 7: 127,761,275 probably null Het
Fbxl21 C A 13: 56,527,003 L56I probably benign Het
Fbxl22 G T 9: 66,511,888 R156S probably benign Het
Fbxl4 T C 4: 22,427,280 L507P probably damaging Het
Fbxo17 G C 7: 28,732,777 G93A unknown Het
Fbxo24 T G 5: 137,621,403 K187T probably damaging Het
Fbxo28 T A 1: 182,317,870 I218F probably damaging Het
Fbxo30 A T 10: 11,295,320 E714V probably damaging Het
Fbxo32 C A 15: 58,205,242 D115Y probably damaging Het
Fbxo40 T A 16: 36,969,599 D383V probably damaging Het
Fbxo42 T G 4: 141,180,534 probably null Het
Fbxw19 T C 9: 109,481,582 K424R probably benign Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fbxw25 C A 9: 109,651,738 W291C Het
Fdx1l C A 9: 21,073,492 M5I probably benign Het
Fer1l5 C A 1: 36,390,563 Y465* probably null Het
Fermt1 C G 2: 132,906,756 G649A probably damaging Het
Fermt1 G T 2: 132,936,018 P177Q probably benign Het
Fermt1 G T 2: 132,941,943 Q49K probably benign Het
Ffar3 A T 7: 30,855,193 F234Y probably damaging Het
Fgd3 C A 13: 49,281,826 D319Y probably damaging Het
Fgd5 A C 6: 91,988,889 K701T probably damaging Het
Fgr C A 4: 133,000,170 H461N probably benign Het
Fibcd1 G A 2: 31,838,539 T102I probably benign Het
Flg A C 3: 93,279,962 R240S probably benign Het
Flii C A 11: 60,722,313 G221C possibly damaging Het
Flnb T G 14: 7,942,066 I2348S probably benign Het
Flot1 A C 17: 35,825,823 K219T probably damaging Het
Flrt2 G T 12: 95,778,912 W8L possibly damaging Het
Flrt2 G T 12: 95,779,559 G224C probably damaging Het
Flywch1 A C 17: 23,761,009 W264G probably benign Het
Fmn2 G T 1: 174,608,394 V644L unknown Het
Fmo2 G T 1: 162,887,598 Q152K probably benign Het
Fmo2 C A 1: 162,898,274 G11V probably damaging Het
Fmo6 G C 1: 162,926,132 S147* probably null Het
Fmod T G 1: 134,040,919 Y232* probably null Het
Fn1 C G 1: 71,597,411 G2194A probably benign Het
Fndc1 C A 17: 7,773,593 G424* probably null Het
Fndc1 T G 17: 7,804,877 K82T possibly damaging Het
Fndc3a C A 14: 72,567,373 K489N probably damaging Het
Fndc3c1 G T X: 106,434,329 P767T not run Het
Foxd1 G C 13: 98,355,938 G440A unknown Het
Foxd3 C A 4: 99,657,066 P148T probably damaging Het
Foxf1 G T 8: 121,084,529 R44L probably damaging Het
Foxi1 G T 11: 34,207,488 P179H probably damaging Het
Foxi3 G A 6: 70,956,798 A90T probably benign Het
Foxj2 A T 6: 122,832,936 probably null Het
Foxj2 G T 6: 122,833,711 A217S probably benign Het
Foxo3 T TG 10: 42,275,265 probably null Het
Fpgs C T 2: 32,692,660 R67H probably benign Het
Fpr3 C A 17: 17,970,993 H175Q possibly damaging Het
Fpr-rs7 C A 17: 20,113,393 W278C probably benign Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frem1 C A 4: 82,999,983 G574V probably damaging Het
Frem3 C A 8: 80,611,503 R142S probably damaging Het
Frem3 T C 8: 80,615,431 L1451P probably benign Het
Frg1 T A 8: 41,399,638 R186* probably null Het
Frmd4a A G 2: 4,498,021 D107G probably damaging Het
Frmpd3 G T X: 140,433,010 E1575* probably null Het
Fryl T C 5: 73,072,837 D1659G probably benign Het
Fscb T G 12: 64,472,930 E587D unknown Het
Fsd2 T C 7: 81,553,192 E213G probably damaging Het
Fshr C G 17: 89,046,667 A88P probably benign Het
Fsip1 G T 2: 118,136,483 L454I possibly damaging Het
Fsip2 G T 2: 82,989,665 M5247I probably benign Het
Fstl3 G C 10: 79,781,198 V192L probably benign Het
Fstl5 A T 3: 76,707,982 K783N probably damaging Het
Fubp1 G A 3: 152,222,087 G391D probably damaging Het
Fxn C G 19: 24,262,042 R162P probably damaging Het
Fyb2 G C 4: 104,913,660 Q57H probably damaging Het
Gabpb2 G T 3: 95,190,693 T223N probably benign Het
Gabra3 C T X: 72,445,353 S322N probably damaging Het
Gabra4 G T 5: 71,623,895 A391D probably benign Het
Gabrp T C 11: 33,552,673 E397G probably benign Het
Gabrr3 C A 16: 59,407,482 S34* probably null Het
Gadd45a C A 6: 67,036,736 G109V probably benign Het
Gal3st2b T G 1: 93,938,685 L36R probably damaging Het
Galm C G 17: 80,183,233 T273S possibly damaging Het
Galnt9 CG C 5: 110,596,146 probably null Het
Galntl5 C A 5: 25,203,189 P220T probably damaging Het
Galntl6 A C 8: 57,857,558 Y370D probably damaging Het
Garem1 T G 18: 21,129,792 K655T probably damaging Het
Garem1 G A 18: 21,148,325 H325Y probably damaging Het
Gatad2a T A 8: 69,936,038 probably null Het
Gba A T 3: 89,204,005 K26* probably null Het
Gbp3 G A 3: 142,561,863 V34M probably damaging Het
Gck C A 11: 5,906,526 M210I probably damaging Het
Gckr G T 5: 31,300,831 R172I probably damaging Het
Gdap1l1 G T 2: 163,447,670 R185L probably damaging Het
Gdf10 C T 14: 33,932,532 T332M possibly damaging Het
Gdf15 T C 8: 70,629,890 S189G probably benign Het
Gdf7 C T 12: 8,298,409 R304H unknown Het
Gdf7 G T 12: 8,298,578 P240T unknown Het
Gdf9 C A 11: 53,437,525 T436K probably damaging Het
Gemin4 G T 11: 76,217,579 probably benign Het
Gga3 T G 11: 115,587,603 Q454H probably benign Het
Ggt5 A G 10: 75,602,618 probably null Het
Ggt7 T A 2: 155,491,078 R622W probably damaging Het
Ggt7 T A 2: 155,499,063 N394I probably damaging Het
Gh G C 11: 106,301,184 R67G probably damaging Het
Ghdc A G 11: 100,769,417 L168P probably benign Het
Ghr A G 15: 3,347,485 Y85H probably benign Het
Gimap1 A C 6: 48,743,249 K265T probably damaging Het
Gimap1 T G 6: 48,743,356 *301E probably null Het
Gimap7 C A 6: 48,724,153 D224E probably benign Het
Gins3 G T 8: 95,633,520 probably benign Het
Gjc1 C A 11: 102,800,008 G390W unknown Het
Glcci1 A T 6: 8,582,674 Q345L possibly damaging Het
Glipr1 G T 10: 111,988,837 P155T probably benign Het
Glis3 G C 19: 28,283,768 P791R possibly damaging Het
Glra3 G T 8: 56,062,500 M203I probably benign Het
Gls C G 1: 52,214,488 D274H probably damaging Het
Gm10300 C G 4: 132,074,809 P38R unknown Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10324 G A 13: 66,122,469 R483K probably benign Het
Gm10324 T A 13: 66,122,673 F551Y probably benign Het
Gm10340 A G 14: 3,134,911 R60G possibly damaging Het
Gm10803 G C 2: 93,564,136 Q84H unknown Het
Gm11565 C T 11: 99,914,851 S23F possibly damaging Het
Gm11567 G A 11: 99,879,332 S32N unknown Het
Gm11567 C A 11: 99,879,421 Q62K unknown Het
Gm11567 C A 11: 99,879,625 Q130K unknown Het
Gm11639 G C 11: 105,001,967 G4247R probably benign Het
Gm11983 T G 11: 6,836,861 K89Q unknown Het
Gm11983 T C 11: 6,837,047 K27E unknown Het
Gm12185 T G 11: 48,908,086 I527L probably benign Het
Gm12888 G T 4: 121,324,808 P29H probably damaging Het
Gm13089 G C 4: 143,696,945 H425D probably benign Het
Gm13103 A G 4: 143,853,110 S422G probably benign Het
Gm13178 C A 4: 144,703,325 G365W probably damaging Het
Gm13212 G C 4: 145,622,968 S325T possibly damaging Het
Gm15130 A G 2: 111,144,587 probably null Het
Gm16503 A C 4: 147,541,156 T36P unknown Het
Gm17019 C T 5: 15,032,997 probably benign Het
Gm17124 A G 14: 42,597,223 probably null Het
Gm19410 G T 8: 35,792,611 W800L possibly damaging Het
Gm21083 T G 5: 15,577,458 V41G probably benign Het
Gm21149 G T 5: 15,472,148 A236D probably damaging Het
Gm21149 G C 5: 15,476,412 R18G not run Het
Gm21190 G A 5: 15,524,894 P242L probably benign Het
Gm21190 A C 5: 15,524,974 D215E not run Het
Gm21190 G T 5: 15,526,580 T136N probably benign Het
Gm21680 C T 5: 25,971,419 S60N probably benign Het
Gm21886 G C 18: 80,089,387 Y185* probably null Het
Gm21886 G T 18: 80,089,923 L14M probably damaging Het
Gm28729 C T 9: 96,492,088 R401H unknown Het
Gm29609 A T 5: 31,154,242 W852R probably benign Het
Gm29797 G C 2: 181,659,095 A128P probably damaging Het
Gm30302 T C 13: 49,785,384 D950G possibly damaging Het
Gm30302 T C 13: 49,786,462 R591G possibly damaging Het
Gm30302 A C 13: 49,787,848 L39V probably damaging Het
Gm3238 G T 10: 77,771,024 P101Q unknown Het
Gm32742 G A 9: 51,159,165 Q76* probably null Het
Gm3285 G A 10: 77,862,434 C139Y unknown Het
Gm3543 T G 14: 41,981,007 N60T probably damaging Het
Gm364 T A X: 57,417,721 N140K probably benign Het
Gm364 T C X: 57,463,184 F487L probably benign Het
Gm3776 T A 9: 78,258,763 C18S probably benign Het
Gm4450 G T 3: 98,456,455 Q25K probably benign Het
Gm45618 T C 7: 142,120,218 K171R unknown Het
Gm45861 G A 8: 27,584,869 G1416S unknown Het
Gm4737 T C 16: 46,154,229 M262V probably benign Het
Gm4779 G T X: 101,792,186 P504H unknown Het
Gm4788 G T 1: 139,698,256 R827S probably benign Het
Gm4788 G C 1: 139,733,448 C554W probably damaging Het
Gm47985 T C 1: 151,183,141 S178P possibly damaging Het
Gm4858 G T 3: 93,074,055 G53W probably damaging Het
Gm49336 C A 14: 60,239,502 C240F probably null Het
Gm5111 C A 6: 48,590,309 L153M unknown Het
Gm5538 C A 3: 59,747,194 Q150K probably benign Het
Gm5592 C G 7: 41,286,317 T81R probably damaging Het
Gm5592 G A 7: 41,286,319 E82K possibly damaging Het
Gm5592 C A 7: 41,288,681 D462E probably benign Het
Gm5862 TGGG TGG 5: 26,018,487 probably null Het
Gm5936 T G X: 74,842,035 V347G probably benign Het
Gm6377 T G X: 109,198,293 L160R probably damaging Het
Gm6588 T C 5: 112,449,875 V96A probably benign Het
Gm6614 A G 6: 141,990,348 F357S probably benign Het
Gm6871 C A 7: 41,546,413 G300V probably damaging Het
Gm7138 C G 10: 77,776,853 C31S unknown Het
Gm7145 A C 1: 117,986,351 K321T probably benign Het
Gm7298 A C 6: 121,764,870 E417A probably benign Het
Gm7298 G T 6: 121,764,875 D419Y possibly damaging Het
Gm732 A C X: 107,945,825 I494S possibly damaging Het
Gm7534 C G 4: 134,200,338 R368P possibly damaging Het
Gm7534 A G 4: 134,202,677 S106P probably benign Het
Gm7579 G T 7: 142,211,941 G28V unknown Het
Gm8369 G C 19: 11,511,624 A92P probably damaging Het
Gm853 T A 4: 130,221,704 H17L probably benign Het
Gm8693 T C 7: 22,691,842 K159R probably benign Het
Gm884 C T 11: 103,613,681 G2487D probably benign Het
Gm8879 C G 5: 11,130,351 N75K probably benign Het
Gm8994 G C 6: 136,329,023 A161P possibly damaging Het
Gm9112 G A X: 102,707,027 T72M probably benign Het
Gm9513 A C 9: 36,476,511 N31T probably damaging Het
Gm9573 G T 17: 35,621,245 S683Y unknown Het
Gm960 G T 19: 4,625,903 R734S unknown Het
Gm973 T G 1: 59,524,602 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9887 C A 12: 69,371,941 W173L not run Het
Gm9964 T C 11: 79,296,400 R74G unknown Het
Gm9992 C A 17: 7,376,530 G127W probably damaging Het
Gmip C T 8: 69,816,292 R496W probably damaging Het
Gmpr2 T G 14: 55,672,743 L10R probably benign Het
Gna12 T A 5: 140,760,553 Q379L probably damaging Het
Gna12 C A 5: 140,762,607 D185Y probably damaging Het
Gnas C A 2: 174,298,606 P249T unknown Het
Gnptab G T 10: 88,431,368 E440D probably damaging Het
Gpa33 C A 1: 166,164,671 C261* probably null Het
Gpat2 C A 2: 127,430,882 F171L probably benign Het
Gpat2 G C 2: 127,433,808 G502A probably damaging Het
Gpat4 C G 8: 23,179,798 S313T probably benign Het
Gpatch1 C A 7: 35,310,485 G55C probably damaging Het
Gpc5 T A 14: 115,369,964 L326Q probably damaging Het
Gpd1l C A 9: 114,904,780 G283W probably damaging Het
Gpnmb C A 6: 49,051,832 A428D possibly damaging Het
Gpr101 T G X: 57,501,274 H172P probably benign Het
Gpr158 G T 2: 21,810,690 probably null Het
Gpr179 G C 11: 97,336,648 S1560R probably benign Het
Gpr26 C A 7: 131,967,048 P41T probably damaging Het
Gpr26 C G 7: 131,967,225 L100V probably damaging Het
Gpr39 G T 1: 125,872,843 G444W probably damaging Het
Gprasp2 G T X: 135,842,893 G334W probably damaging Het
Gprin1 C A 13: 54,740,397 Q21H probably benign Het
Gpsm1 G T 2: 26,327,345 Q408H possibly damaging Het
Grb10 C A 11: 11,944,845 A359S possibly damaging Het
Grb7 G T 11: 98,453,971 probably null Het
Grb7 G C 11: 98,454,484 G456R probably damaging Het
Greb1 C A 12: 16,696,756 C1171F probably benign Het
Greb1l G C 18: 10,515,305 G699A probably damaging Het
Gria3 C A X: 41,478,647 A113D probably benign Het
Grid2 G A 6: 63,908,879 M86I possibly damaging Het
Grid2 A G 6: 64,663,228 Q810R probably benign Het
Grik5 T A 7: 25,013,804 D793V probably damaging Het
Grin1 GCTCTC GCTC 2: 25,297,907 probably null Het
Grin3a A G 4: 49,770,622 S717P probably damaging Het
Grip1 C A 10: 119,819,483 probably benign Het
Grip2 G C 6: 91,763,510 P1023A possibly damaging Het
Grk2 C G 19: 4,287,645 M568I probably benign Het
Grk3 C A 5: 112,957,314 probably null Het
Grm5 G T 7: 87,602,715 G58W probably damaging Het
Grm6 C A 11: 50,859,537 P509H probably benign Het
Grm7 A G 6: 111,358,149 E507G probably benign Het
Grm7 G T 6: 111,358,490 V621F probably damaging Het
Grm8 G C 6: 28,126,027 S33R probably benign Het
Grpr A G X: 163,515,034 L338P probably damaging Het
Grtp1 T G 8: 13,200,199 I17L probably benign Het
Gsdma C A 11: 98,669,759 P179H probably damaging Het
Gsk3b A T 16: 38,208,070 K297* probably null Het
Gspt2 GC G X: 94,637,468 probably null Het
Gtf2h3 G T 5: 124,579,175 probably benign Het
Gtf2i C A 5: 134,263,645 G415V probably null Het
Gtf2ird1 T G 5: 134,409,312 probably null Het
Gtf3a G A 5: 146,951,204 C105Y probably damaging Het
Gtf3c1 T A 7: 125,703,964 I100F probably damaging Het
Gtse1 A G 15: 85,868,746 K354R possibly damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy1a2 A C 9: 3,635,156 K400T probably damaging Het
Gulp1 C A 1: 44,788,479 D260E probably damaging Het
Gxylt2 T G 6: 100,783,191 L229R probably damaging Het
Gykl1 A G 18: 52,694,547 K276E probably damaging Het
H2-Eb2 A C 17: 34,334,309 E156D possibly damaging Het
H2-M11 A C 17: 36,548,770 R218S possibly damaging Het
H2-Q2 A C 17: 35,345,675 Q351P probably damaging Het
H2-T3 C G 17: 36,186,580 L382F possibly damaging Het
H2-T3 A T 17: 36,186,582 L382M possibly damaging Het
Habp2 T C 19: 56,317,760 V426A probably damaging Het
Hacd1 C A 2: 14,035,795 M216I probably damaging Het
Hacd2 G T 16: 35,106,325 Q231H probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Hal G A 10: 93,489,893 M89I probably benign Het
Hbb-bt A G 7: 103,813,892 probably benign Het
Hc T A 2: 35,006,273 probably null Het
Hcar1 T A 5: 123,879,741 probably benign Het
Hcfc2 G C 10: 82,699,172 R10T probably damaging Het
Hcls1 G T 16: 36,961,492 R321M possibly damaging Het
Hcn4 G T 9: 58,858,148 G638C unknown Het
Hdac1 T A 4: 129,542,616 Q5L probably benign Het
Hdac9 G T 12: 34,373,987 T536K probably benign Het
Hdgfl2 G T 17: 56,079,825 R24L possibly damaging Het
Hdgfl2 G T 17: 56,097,016 A281S probably null Het
Heatr1 T G 13: 12,399,008 N155K possibly damaging Het
Hecw1 G A 13: 14,300,333 A540V possibly damaging Het
Hells G T 19: 38,965,407 R765S possibly damaging Het
Helq C A 5: 100,766,766 L953F possibly damaging Het
Helz2 G C 2: 181,237,564 P754A probably benign Het
Heph G C X: 96,554,922 E919Q probably damaging Het
Herc1 A C 9: 66,434,576 E1882D probably benign Het
Herc2 G A 7: 56,097,533 V473I possibly damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herc2 G T 7: 56,132,498 G1311V probably damaging Het
Herc3 G T 6: 58,843,858 E76* probably null Het
Herc4 T G 10: 63,307,749 I686S probably benign Het
Herc6 G T 6: 57,600,031 G243V probably damaging Het
Herpud2 C G 9: 25,130,622 V85L not run Het
Hexdc C A 11: 121,215,237 P117T probably damaging Het
Hip1r A G 5: 123,997,010 Q403R probably damaging Het
Hist1h1b T C 13: 21,780,094 K154R unknown Het
Hist1h4i C A 13: 22,041,214 R37L probably damaging Het
Hist2h2ab G T 3: 96,220,051 A46S probably benign Het
Hivep3 C T 4: 120,133,782 R2160W probably damaging Het
Hlcs A C 16: 94,262,659 L367R probably damaging Het
Hmcn1 G T 1: 150,586,445 Q5161K probably null Het
Hmcn1 A G 1: 150,655,921 V3199A possibly damaging Het
Hmcn1 A G 1: 150,663,917 V2941A probably benign Het
Hmcn2 G C 2: 31,344,029 D269H possibly damaging Het
Hmcn2 C A 2: 31,425,416 L3726M probably damaging Het
Hmcn2 G T 2: 31,429,091 R3934S probably damaging Het
Hmga2 G C 10: 120,370,671 P113A unknown Het
Hmgcs2 G A 3: 98,290,945 G55S probably damaging Het
Hmx2 A T 7: 131,554,467 E54V probably damaging Het
Hnf1a CA C 5: 114,950,124 probably null Het
Hnrnpa2b1 G T 6: 51,467,243 T20N probably damaging Het
Hnrnpf G A 6: 117,923,784 G10S probably benign Het
Hnrnph2 G T X: 134,605,133 E76* probably null Het
Hnrnpu T G 1: 178,332,215 N434H unknown Het
Hnrnpul1 C A 7: 25,724,664 S721I probably benign Het
Hnrnpul1 G C 7: 25,724,698 P710A unknown Het
Hoxb1 C A 11: 96,367,051 P269Q probably benign Het
Hoxd9 G C 2: 74,698,128 A25P probably damaging Het
Hp1bp3 C T 4: 138,221,673 L16F not run Het
Hpd C A 5: 123,181,475 G49V probably damaging Het
Hps1 C A 19: 42,766,686 R272S probably null Het
Hsd17b13 G T 5: 103,968,705 P184T probably benign Het
Hsd17b3 C T 13: 64,063,138 G182S possibly damaging Het
Hsd3b1 T G 3: 98,852,886 Q263P probably damaging Het
Hsd3b2 C T 3: 98,712,222 E136K probably benign Het
Hsd3b3 A G 3: 98,743,960 V58A probably benign Het
Hsdl2 A T 4: 59,617,706 K478* probably null Het
Hspa1l G C 17: 34,978,492 K502N possibly damaging Het
Htr1f G T 16: 64,926,077 S284* probably null Het
Htr1f G T 16: 64,926,874 N18K probably benign Het
Htr7 G T 19: 35,969,423 T397N probably damaging Het
Htra2 C A 6: 83,054,383 R15L probably benign Het
Hunk C A 16: 90,472,573 P335H probably damaging Het
Huwe1 C A X: 151,856,575 H356N probably damaging Het
Huwe1 A C X: 151,928,381 K3958T unknown Het
Hyal4 G A 6: 24,756,628 V282M probably damaging Het
Hydin T G 8: 110,541,600 F2904V possibly damaging Het
Hyou1 G T 9: 44,387,742 E621* probably null Het
Ice1 C A 13: 70,605,201 C922F probably damaging Het
Ide C T 19: 37,315,491 V238M Het
Idh3b T A 2: 130,281,542 probably null Het
Ifi204 C A 1: 173,751,628 K550N probably null Het
Ifi206 T G 1: 173,482,048 K127N Het
Ifi27l2b C A 12: 103,457,033 G7C unknown Het
Ifi44 A G 3: 151,732,453 L399P probably damaging Het
Ifih1 T G 2: 62,617,469 Q297P probably benign Het
Ifitm1 C A 7: 140,969,517 T71K probably benign Het
Ifna5 C T 4: 88,835,999 H159Y probably damaging Het
Ifnab T G 4: 88,690,718 E170D probably damaging Het
Ift122 A C 6: 115,915,994 D854A probably damaging Het
Ift172 C A 5: 31,276,924 W490L probably damaging Het
Igfbp4 C G 11: 99,051,515 P234R probably damaging Het
Igfn1 G T 1: 135,972,000 H524Q probably damaging Het
Ighv1-12 C A 12: 114,616,013 G63V possibly damaging Het
Ighv14-4 C A 12: 114,176,667 C41F probably damaging Het
Ighv14-4 C G 12: 114,176,672 L39F probably damaging Het
Ighv1-52 C A 12: 115,145,777 V21F probably damaging Het
Ighv1-63 C T 12: 115,495,645 A111T possibly damaging Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv1-9 T G 12: 114,583,834 E29A probably benign Het
Igkv1-35 C T 6: 70,011,034 G93R possibly damaging Het
Igkv1-99 T A 6: 68,542,262 S68T Het
Igkv3-12 A T 6: 70,518,611 I41F probably benign Het
Igkv4-74 T C 6: 69,185,345 Q6R possibly damaging Het
Igkv6-32 T A 6: 70,074,586 probably benign Het
Igsf21 A T 4: 140,067,215 C116S probably damaging Het
Igsf5 C G 16: 96,391,023 S274C probably damaging Het
Igsf8 G T 1: 172,318,354 A406S probably damaging Het
Igsf9 G C 1: 172,492,149 G337A probably damaging Het
Igsf9 G T 1: 172,495,226 A586S probably benign Het
Igsf9b A G 9: 27,317,353 probably null Het
Ihh T G 1: 74,946,094 S411R probably damaging Het
Ik G T 18: 36,753,515 D347Y possibly damaging Het
Ikbkap T A 4: 56,790,146 T315S probably benign Het
Ikzf1 G T 11: 11,758,194 probably null Het
Ikzf3 T G 11: 98,467,181 E443D probably benign Het
Ikzf4 G A 10: 128,634,230 P527S possibly damaging Het
Il10ra A C 9: 45,266,632 S67A possibly damaging Het
Il16 C G 7: 83,652,827 S727T probably benign Het
Il17rc G T 6: 113,476,795 probably null Het
Il1rap G T 16: 26,722,399 R463S probably damaging Het
Il27ra C A 8: 84,040,990 W101C probably damaging Het
Il2ra C A 2: 11,681,931 A191D probably damaging Het
Il6st A G 13: 112,493,618 K333E probably benign Het
Impg1 C G 9: 80,378,467 R418S probably benign Het
Incenp C A 19: 9,877,687 W620L unknown Het
Inhbb C A 1: 119,417,798 V254L probably benign Het
Inpp4b C G 8: 82,069,001 A818G possibly damaging Het
Inpp5b CA C 4: 124,797,840 probably null Het
Inpp5d T G 1: 87,669,709 F201V probably benign Het
Inpp5d T G 1: 87,703,131 L671W probably damaging Het
Inpp5j G T 11: 3,502,484 Y255* probably null Het
Insc C T 7: 114,811,639 Q244* probably null Het
Insm1 C T 2: 146,223,556 Q431* probably null Het
Ints12 A C 3: 133,102,464 D201A probably damaging Het
Ints6l G A X: 56,497,935 M527I probably damaging Het
Ints9 G A 14: 65,037,454 V620I probably benign Het
Ipo13 C A 4: 117,904,630 E458* probably null Het
Ipp G T 4: 116,537,885 G539V probably null Het
Iqca A T 1: 90,045,725 V775E probably benign Het
Iqcf3 G T 9: 106,560,988 P12Q unknown Het
Iqck C A 7: 118,941,654 R259S probably benign Het
Iqgap1 C A 7: 80,768,309 K104N probably benign Het
Iqgap2 A G 13: 95,731,443 I219T possibly damaging Het
Irgq G T 7: 24,531,801 G139V probably damaging Het
Irs2 T G 8: 11,006,185 D749A probably damaging Het
Irx6 C A 8: 92,678,371 P289H possibly damaging Het
Isl2 C A 9: 55,542,215 C58* probably null Het
Ism1 A C 2: 139,731,874 N48T probably benign Het
Itga7 A C 10: 128,953,827 K1012T probably benign Het
Itga8 A C 2: 12,247,518 F294V probably damaging Het
Itga8 C A 2: 12,262,136 A163S probably benign Het
Itga8 C A 2: 12,301,832 probably benign Het
Itga9 A C 9: 118,843,530 D790A probably benign Het
Itga9 G A 9: 118,887,839 V990M probably damaging Het
Itgad T A 7: 128,190,087 N574K probably damaging Het
Itgax G C 7: 128,144,872 R909T probably benign Het
Itgb2 A T 10: 77,557,962 Q412L probably benign Het
Itgb3 G T 11: 104,643,623 K435N possibly damaging Het
Itgb4 G A 11: 116,006,520 G1536R probably damaging Het
Itgb6 G C 2: 60,611,468 S666C possibly damaging Het
Itgbl1 G T 14: 123,954,672 G373C probably damaging Het
Itih4 GAA G 14: 30,899,462 probably null Het
Itm2c G A 1: 85,906,527 V188M possibly damaging Het
Itpka G C 2: 119,742,800 S141T probably damaging Het
Itpkc C A 7: 27,227,638 D284Y probably benign Het
Itpr1 T A 6: 108,499,149 W2275R probably damaging Het
Ivd G T 2: 118,876,344 K272N possibly damaging Het
Ivns1abp A G 1: 151,351,033 E12G probably damaging Het
Jak1 C A 4: 101,163,681 G654V probably damaging Het
Jak1 C T 4: 101,163,722 M640I probably benign Het
Jak2 G A 19: 29,271,398 E92K possibly damaging Het
Jak3 C G 8: 71,680,683 A340G possibly damaging Het
Jakmip3 G T 7: 139,020,133 R254L probably benign Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jph1 C T 1: 17,097,352 E85K possibly damaging Het
Jph4 G A 14: 55,113,648 R304C probably benign Het
Jun T A 4: 95,051,378 probably benign Het
Kank4 TGGAGGGGGGAGGG TGG 4: 98,778,294 probably null Het
Kat6a C G 8: 22,910,154 C310W probably damaging Het
Katna1 G T 10: 7,759,785 S328I probably damaging Het
Katnal2 T C 18: 77,012,057 K127R probably benign Het
Kbtbd2 T G 6: 56,780,309 E147D probably damaging Het
Kcna3 A T 3: 107,037,266 N282Y probably damaging Het
Kcna5 T A 6: 126,533,716 K483M probably damaging Het
Kcnb1 G T 2: 167,188,402 D74E probably damaging Het
Kcne2 C T 16: 92,296,591 A2V probably benign Het
Kcnh1 C A 1: 192,418,737 R573S probably damaging Het
Kcnh8 C A 17: 52,894,061 L508I probably damaging Het
Kcnj2 G T 11: 111,072,135 V118L probably benign Het
Kcnk18 G T 19: 59,234,959 A179S probably benign Het
Kcnq4 A C 4: 120,698,497 probably null Het
Kcns1 G A 2: 164,168,633 H69Y probably benign Het
Kcnt1 G C 2: 25,906,796 R809P probably benign Het
Kcnt2 G C 1: 140,376,361 W156C probably damaging Het
Kcnv2 G T 19: 27,323,438 A230S probably benign Het
Kcp T A 6: 29,485,012 E1247V probably benign Het
Kctd1 C T 18: 15,063,125 S147N unknown Het
Kctd12 C G 14: 102,981,918 G175R not run Het
Kctd19 A C 8: 105,385,136 F842V probably damaging Het
Kdm3b G T 18: 34,809,069 E738* probably null Het
Kdm4a C T 4: 118,153,190 E619K probably benign Het
Kdm4a T A 4: 118,177,502 S11C probably benign Het
Kdm5b G A 1: 134,625,035 D1250N probably damaging Het
Kel G T 6: 41,687,572 P644T probably damaging Het
Khdc1c G T 1: 21,369,563 E113* probably null Het
Khdrbs2 G T 1: 32,333,662 W139L unknown Het
Khdrbs3 T C 15: 69,017,467 L155P probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 T G 4: 63,171,997 E3D possibly damaging Het
Kif13b C G 14: 64,803,344 P1627R probably benign Het
Kif14 A T 1: 136,496,653 Q1002L probably damaging Het
Kif14 G T 1: 136,500,016 probably null Het
Kif18a G A 2: 109,318,053 G631R possibly damaging Het
Kif19a A T 11: 114,786,590 E600V probably damaging Het
Kif19a C A 11: 114,789,829 A925E probably benign Het
Kif1a G C 1: 93,021,316 L1495V probably damaging Het
Kif1a G A 1: 93,022,491 R1405W probably damaging Het
Kif1a G A 1: 93,055,697 P693S probably benign Het
Kif1b T G 4: 149,266,298 K273T possibly damaging Het
Kif20b C G 19: 34,952,875 S1260C probably benign Het
Kif21b C A 1: 136,154,137 T641K probably benign Het
Kif26a G C 12: 112,177,618 E1435D probably damaging Het
Kif28 T G 1: 179,733,134 K202T probably benign Het
Kif2b C A 11: 91,576,264 E398* probably null Het
Kirrel2 T C 7: 30,453,457 T379A probably benign Het
Klf17 G T 4: 117,760,351 R270S probably benign Het
Klhdc7a G T 4: 139,967,797 probably benign Het
Klhdc8b T A 9: 108,448,377 Q326L probably benign Het
Klhl18 C G 9: 110,437,347 A300P probably null Het
Klhl2 C A 8: 64,758,126 R296L probably damaging Het
Klhl22 G A 16: 17,776,696 D230N probably benign Het
Klhl30 C G 1: 91,359,465 A491G probably damaging Het
Klhl6 G T 16: 19,953,674 T307N probably damaging Het
Klk8 C A 7: 43,803,725 R247S possibly damaging Het
Klkb1 G T 8: 45,273,629 R446S probably damaging Het
Klra1 C G 6: 130,372,851 W208S probably damaging Het
Klra3 C A 6: 130,335,721 E27* probably null Het
Klra5 G C 6: 129,911,452 P4A not run Het
Klrb1a GT G 6: 128,618,585 probably null Het
Kmt2a C A 9: 44,847,979 D858Y probably damaging Het
Kmt2b C A 7: 30,577,370 R1674L probably damaging Het
Kmt2c G C 5: 25,354,413 A1076G probably damaging Het
Kmt5b G T 19: 3,793,118 G72* probably null Het
Kng1 G T 16: 23,079,616 V589L probably benign Het
Kpna6 T A 4: 129,648,078 S509C possibly damaging Het
Kpna6 C A 4: 129,655,548 W147L probably damaging Het
Krt12 C A 11: 99,420,761 E205* probably null Het
Krt17 T G 11: 100,260,923 K15Q probably benign Het
Krt222 A T 11: 99,238,552 L143Q probably damaging Het
Krt24 C G 11: 99,284,886 G108R unknown Het
Krt25 C G 11: 99,322,822 A24P probably benign Het
Krt27 C A 11: 99,348,978 E253D probably damaging Het
Krt33a C A 11: 100,011,914 E361D probably benign Het
Krt34 G T 11: 100,041,434 C21* probably null Het
Krt82 C T 15: 101,541,852 V470I probably benign Het
Krtap1-3 A G 11: 99,590,995 C109R possibly damaging Het
Krtap16-1 C T 11: 99,985,597 R327Q possibly damaging Het
Krtap21-1 C A 16: 89,403,581 G58C unknown Het
Krtap28-13 G T 1: 83,061,090 C32F unknown Het
Krtap3-1 G C 11: 99,566,567 A6G probably benign Het
Krtap4-2 C A 11: 99,634,976 G17C unknown Het
Krtap6-1 G C 16: 89,031,809 C31S unknown Het
Krtap7-1 C A 16: 89,508,260 M1I probably null Het
Ksr1 C A 11: 79,020,751 R735L possibly damaging Het
Ksr1 C A 11: 79,027,600 R576L probably benign Het
Kyat1 G T 2: 30,187,732 T175N probably damaging Het
L2hgdh C T 12: 69,707,132 S233N probably benign Het
L3mbtl4 G T 17: 68,425,687 W54L probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lamb1 A T 12: 31,327,702 S1697C possibly damaging Het
Lamb2 G T 9: 108,482,901 G419C probably damaging Het
Lamc2 C A 1: 153,133,621 V813L probably benign Het
Lamp2 T C X: 38,424,381 S332G probably damaging Het
Lao1 C A 4: 118,968,440 H486N probably damaging Het
Large2 G C 2: 92,370,198 T87R probably benign Het
Lats1 G T 10: 7,705,809 G786V probably damaging Het
Lbp T A 2: 158,325,762 L402Q probably damaging Het
Lcn11 G T 2: 25,777,724 K41N probably benign Het
Lct C A 1: 128,287,611 E1743* probably null Het
Ldb3 C G 14: 34,555,365 A351P probably benign Het
Ldhd G T 8: 111,627,520 T382N probably damaging Het
Lect2 A T 13: 56,548,361 M1K probably null Het
Lef1 C A 3: 131,200,323 A344D probably damaging Het
Lep G C 6: 29,070,970 A98P possibly damaging Het
Lepr C A 4: 101,745,614 P200T probably damaging Het
Lexm G T 4: 106,607,300 D387E probably benign Het
Lgr5 C A 10: 115,460,876 R382M probably damaging Het
Lhcgr T G 17: 88,742,270 K609N probably damaging Het
Lhx3 G T 2: 26,203,987 R77S probably damaging Het
Lhx4 C A 1: 155,705,255 A175S probably damaging Het
Lilra6 C T 7: 3,915,074 probably null Het
Lingo3 G C 10: 80,834,855 Q414E possibly damaging Het
Lins1 C G 7: 66,710,264 A263G possibly damaging Het
Lipf T A 19: 33,965,595 L101Q probably damaging Het
Lipo3 A C 19: 33,584,928 L14R probably null Het
Lipo4 C A 19: 33,503,184 M261I probably benign Het
Lipt1 G A 1: 37,875,903 V347I probably benign Het
Llgl2 G T 11: 115,849,554 E359* probably null Het
Lman2l C A 1: 36,428,376 G197V probably damaging Het
Lmnb2 C G 10: 80,903,238 G594R probably damaging Het
Lmo7 C A 14: 101,884,306 P269Q probably damaging Het
Lmo7 A T 14: 101,919,281 T1296S probably benign Het
Lmo7 G A 14: 101,919,443 E1350K unknown Het
Lmo7 T C 14: 101,929,228 S1548P unknown Het
Lmx1a A T 1: 167,691,999 K32M possibly damaging Het
Lnp1 C T 16: 56,927,903 D9N possibly damaging Het
Lox T G 18: 52,520,834 T397P probably damaging Het
Lpar5 C A 6: 125,081,379 T21K possibly damaging Het
Lpar5 T G 6: 125,082,072 L252R probably damaging Het
Lpgat1 T G 1: 191,778,475 F391V probably benign Het
Lpin2 C G 17: 71,225,211 S225* probably null Het
Lpin3 C G 2: 160,899,785 P492A probably damaging Het
Lpp G C 16: 24,761,603 S148T probably benign Het
Lpxn C A 19: 12,824,947 A212D probably damaging Het
Lrba G C 3: 86,715,538 C2409S probably benign Het
Lrba G T 3: 86,751,532 G2569C possibly damaging Het
Lrch3 A C 16: 32,914,316 T59P possibly damaging Het
Lrfn1 A G 7: 28,459,115 E153G possibly damaging Het
Lrig1 G T 6: 94,609,026 T727N possibly damaging Het
Lrp1 C G 10: 127,554,962 C3022S probably damaging Het
Lrp12 A T 15: 39,878,123 F418I probably damaging Het
Lrp1b A C 2: 40,677,506 L4070V Het
Lrp1b T A 2: 40,697,582 D3887V Het
Lrp1b C A 2: 40,922,383 E2517D Het
Lrp1b G T 2: 41,728,710 N231K Het
Lrp2 C G 2: 69,480,042 G2729A possibly damaging Het
Lrp2 A T 2: 69,507,881 V1185E possibly damaging Het
Lrp6 C T 6: 134,456,157 G1404R possibly damaging Het
Lrpprc C G 17: 84,770,431 A359P possibly damaging Het
Lrrc15 C G 16: 30,274,252 A90P probably benign Het
Lrrc18 C G 14: 33,009,200 P232R probably benign Het
Lrrc20 A G 10: 61,527,165 K63R probably damaging Het
Lrrc27 C A 7: 139,242,720 P509Q probably damaging Het
Lrrc30 C T 17: 67,632,436 V50I probably benign Het
Lrrc37a C A 11: 103,456,486 D3128Y probably damaging Het
Lrrc37a G T 11: 103,499,034 A1855D possibly damaging Het
Lrrc37a T G 11: 103,501,094 E1168D probably benign Het
Lrrc49 T A 9: 60,677,221 Q186L probably damaging Het
Lrrc4b G A 7: 44,445,123 V72M probably damaging Het
Lrrc4b GC G 7: 44,461,312 probably null Het
Lrrc59 A C 11: 94,643,321 K235T probably benign Het
Lrrc8e A T 8: 4,234,822 E349V probably damaging Het
Lrrc9 A G 12: 72,477,393 K791R probably damaging Het
Lrrd1 C T 5: 3,850,025 P110L probably benign Het
Lrrfip1 G T 1: 91,101,199 M68I possibly damaging Het
Lrrfip2 C A 9: 111,161,340 A43E probably damaging Het
Lrriq1 T A 10: 103,202,359 Q861L probably damaging Het
Lrriq1 G T 10: 103,202,360 Q861K probably damaging Het
Lrriq1 G T 10: 103,234,085 S23R probably damaging Het
Lrrtm2 T C 18: 35,214,659 probably benign Het
Lrrtm3 C A 10: 64,089,355 G11V probably damaging Het
Lrsam1 C G 2: 32,941,814 R383P probably damaging Het
Lrwd1 G A 5: 136,134,008 R120C probably damaging Het
Ltbp2 G C 12: 84,875,853 R147G probably benign Het
Luc7l2 G T 6: 38,551,908 G21* probably null Het
Ly9 G T 1: 171,594,060 T541K probably damaging Het
Lyg1 C A 1: 37,947,177 G159C probably null Het
Lyg2 C A 1: 37,911,127 C40F probably damaging Het
Lyst T C 13: 13,640,107 L1149S probably damaging Het
Lyst C G 13: 13,777,079 A3755G probably benign Het
M1ap A T 6: 82,968,042 R106* probably null Het
Macrod2 G T 2: 140,706,208 G93V probably damaging Het
Macrod2 T A 2: 141,024,090 C123S probably damaging Het
Madd C A 2: 91,159,272 G1129V probably damaging Het
Mafg T G 11: 120,629,528 Q82P probably damaging Het
Mageb18 G A X: 92,119,896 P247S probably damaging Het
Magi2 C A 5: 20,702,109 Q1094K probably benign Het
Magohb C A 6: 131,288,063 W79C probably damaging Het
Malrd1 C A 2: 16,217,845 Q2015K unknown Het
Mamdc2 A C 19: 23,334,057 F478V possibly damaging Het
Man1a G T 10: 53,919,315 P523Q probably damaging Het
Man1b1 G C 2: 25,344,983 R270T possibly damaging Het
Man2b1 A C 8: 85,093,938 D618A probably damaging Het
Manba G T 3: 135,563,274 G647* probably null Het
Map1a G T 2: 121,303,238 G1512C possibly damaging Het
Map2k5 C A 9: 63,358,038 R69S probably damaging Het
Map3k13 G T 16: 21,905,162 G298V probably damaging Het
Map3k14 G T 11: 103,225,496 T702K probably benign Het
Map3k14 T G 11: 103,231,073 E506A probably benign Het
Map3k7 T G 4: 32,015,963 I496S probably damaging Het
Map3k9 C A 12: 81,772,782 D233Y possibly damaging Het
Map4k3 C G 17: 80,618,337 A410P possibly damaging Het
Map6 G C 7: 99,317,660 E565D probably damaging Het
Mapk10 A T 5: 102,991,887 L166Q probably damaging Het
Mapk4 A G 18: 73,937,184 W213R probably damaging Het
Mapk8 G T 14: 33,410,886 P31H probably damaging Het
March4 C T 1: 72,452,500 C204Y probably damaging Het
Marf1 C A 16: 14,115,777 Q1582H probably benign Het
Mast1 T G 8: 84,912,459 S1414R probably damaging Het
Mast1 G C 8: 84,918,681 R712G probably damaging Het
Mast4 C G 13: 102,738,460 E1467Q probably damaging Het
Mat1a A T 14: 41,105,510 probably benign Het
Mat2b C G 11: 40,682,485 Q233H probably damaging Het
Mat2b T A 11: 40,687,777 S28C probably benign Het
Matn1 T A 4: 130,946,105 L128Q probably damaging Het
Mavs G T 2: 131,240,401 W68C probably damaging Het
Mbd5 A C 2: 49,279,308 N1497T probably benign Het
Mbip T G 12: 56,340,385 E156D probably damaging Het
Mbnl2 G C 14: 120,403,359 A346P probably benign Het
Mboat2 G T 12: 24,948,344 A282S possibly damaging Het
Mcm3 C A 1: 20,820,181 V10L probably benign Het
Mcm8 G T 2: 132,827,567 G319* probably null Het
Mcm9 C A 10: 53,537,507 R492S unknown Het
Mcoln3 C G 3: 146,140,466 H510Q probably benign Het
Mcts1 A C X: 38,601,941 K8N possibly damaging Het
Mdga2 C A 12: 66,689,443 G337V probably damaging Het
Mdh1b G T 1: 63,711,531 T426K probably benign Het
Mdh2 C A 5: 135,789,629 S246Y probably damaging Het
Mdn1 A G 4: 32,667,102 N189S probably benign Het
Mdn1 G T 4: 32,668,944 G334V probably damaging Het
Mdn1 A C 4: 32,696,244 N1209T probably damaging Het
Med1 C A 11: 98,161,183 V452L possibly damaging Het
Med12 G T X: 101,281,225 D679Y probably damaging Het
Med12 G T X: 101,293,573 Q1902H possibly damaging Het
Med12l C A 3: 59,091,417 N599K probably damaging Het
Med12l C A 3: 59,244,943 L1050I probably damaging Het
Med12l C A 3: 59,296,117 P2020Q probably benign Het
Med13 T A 11: 86,328,544 S359C possibly damaging Het
Med13 T A 11: 86,345,862 K156N probably benign Het
Med13 T G 11: 86,355,423 D51A probably damaging Het
Medag G T 5: 149,427,507 probably null Het
Mef2b G C 8: 70,166,375 R202S probably damaging Het
Mefv C A 16: 3,715,455 E317D possibly damaging Het
Megf10 C G 18: 57,277,694 P692A probably damaging Het
Meis1 C A 11: 19,014,317 G105V probably damaging Het
Mep1a C G 17: 43,477,320 R628T probably benign Het
Mepce C A 5: 137,785,842 G74V probably damaging Het
Mettl25 C A 10: 105,826,098 R337I possibly damaging Het
Mettl4 T G 17: 94,733,563 T388P probably benign Het
Mettl7b G T 10: 128,958,748 P236T probably damaging Het
Mex3d C G 10: 80,386,713 E236D Het
Mfsd11 G C 11: 116,863,940 A226P probably damaging Het
Mfsd13b G A 7: 120,991,677 V214I probably benign Het
Mfsd2a G C 4: 122,951,839 T173S probably benign Het
Mfsd2a G T 4: 122,959,311 L62M possibly damaging Het
Mfsd2b C A 12: 4,866,530 probably null Het
Mfsd4b2 C T 10: 39,921,600 S253N probably benign Het
Mfsd4b4 G T 10: 39,892,599 P212H possibly damaging Het
Mfsd4b5 G C 10: 39,986,390 L46V probably damaging Het
Mgam G T 6: 40,677,644 probably null Het
Mgam G T 6: 40,729,066 R23L probably damaging Het
Mgat4d G C 8: 83,348,521 V13L probably benign Het
Mgat4d A C 8: 83,368,112 K259N probably benign Het
Mia2 G T 12: 59,108,124 D208Y probably benign Het
Mia2 C G 12: 59,108,801 D433E probably damaging Het
Mib2 G C 4: 155,661,141 A71G probably benign Het
Midn G A 10: 80,153,628 G142E probably benign Het
Mier2 C A 10: 79,540,501 V197L unknown Het
Mill1 A T 7: 18,245,499 probably benign Het
Mkln1 A C 6: 31,398,921 K22T possibly damaging Het
Mkln1 G T 6: 31,451,554 G273C probably damaging Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mkrn3 C T 7: 62,419,810 G78R probably benign Het
Mmel1 C T 4: 154,895,208 R762* probably null Het
Mmp10 G T 9: 7,508,205 probably null Het
Mmp24 G A 2: 155,810,392 G340E probably damaging Het
Mmp25 C G 17: 23,630,659 C586S probably damaging Het
Mmp7 G C 9: 7,695,602 G160A probably damaging Het
Mmrn1 C G 6: 60,945,034 D158E probably benign Het
Mn1 C G 5: 111,420,379 S738R probably benign Het
Mn1 A C 5: 111,454,706 K1270T possibly damaging Het
Mnt C T 11: 74,836,675 P129L probably damaging Het
Mnx1 C A 5: 29,474,088 E332D unknown Het
Mnx1 C A 5: 29,474,174 E304* probably null Het
Moap1 C G 12: 102,743,075 E72Q probably damaging Het
Mocos A T 18: 24,670,633 H337L probably benign Het
Mogs G T 6: 83,116,213 G181W probably damaging Het
Mon1b G C 8: 113,637,809 E73Q probably benign Het
Morc1 G T 16: 48,587,058 V646L probably benign Het
Mpig6b C A 17: 35,065,340 G158V probably damaging Het
Mpp3 G T 11: 102,008,356 H419N probably damaging Het
Mprip G T 11: 59,737,404 G226W possibly damaging Het
Mprip A T 11: 59,759,484 Q1338L probably benign Het
Mpv17l G T 16: 13,940,829 R39L probably benign Het
Mrc2 G C 11: 105,341,376 W886S possibly damaging Het
Mrc2 G T 11: 105,347,360 E1153* probably null Het
Mrgprd T A 7: 145,321,953 L187H probably damaging Het
Mrgprx2 A C 7: 48,482,342 F243V probably damaging Het
Mrpl37 C A 4: 107,057,426 Q380H probably damaging Het
Mrpl39 C T 16: 84,723,972 V260I probably benign Het
Mrpl45 G T 11: 97,321,559 A121S probably benign Het
Mrps14 A C 1: 160,197,027 M43L probably benign Het
Mrps24 T A 11: 5,704,538 S139C possibly damaging Het
Mrvi1 C T 7: 110,923,999 R79H probably benign Het
Ms4a6b A T 19: 11,529,486 probably null Het
Ms4a8a G A 19: 11,070,760 S202L possibly damaging Het
Msc A T 1: 14,755,239 C39S unknown Het
Msi2 C A 11: 88,348,792 G331C probably damaging Het
Msln G T 17: 25,753,794 Q38K possibly damaging Het
Mss51 C T 14: 20,486,146 probably null Het
Mtcl1 T C 17: 66,379,460 E817G probably benign Het
Mtf2 G C 5: 108,087,944 G163R probably damaging Het
Mtfr1l C G 4: 134,530,679 probably null Het
Mthfd1 G A 12: 76,303,967 G708R possibly damaging Het
Mtmr2 A C 9: 13,799,281 E375D probably benign Het
Mtmr3 G C 11: 4,485,913 A1098G probably damaging Het
Mtor A T 4: 148,550,125 H2401L probably benign Het
Mtor G C 4: 148,550,130 V2403L possibly damaging Het
Mttp C A 3: 138,104,779 R625L probably benign Het
Mtus2 A G 5: 148,076,742 K115R probably benign Het
Mtus2 G T 5: 148,077,258 R287L probably benign Het
Muc13 A C 16: 33,799,087 Q68H unknown Het
Muc13 T C 16: 33,815,850 M568T possibly damaging Het
Muc2 T G 7: 141,746,714 I258S Het
Muc4 G A 16: 32,768,730 V754I possibly damaging Het
Muc5b C A 7: 141,842,705 L185I unknown Het
Mug1 G A 6: 121,841,294 M151I probably benign Het
Mug1 T G 6: 121,880,493 F1059V probably damaging Het
Mup11 C A 4: 60,660,215 M121I probably benign Het
Mup8 T C 4: 60,222,378 E31G probably benign Het
Mup8 C A 4: 60,222,542 probably benign Het
Mvb12b A T 2: 33,874,370 S56T probably damaging Het
Mybl1 C A 1: 9,685,769 R185L probably damaging Het
Mybpc1 G T 10: 88,560,327 N205K probably benign Het
Mybpc2 A C 7: 44,521,696 S144A probably benign Het
Mybpc3 C A 2: 91,120,403 P192Q possibly damaging Het
Mycbp2 C A 14: 103,156,637 K2829N probably benign Het
Mycbp2 T A 14: 103,346,249 Q90L probably benign Het
Myf6 G T 10: 107,494,260 H149N probably benign Het
Myh11 C A 16: 14,239,396 A345S probably null Het
Myh11 T A 16: 14,277,775 E41V Het
Myh13 T A 11: 67,329,295 S157T possibly damaging Het
Myh14 G T 7: 44,608,515 R1858S probably damaging Het
Myh14 A G 7: 44,638,309 V592A probably damaging Het
Myh15 A C 16: 49,096,531 S405R probably damaging Het
Myh3 G C 11: 67,082,415 W113S possibly damaging Het
Myh4 G T 11: 67,248,641 G595C probably damaging Het
Myh4 G T 11: 67,253,505 D1234Y probably damaging Het
Myh4 G A 11: 67,256,271 A1581T probably benign Het
Myh8 A C 11: 67,303,674 Q1570H probably damaging Het
Mylk3 A T 8: 85,365,179 Het
Myo15 G C 11: 60,488,258 A232P Het
Myo15 G C 11: 60,498,403 R873P Het
Myo15 G T 11: 60,524,441 V3410L probably damaging Het
Myo15b C T 11: 115,883,452 P339S possibly damaging Het
Myo15b A T 11: 115,887,925 T2582S unknown Het
Myo18b C T 5: 112,762,721 R1935H not run Het
Myo18b A T 5: 112,809,738 L1453Q possibly damaging Het
Myo18b C A 5: 112,831,190 G1186W probably damaging Het
Myo19 G A 11: 84,885,278 G30E probably benign Het
Myo19 GCACACAC GCACAC 11: 84,909,350 probably null Het
Myo1g C G 11: 6,519,045 A86P probably damaging Het
Myo7a C G 7: 98,095,727 R291P probably damaging Het
Myo7b C A 18: 31,980,998 R1100L possibly damaging Het
Myo9a A C 9: 59,895,259 T2010P probably damaging Het
Myoc G T 1: 162,639,636 E125* probably null Het
Myoc G C 1: 162,649,154 D476H probably damaging Het
Myom3 G T 4: 135,764,820 V92L probably benign Het
Myot G T 18: 44,346,085 M296I probably damaging Het
N4bp2l2 C A 5: 150,662,320 R65L probably benign Het
Nab2 C A 10: 127,663,132 E426* probably null Het
Nabp1 T A 1: 51,477,725 probably benign Het
Nacad G T 11: 6,602,297 S298Y probably damaging Het
Nagpa C G 16: 5,203,933 G17A probably damaging Het
Naip2 T G 13: 100,161,593 E645A probably benign Het
Naip2 A T 13: 100,161,909 Y540N probably benign Het
Nanog G A 6: 122,713,231 W198* probably null Het
Nars2 G T 7: 96,951,897 D32Y probably benign Het
Nat2 A G 8: 67,501,264 R9G probably damaging Het
Nat3 G T 8: 67,547,814 S115I possibly damaging Het
Nat8f2 T C 6: 85,868,044 E112G probably damaging Het
Nat8f5 T C 6: 85,817,685 T98A probably benign Het
Nat8l C T 5: 33,996,811 probably benign Het
Nav1 C A 1: 135,452,886 V1432L unknown Het
Nav1 T A 1: 135,472,420 S471C probably damaging Het
Nbas G T 12: 13,483,876 Q1837H probably benign Het
Nbeal2 G C 9: 110,625,816 Q2645E probably benign Het
Nbeal2 C A 9: 110,638,835 M455I probably benign Het
Nbr1 G C 11: 101,572,554 G616R probably benign Het
Ncdn C A 4: 126,750,151 G293C probably damaging Het
Ncdn C A 4: 126,750,153 C292F probably benign Het
Nckap1 A C 2: 80,540,508 probably null Het
Nckap5 C T 1: 126,528,681 probably null Het
Ncoa6 T A 2: 155,421,302 Q404L probably damaging Het
Ncor1 C A 11: 62,438,516 probably null Het
Ndc1 G C 4: 107,386,602 A332P probably damaging Het
Ndfip2 G T 14: 105,258,709 A13S probably benign Het
Ndn C A 7: 62,348,544 P46Q probably benign Het
Ndst3 A C 3: 123,552,630 F665C probably damaging Het
Ndst3 T G 3: 123,627,969 K405T possibly damaging Het
Ndst3 C A 3: 123,671,494 L276F probably damaging Het
Ndufa9 C A 6: 126,844,815 G66C probably damaging Het
Ndufs1 C A 1: 63,163,836 A190S probably damaging Het
Ndufs6 A G 13: 73,328,436 V4A probably benign Het
Neb C G 2: 52,267,782 W2271S probably benign Het
Neb C T 2: 52,279,631 probably null Het
Nectin2 C A 7: 19,738,363 V34L probably benign Het
Neil2 A C 14: 63,188,496 F142V probably damaging Het
Nek11 G C 9: 105,293,669 A389G probably benign Het
Nek2 G T 1: 191,827,239 R285S probably benign Het
Nell1 C G 7: 50,560,882 S377C unknown Het
Neu4 G T 1: 94,025,250 G447V probably benign Het
Neurl1a C A 19: 47,239,873 L53M probably damaging Het
Nfasc C A 1: 132,634,638 R133L probably benign Het
Nfatc2 G A 2: 168,571,349 Q139* probably null Het
Nfe2l2 T A 2: 75,679,164 Q104L probably null Het
Nfkbil1 C A 17: 35,234,961 G110C probably damaging Het
Nfkbil1 C A 17: 35,234,962 Q109H probably benign Het
Nfxl1 T G 5: 72,538,150 Q450H probably null Het
Nfyc C A 4: 120,790,487 probably benign Het
Ngb C A 12: 87,098,429 G151C probably damaging Het
Nhlrc4 C A 17: 25,943,744 A10S possibly damaging Het
Nin T A 12: 70,049,164 probably null Het
Nipbl G C 15: 8,338,699 P1180A possibly damaging Het
Nipsnap3a G T 4: 52,997,216 E161* probably null Het
Nkain2 C A 10: 32,402,271 G53* probably null Het
Nkapl C G 13: 21,468,303 G47R unknown Het
Nkx2-1 G T 12: 56,533,684 P157H probably benign Het
Nkx2-1 C A 12: 56,534,964 G33C probably damaging Het
Nle1 C A 11: 82,904,312 D298Y probably damaging Het
Nlgn1 G T 3: 25,436,604 L320I probably benign Het
Nlgn3 G T X: 101,317,982 V300L probably benign Het
Nlgn3 T C X: 101,319,877 L698P probably damaging Het
Nlk C G 11: 78,583,399 G358A probably damaging Het
Nlrp12 T C 7: 3,222,537 K1034R probably benign Het
Nlrp14 A G 7: 107,182,714 T373A probably benign Het
Nlrp1b T G 11: 71,182,270 K249T probably damaging Het
Nlrp6 T A 7: 140,922,721 W247R probably damaging Het
Nlrp9a G T 7: 26,558,229 W424L probably damaging Het
Nlrx1 A C 9: 44,256,923 V559G possibly damaging Het
Nme9 G A 9: 99,470,795 R266Q possibly damaging Het
Nmur2 T G 11: 56,027,101 K354T probably benign Het
Nos3 C A 5: 24,377,654 R627S probably benign Het
Notch3 A T 17: 32,141,516 F1480L probably benign Het
Notch3 A T 17: 32,151,370 C739S probably damaging Het
Nova2 G T 7: 18,958,449 G501V unknown Het
Noxa1 T A 2: 25,090,273 Q170L possibly damaging Het
Noxred1 A C 12: 87,223,057 L300W probably damaging Het
Npas2 T A 1: 39,336,010 S470T probably benign Het
Npas3 T C 12: 53,501,180 L103P probably damaging Het
Npm1 C A 11: 33,160,831 V117L probably benign Het
Npr2 A T 4: 43,650,720 H1000L probably damaging Het
Nr1h4 G C 10: 89,498,350 Y59* probably null Het
Nr2f2 C A 7: 70,357,778 V319F probably damaging Het
Nr3c2 G A 8: 76,909,700 V477M probably damaging Het
Nrap CTGTGTGT CTGTGT 19: 56,345,517 probably null Het
Nrcam G T 12: 44,571,570 R781L probably damaging Het
Nrg2 G T 18: 36,018,470 P673H probably damaging Het
Nrg3 C G 14: 39,472,533 V90L possibly damaging Het
Nrn1l G T 8: 105,894,416 A47S probably damaging Het
Nrxn3 C A 12: 89,187,055 S264* probably null Het
Nrxn3 C A 12: 89,517,909 A676E possibly damaging Het
Nsd1 A T 13: 55,245,525 Q416L probably damaging Het
Nsf C G 11: 103,910,554 D212H probably damaging Het
Nsrp1 C A 11: 77,050,695 Q62H probably damaging Het
Ntmt1 G C 2: 30,822,428 G161A probably damaging Het
Ntn4 G C 10: 93,741,153 R561P probably damaging Het
Ntrk2 A G 13: 58,874,333 T401A probably benign Het
Nudt8 G T 19: 4,001,690 R130S not run Het
Nufip2 G C 11: 77,741,791 *711S probably null Het
Nup214 G T 2: 32,010,258 R866S possibly damaging Het
Nup214 G T 2: 32,034,225 E1589* probably null Het
Nwd1 T G 8: 72,672,300 L696R not run Het
Nwd2 A G 5: 63,725,197 Y64C probably damaging Het
Nwd2 C A 5: 63,806,157 T1028K probably damaging Het
Oas1d T C 5: 120,914,914 W11R probably benign Het
Obox2 C T 7: 15,397,196 P76S possibly damaging Het
Obox3 C A 7: 15,626,224 E173D probably benign Het
Obscn G T 11: 58,994,372 A8020E unknown Het
Obscn A T 11: 58,995,530 Y7835N unknown Het
Obscn T G 11: 59,038,807 D5194A probably damaging Het
Obscn G T 11: 59,040,347 A5018E probably benign Het
Obscn G T 11: 59,049,725 N4614K probably benign Het
Obscn A G 11: 59,082,823 I1894T probably benign Het
Obscn G C 11: 59,136,286 C30W probably benign Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfm4 T G 14: 80,021,219 D302E probably benign Het
Olfr1015 T C 2: 85,786,120 V203A probably damaging Het
Olfr1018 G A 2: 85,823,021 G17R probably damaging Het
Olfr1025-ps1 C A 2: 85,918,501 T192N probably damaging Het
Olfr1048 C T 2: 86,236,458 A119T probably damaging Het
Olfr1052 T C 2: 86,298,226 S137P probably damaging Het
Olfr1054 A T 2: 86,332,706 Y217N probably damaging Het
Olfr1055 G T 2: 86,346,883 N294K possibly damaging Het
Olfr1057 G C 2: 86,375,115 T99R possibly damaging Het
Olfr1061 T A 2: 86,413,528 S175C probably damaging Het
Olfr1062 G C 2: 86,423,374 L101V probably benign Het
Olfr109 T A 17: 37,466,661 F152I possibly damaging Het
Olfr1095 T G 2: 86,850,940 S253R Het
Olfr1102 T A 2: 87,002,610 C214S probably benign Het
Olfr1102 G T 2: 87,002,611 C214F probably benign Het
Olfr1105 G T 2: 87,033,487 L245I probably damaging Het
Olfr1109 G T 2: 87,093,224 P58T possibly damaging Het
Olfr1128 A C 2: 87,544,621 L308V probably benign Het
Olfr1130 C T 2: 87,607,754 A122V probably benign Het
Olfr1131 T A 2: 87,629,315 L168Q probably damaging Het
Olfr1136 G T 2: 87,693,151 H244N probably damaging Het
Olfr1155 G T 2: 87,943,209 Q140K possibly damaging Het
Olfr1155 T G 2: 87,943,467 N54H probably damaging Het
Olfr1160 A C 2: 88,006,437 C105G probably damaging Het
Olfr1164 A T 2: 88,093,334 C201S probably damaging Het
Olfr1168 T C 2: 88,185,071 S65P probably damaging Het
Olfr1178 C A 2: 88,392,033 T262K probably damaging Het
Olfr1179 G C 2: 88,402,122 L271V probably damaging Het
Olfr1180 G T 2: 88,411,986 P224H probably damaging Het
Olfr1183 C A 2: 88,462,114 P277Q probably damaging Het
Olfr1199 T G 2: 88,755,797 K293Q probably damaging Het
Olfr1205 T A 2: 88,831,578 S154T probably damaging Het
Olfr1208 A T 2: 88,897,061 F179I probably damaging Het
Olfr121 G T 17: 37,752,767 K304N probably damaging Het
Olfr1217 A T 2: 89,023,795 D69E possibly damaging Het
Olfr1217 T G 2: 89,023,896 T36P probably damaging Het
Olfr1219 C A 2: 89,074,438 G218C probably benign Het
Olfr1224-ps1 A G 2: 89,156,467 L236P probably damaging Het
Olfr1229 C A 2: 89,282,537 V199F probably benign Het
Olfr1229 TGGG TGGGG 2: 89,282,897 probably null Het
Olfr1230 C T 2: 89,296,953 G106S probably damaging Het
Olfr1262 T A 2: 90,003,048 V214E probably damaging Het
Olfr1287 C A 2: 111,449,784 L215M probably damaging Het
Olfr1290 A G 2: 111,489,877 F94L probably damaging Het
Olfr1294 C A 2: 111,538,285 M1I probably null Het
Olfr1297 A G 2: 111,621,261 L271P probably damaging Het
Olfr1300-ps1 T A 2: 111,692,429 F304I unknown Het
Olfr1303 C A 2: 111,814,034 G231C probably benign Het
Olfr1309 A C 2: 111,983,753 V107G probably benign Het
Olfr1310 T A 2: 112,008,457 H243L probably damaging Het
Olfr1328 T G 4: 118,933,918 H310P probably benign Het
Olfr1329 C T 4: 118,917,027 G147R probably benign Het
Olfr1329 T G 4: 118,917,135 T111P probably damaging Het
Olfr1333 G T 4: 118,830,050 P129Q probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr1342 G T 4: 118,690,272 T60K probably benign Het
Olfr1347 A T 7: 6,488,692 C54S probably benign Het
Olfr1347 G T 7: 6,488,698 L52I probably damaging Het
Olfr1350 C A 7: 6,570,048 P19H probably damaging Het
Olfr1351 G C 10: 79,018,205 R294S probably damaging Het
Olfr1356 T A 10: 78,847,021 Q298L possibly damaging Het
Olfr1357 T G 10: 78,612,056 N195T probably damaging Het
Olfr136 A C 17: 38,335,352 N65T probably damaging Het
Olfr1369-ps1 A T 13: 21,116,601 K303I probably damaging Het
Olfr1375 T G 11: 51,048,835 C243G probably damaging Het
Olfr1382 C G 11: 49,535,253 L23V probably damaging Het
Olfr1385 G C 11: 49,495,067 C178S probably damaging Het
Olfr140 G T 2: 90,052,265 Q20K probably benign Het
Olfr1410 G T 1: 92,607,751 probably benign Het
Olfr1425 G T 19: 12,073,840 P264H probably damaging Het
Olfr1425 G T 19: 12,073,910 H241N probably damaging Het
Olfr143 G T 9: 38,253,852 C142F probably benign Het
Olfr1437 T G 19: 12,322,267 N187H possibly damaging Het
Olfr1442 C A 19: 12,674,310 T35N probably benign Het
Olfr1454 A T 19: 13,063,646 K78N probably benign Het
Olfr1467 T G 19: 13,364,915 C96G probably damaging Het
Olfr1467 G C 19: 13,364,916 C96S probably damaging Het
Olfr1487 T G 19: 13,619,662 F124V probably damaging Het
Olfr1490 C A 19: 13,654,463 H11Q probably benign Het
Olfr1491 C G 19: 13,705,203 D125E probably damaging Het
Olfr1500 G T 19: 13,827,899 L166I probably damaging Het
Olfr152 C A 2: 87,783,024 H161Q probably damaging Het
Olfr159 A C 4: 43,770,267 V248G probably damaging Het
Olfr161 T A 16: 3,592,540 L48Q probably damaging Het
Olfr161 G A 16: 3,593,133 A246T probably benign Het
Olfr165 T A 16: 19,407,735 M94L probably benign Het
Olfr173 C A 16: 58,797,423 C141F probably damaging Het
Olfr173 G C 16: 58,797,673 P58A probably damaging Het
Olfr175-ps1 GT GTT 16: 58,824,307 probably null Het
Olfr197 C A 16: 59,186,485 probably benign Het
Olfr203 G T 16: 59,303,169 R5S probably benign Het
Olfr211 T C 6: 116,494,376 Y256H probably damaging Het
Olfr218 C A 1: 173,203,797 S147Y probably benign Het
Olfr266 C G 3: 106,822,043 C172S probably damaging Het
Olfr301 T G 7: 86,412,698 F112C probably benign Het
Olfr310 G A 7: 86,268,947 P281S probably damaging Het
Olfr354 C A 2: 36,907,701 L252I possibly damaging Het
Olfr361 C G 2: 37,085,636 M37I probably benign Het
Olfr362 G A 2: 37,105,636 P5S probably benign Het
Olfr387-ps1 C A 11: 73,664,774 T55K not run Het
Olfr397 TC T 11: 73,965,297 probably null Het
Olfr404-ps1 T A 11: 74,239,747 F61Y probably damaging Het
Olfr404-ps1 G A 11: 74,240,120 M185I possibly damaging Het
Olfr404-ps1 T G 11: 74,240,203 L213R probably damaging Het
Olfr414 C G 1: 174,430,591 S54R probably benign Het
Olfr430 A T 1: 174,069,331 E11V probably damaging Het
Olfr430 G T 1: 174,069,514 W72L probably damaging Het
Olfr444 A C 6: 42,955,690 H64P probably damaging Het
Olfr444 G C 6: 42,956,298 E267Q probably benign Het
Olfr449 T C 6: 42,837,977 L32P probably damaging Het
Olfr469 C T 7: 107,822,993 A159T probably benign Het
Olfr472 T G 7: 107,903,058 L114V probably damaging Het
Olfr478 T C 7: 108,031,446 E299G probably damaging Het
Olfr482 C A 7: 108,094,994 C192F probably damaging Het
Olfr484 G T 7: 108,124,879 A128E probably damaging Het
Olfr498 T A 7: 108,465,371 F16I probably benign Het
Olfr509 T A 7: 108,645,767 T270S possibly damaging Het
Olfr560 T A 7: 102,753,414 S172C probably benign Het
Olfr560 C G 7: 102,753,416 C171S possibly damaging Het
Olfr577 C T 7: 102,973,309 V228I not run Het
Olfr62 A C 4: 118,665,826 Q103P probably damaging Het
Olfr625-ps1 A T 7: 103,683,105 Y129F probably benign Het
Olfr628 T C 7: 103,732,781 L285P probably damaging Het
Olfr631 G A 7: 103,929,777 W318* probably null Het
Olfr642 T A 7: 104,050,273 H27L probably benign Het
Olfr67 C A 7: 103,787,453 V275F probably benign Het
Olfr675 G T 7: 105,024,099 P294T probably damaging Het
Olfr681 C A 7: 105,122,120 S221Y probably damaging Het
Olfr681 T A 7: 105,122,122 Y222N probably damaging Het
Olfr688 T A 7: 105,288,722 W210R probably damaging Het
Olfr716 G T 7: 107,148,155 V280L probably benign Het
Olfr721-ps1 G T 14: 14,407,732 C168F probably damaging Het
Olfr742 C G 14: 50,516,065 P287R probably damaging Het
Olfr780 G A 10: 129,322,219 G199S probably benign Het
Olfr788 T A 10: 129,473,615 S308T probably benign Het
Olfr794 G T 10: 129,571,236 E194* probably null Het
Olfr796 G T 10: 129,608,103 A126D probably damaging Het
Olfr8 A T 10: 78,955,219 N5Y probably damaging Het
Olfr807 A G 10: 129,754,688 F254S probably damaging Het
Olfr807 C A 10: 129,754,824 A209S possibly damaging Het
Olfr809 A T 10: 129,776,042 I43F probably damaging Het
Olfr822 G T 10: 130,075,104 Q231H probably benign Het
Olfr826 A C 10: 130,179,965 L305R possibly damaging Het
Olfr828 AGG AG 9: 18,815,980 probably null Het
Olfr854 T A 9: 19,566,526 Q286L probably damaging Het
Olfr871 G T 9: 20,212,844 R165L possibly damaging Het
Olfr890 G A 9: 38,143,431 A94T probably benign Het
Olfr912 G T 9: 38,581,885 G203W probably damaging Het
Olfr919 C T 9: 38,697,928 G146D possibly damaging Het
Olfr936 T G 9: 39,046,919 T167P probably damaging Het
Olfr969 C A 9: 39,795,929 L185M possibly damaging Het
Olfr970 A T 9: 39,820,355 S239C probably damaging Het
Olfr987 C T 2: 85,331,893 E2K probably benign Het
Olfr99 A T 17: 37,279,674 Y249N probably damaging Het
Olfr993 C G 2: 85,414,663 C72S probably damaging Het
Olfr993 G C 2: 85,414,685 H65D possibly damaging Het
Omt2b T A 9: 78,329,330 W113R probably damaging Het
Oog1 G C 12: 87,608,364 E427D probably damaging Het
Opn1sw C G 6: 29,379,456 G183A probably damaging Het
Oprk1 G A 1: 5,602,702 R354H probably benign Het
Osbpl7 G A 11: 97,060,153 G609S probably damaging Het
Otof G T 5: 30,371,586 A1826E probably damaging Het
Otogl C T 10: 107,777,213 R2046H probably benign Het
Otogl A T 10: 107,778,873 C1973S probably damaging Het
Otogl G T 10: 107,789,032 H1582N probably benign Het
Otop3 T A 11: 115,339,844 L147Q probably damaging Het
Otop3 C G 11: 115,341,012 H234Q probably damaging Het
Otud4 C T 8: 79,658,929 T217I probably benign Het
Otud6a C A X: 100,429,391 R127S possibly damaging Het
Otud7a G T 7: 63,758,700 R917L unknown Het
Oxct2a G T 4: 123,322,538 P350Q probably damaging Het
Oxtr T A 6: 112,489,695 N35Y probably damaging Het
P2rx6 G C 16: 17,568,055 D223H probably damaging Het
P2ry14 A C 3: 59,115,737 F101V probably damaging Het
P2ry4 G A X: 100,593,321 R324C probably benign Het
Pabpc4 G A 4: 123,295,274 G469D probably benign Het
Padi3 G T 4: 140,795,671 A330E possibly damaging Het
Padi3 A G 4: 140,798,123 L193P not run Het
Pafah1b1 C A 11: 74,689,119 G86V probably benign Het
Pafah1b1 T G 11: 74,690,241 K54T probably damaging Het
Pak7 A C 2: 136,083,246 L712R probably damaging Het
Pam C A 1: 97,934,723 R99L probably benign Het
Pam16 C A 16: 4,624,906 probably benign Het
Pappa2 C G 1: 158,814,814 G1287A probably damaging Het
Pappa2 A T 1: 158,814,816 D1286E probably damaging Het
Pappa2 A C 1: 158,956,933 I169S probably benign Het
Paqr8 G T 1: 20,934,798 G59W probably damaging Het
Paqr9 G C 9: 95,560,306 W116C possibly damaging Het
Pard3b G T 1: 62,238,892 V694L probably benign Het
Patj C T 4: 98,611,130 S1347L probably benign Het
Patj A T 4: 98,676,318 K1636* probably null Het
Pax3 C A 1: 78,122,590 probably null Het
Pax5 C A 4: 44,697,678 G19V probably damaging Het
Paxip1 C T 5: 27,783,729 probably null Het
Pcdh1 C A 18: 38,198,688 V560L possibly damaging Het
Pcdh15 G A 10: 74,630,701 D1517N probably benign Het
Pcdh19 C T X: 133,682,092 R763K probably null Het
Pcdh8 G A 14: 79,769,077 P682L probably benign Het
Pcdha7 G C 18: 36,975,840 E639D probably benign Het
Pcdhb10 AC A 18: 37,413,395 probably null Het
Pcdhb13 C A 18: 37,443,235 S222* probably null Het
Pcdhb16 C A 18: 37,479,160 P391H probably damaging Het
Pcdhgb1 A T 18: 37,681,840 Q461H probably benign Het
Pcgf2 T G 11: 97,690,021 K332T probably damaging Het
Pck2 G T 14: 55,545,269 A387S probably benign Het
Pclo C A 5: 14,681,516 S218Y possibly damaging Het
Pclo G C 5: 14,681,779 E306Q Het
Pclo C A 5: 14,712,648 Q427K probably damaging Het
Pcna-ps2 G T 19: 9,284,112 G245V probably damaging Het
Pcnt C A 10: 76,382,157 E2095* probably null Het
Pcnx2 G A 8: 125,761,654 P1717L probably damaging Het
Pcnx2 A C 8: 125,838,014 L1047V probably benign Het
Pcnx3 T A 19: 5,687,220 probably null Het
Pcolce2 G C 9: 95,637,836 A15P possibly damaging Het
Pcsk1 A T 13: 75,098,042 N180Y probably damaging Het
Pcsk4 G T 10: 80,322,726 T564K possibly damaging Het
Pcsk9 G T 4: 106,458,941 Q102K probably damaging Het
Pcx G T 19: 4,619,073 V701L possibly damaging Het
Pcyt2 C G 11: 120,614,373 G122A probably damaging Het
Pde11a C T 2: 76,194,905 A451T probably benign Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Pde6c G T 19: 38,132,881 probably benign Het
Pdk2 A C 11: 95,027,918 L344V probably damaging Het
Pdk4 G T 6: 5,487,170 S292Y probably damaging Het
Pds5a G C 5: 65,659,727 S177R possibly damaging Het
Pdxdc1 C A 16: 13,903,043 probably benign Het
Pdxk T G 10: 78,441,188 T259P probably damaging Het
Pdzk1 A G 3: 96,854,557 N162D probably benign Het
Pdzrn3 T A 6: 101,151,999 S569C probably damaging Het
Pdzrn4 G A 15: 92,396,957 A15T probably benign Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Peli3 C A 19: 4,934,967 R172L probably benign Het
Penk G T 4: 4,138,106 A13E probably damaging Het
Per2 T A 1: 91,421,493 N1052I possibly damaging Het
Pfas T C 11: 68,990,070 M198V Het
Pfas C T 11: 69,002,487 G91R probably damaging Het
Pfkl C A 10: 78,000,136 G213W probably damaging Het
Pfpl G T 19: 12,429,941 E519* probably null Het
Pga5 T C 19: 10,669,159 T372A probably damaging Het
Pgc C G 17: 47,728,868 Y62* probably null Het
Pgd C A 4: 149,166,679 probably benign Het
Pglyrp3 A T 3: 92,028,085 H214L probably damaging Het
Pglyrp4 A G 3: 90,739,005 Q282R probably damaging Het
Pgm2 C T 4: 99,978,997 T444I probably damaging Het
Pgm2l1 G T 7: 100,270,455 G586V possibly damaging Het
Phactr3 C A 2: 178,269,374 P139Q probably damaging Het
Phax G T 18: 56,586,952 G322W probably damaging Het
Phc3 C G 3: 30,936,597 M478I probably benign Het
Phf2 T A 13: 48,807,707 T836S unknown Het
Phldb2 C A 16: 45,825,826 A86S probably benign Het
Phldb2 C A 16: 45,825,827 L85F probably benign Het
Phldb2 T A 16: 45,953,508 probably benign Het
Phrf1 G C 7: 141,243,883 G46R unknown Het
Phrf1 G T 7: 141,258,818 R642L unknown Het
Picalm A T 7: 90,196,967 S639C probably damaging Het
Pidd1 T A 7: 141,440,361 S551C probably benign Het
Pigb C G 9: 73,034,572 G135A probably benign Het
Pigr A C 1: 130,850,815 E745D possibly damaging Het
Pigx T G 16: 32,087,425 Q130P probably benign Het
Pik3c2b C A 1: 133,066,553 S85Y probably damaging Het
Pik3c2b G T 1: 133,099,686 E1308* probably null Het
Pik3cd TG T 4: 149,654,847 probably null Het
Pik3cg T C 12: 32,204,795 R398G probably damaging Het
Pik3r6 G A 11: 68,520,200 probably benign Het
Pik3r6 G T 11: 68,544,765 A614S probably benign Het
Pja2 C A 17: 64,292,869 S540I probably damaging Het
Pkd1l1 C A 11: 8,826,801 G2513C Het
Pkd1l2 G C 8: 117,054,914 C797W probably damaging Het
Pkd1l3 C A 8: 109,623,242 P240T unknown Het
Pkd2 G A 5: 104,460,049 G138E probably benign Het
Pkd2l1 G T 19: 44,149,271 T708K probably benign Het
Pkhd1 A C 1: 20,523,747 F1381V possibly damaging Het
Pklr C G 3: 89,144,855 P489R probably damaging Het
Pkn1 C T 8: 83,673,497 R632Q probably damaging Het
Pkp2 T C 16: 16,230,700 V323A probably benign Het
Pkp4 G C 2: 59,342,244 probably null Het
Pla2g7 C G 17: 43,602,919 A251G probably benign Het
Plagl1 A G 10: 13,128,716 Q576R unknown Het
Plau A C 14: 20,839,481 S205R probably damaging Het
Plcb2 T A 2: 118,723,128 K171N probably damaging Het
Plcd4 T A 1: 74,548,126 L15Q probably benign Het
Plcd4 C A 1: 74,557,792 H398N probably damaging Het
Plce1 C T 19: 38,701,894 A674V probably damaging Het
Plce1 G T 19: 38,724,980 E1231* probably null Het
Plce1 A G 19: 38,769,460 H1959R probably damaging Het
Plcg1 A T 2: 160,758,127 R936W probably damaging Het
Plcl1 G A 1: 55,696,040 G180D probably benign Het
Plcl1 C T 1: 55,751,284 Q1038* probably null Het
Plcl2 T G 17: 50,608,456 V831G probably damaging Het
Plcz1 C G 6: 140,013,676 V252L possibly damaging Het
Pld1 T C 3: 28,076,533 L494P probably damaging Het
Pld1 A T 3: 28,131,577 K984* probably null Het
Pld6 G C 11: 59,787,438 C66W probably damaging Het
Plekha6 G T 1: 133,263,813 R40L probably benign Het
Plekha6 G T 1: 133,272,471 G263W probably damaging Het
Plekhg3 G T 12: 76,575,856 probably null Het
Plekhn1 C G 4: 156,223,431 G346A possibly damaging Het
Plekho1 C G 3: 95,995,715 G3A unknown Het
Plg A C 17: 12,414,185 T678P probably benign Het
Plk1 C T 7: 122,167,650 R364W not run Het
Plod1 C A 4: 147,923,200 G342C probably damaging Het
Plppr4 T C 3: 117,322,849 K453R probably damaging Het
Plxdc2 G A 2: 16,565,403 G180E possibly damaging Het
Plxna1 C A 6: 89,321,052 W1748L probably damaging Het
Plxna3 G T X: 74,336,020 W788C probably damaging Het
Plxnb3 T A X: 73,759,165 V213E probably damaging Het
Plxnc1 G T 10: 94,865,029 P598T probably benign Het
Pm20d1 G T 1: 131,797,558 E47D possibly damaging Het
Pmch T C 10: 88,091,833 I132T not run Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Pnisr C G 4: 21,873,684 R476G probably benign Het
Pnmal2 C A 7: 16,946,810 A573D possibly damaging Het
Pnpla8 CAGA CA 12: 44,295,990 probably null Het
Pnpt1 C T 11: 29,145,475 S408L probably benign Het
Pnpt1 G A 11: 29,145,477 D409N possibly damaging Het
Poc5 G T 13: 96,401,722 Q298H probably benign Het
Podxl T A 6: 31,528,634 K158M probably damaging Het
Pola1 T G X: 93,480,604 T1144P probably damaging Het
Pold1 C A 7: 44,541,780 R209L probably benign Het
Pold1 G A 7: 44,542,232 P110L probably benign Het
Pold4 G T 19: 4,232,172 E27D probably benign Het
Polg G T 7: 79,453,741 A960D probably damaging Het
Polg2 C A 11: 106,773,429 V357F probably damaging Het
Polq G T 16: 37,042,257 probably null Het
Polr2b A C 5: 77,331,971 K524Q probably damaging Het
Pom121l12 C A 11: 14,599,639 A115E probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Pop7 C A 5: 137,502,187 probably benign Het
Poteg G T 8: 27,447,954 R46I possibly damaging Het
Pou5f2 G C 13: 78,025,097 V53L probably benign Het
Pou6f2 T C 13: 18,378,635 Q38R unknown Het
Ppfia2 A T 10: 106,474,645 E4D probably damaging Het
Ppfia4 C A 1: 134,327,379 R246L probably benign Het
Ppia G T 11: 6,419,600 G162V possibly damaging Het
Ppip5k1 A C 2: 121,337,866 L685R probably damaging Het
Ppl A T 16: 5,106,778 L141Q probably damaging Het
Ppm1b G T 17: 84,994,265 R191L probably damaging Het
Ppm1d G C 11: 85,339,573 C339S probably benign Het
Ppm1g T A 5: 31,220,436 probably benign Het
Ppm1n C A 7: 19,279,245 E260D probably damaging Het
Ppp1r26 G T 2: 28,452,847 G830W probably damaging Het
Ppp1r7 C A 1: 93,354,354 T209N possibly damaging Het
Ppp2r1b AGGG AGG 9: 50,873,645 probably null Het
Ppp2r2c C G 5: 36,931,277 S163R probably benign Het
Ppp2r3a C G 9: 101,126,389 A427P possibly damaging Het
Ppp4r1 G A 17: 65,838,926 A887T probably damaging Het
Pramef25 C A 4: 143,950,123 G137V probably benign Het
Pramef6 T A 4: 143,895,684 Q367L probably damaging Het
Pramel4 G T 4: 144,068,521 G496W unknown Het
Pramel5 G T 4: 144,273,860 R49S probably benign Het
Pramel6 G T 2: 87,508,722 V89L probably benign Het
Prc1 C G 7: 80,306,485 S311R probably damaging Het
Prcd C A 11: 116,659,368 A74D probably damaging Het
Prdm1 A C 10: 44,446,833 L207R probably damaging Het
Prdm10 A T 9: 31,316,168 Q19L possibly damaging Het
Prdm10 G T 9: 31,316,293 E65* probably null Het
Prdm13 A T 4: 21,679,518 L324Q unknown Het
Prdm16 C A 4: 154,341,786 G514V probably damaging Het
Prdx1 C G 4: 116,687,481 P22A probably benign Het
Prelp G C 1: 133,914,881 S175R probably damaging Het
Prep G T 10: 45,150,468 G496V probably damaging Het
Prex1 C A 2: 166,572,970 E1490* probably null Het
Prkar1a G C 11: 109,660,013 Q64H probably benign Het
Prkcd T G 14: 30,610,249 Q18H possibly damaging Het
Prkcsh A C 9: 22,013,055 T494P probably damaging Het
Prkcz G C 4: 155,354,680 P103R probably damaging Het
Prkcz C T 4: 155,356,468 R81H probably damaging Het
Prkdc G T 16: 15,687,422 G863* probably null Het
Prlr A G 15: 10,314,255 S13G probably benign Het
Prmt6 C A 3: 110,250,130 S281I probably benign Het
Proc C A 18: 32,134,979 Q35H probably benign Het
Prom2 C A 2: 127,532,775 G614W probably damaging Het
Prp2 A T 6: 132,600,237 Q162H unknown Het
Prpf40a C G 2: 53,144,875 R767P probably damaging Het
Prpsap1 C A 11: 116,478,618 M162I possibly damaging Het
Prpsap1 G T 11: 116,479,768 A116D possibly damaging Het
Prr11 C G 11: 87,097,142 V312L possibly damaging Het
Prr12 C G 7: 45,052,856 G9A unknown Het
Prr15l G A 11: 96,934,763 G73D probably damaging Het
Prr16 C A 18: 51,303,150 H234N probably damaging Het
Prr29 C T 11: 106,376,941 L171F possibly damaging Het
Prrt1 G T 17: 34,630,833 G74C probably damaging Het
Prss16 G T 13: 22,006,054 C311* probably null Het
Prss16 C A 13: 22,006,400 probably benign Het
Prss30 G T 17: 23,974,584 Q19K unknown Het
Prss30 A T 17: 23,974,586 L18Q unknown Het
Prss38 G T 11: 59,374,334 P135T probably damaging Het
Prss40 T G 1: 34,559,779 K101T possibly damaging Het
Prss44 G T 9: 110,814,067 G10V probably benign Het
Prtg G A 9: 72,893,968 G860E probably damaging Het
Prune1 T G 3: 95,255,000 K454T probably damaging Het
Psapl1 A G 5: 36,205,164 I367V probably damaging Het
Psg18 C A 7: 18,354,787 G11W probably benign Het
Psip1 G A 4: 83,459,874 P462S possibly damaging Het
Psmb8 G C 17: 34,200,856 G228A probably benign Het
Psmc2 A C 5: 21,801,317 D276A probably damaging Het
Psmd11 G T 11: 80,428,648 probably benign Het
Psmd13 G T 7: 140,882,426 probably benign Het
Psmd2 G A 16: 20,662,660 V822I probably benign Het
Psme4 G A 11: 30,843,522 V1208I possibly damaging Het
Ptafr A G 4: 132,579,962 Q221R probably benign Het
Ptchd3 T G 11: 121,836,476 L392R possibly damaging Het
Pten G A 19: 32,798,115 probably null Het
Ptges3 G T 10: 128,074,270 D142Y probably damaging Het
Ptgfr C A 3: 151,835,641 D77Y probably damaging Het
Ptgs1 G T 2: 36,240,776 G229V probably damaging Het
Ptgs2 A T 1: 150,105,721 H585L probably benign Het
Pth2r C G 1: 65,363,308 A322G probably benign Het
Ptp4a1 C T 1: 30,944,569 C99Y probably benign Het
Ptpn11 C A 5: 121,143,094 G507V probably damaging Het
Ptpn5 T A 7: 47,086,122 I283F probably damaging Het
Ptpn6 G T 6: 124,725,076 Y416* probably null Het
Ptpn7 A C 1: 135,134,511 N65T probably benign Het
Ptprb AGGG AGGGGG 10: 116,302,156 probably null Het
Ptprd C A 4: 76,133,214 M23I probably benign Het
Ptprn A C 1: 75,251,818 F872V probably damaging Het
Ptprq C A 10: 107,526,070 M2090I probably damaging Het
Ptprs T A 17: 56,417,050 S1648C possibly damaging Het
Ptprs C A 17: 56,422,211 E1256* probably null Het
Ptprs G T 17: 56,434,468 R599S possibly damaging Het
Ptprz1 A C 6: 23,051,995 K2274N probably damaging Het
Ptx3 G T 3: 66,220,835 G106C possibly damaging Het
Pxk C G 14: 8,146,271 P394A probably damaging Het
Pxylp1 A T 9: 96,824,956 L391H probably damaging Het
Pygl G T 12: 70,222,874 T99N probably benign Het
Qrfpr T C 3: 36,182,610 Y214C probably damaging Het
Qrich2 A C 11: 116,456,378 L1207V probably benign Het
Qrsl1 A T 10: 43,884,948 V240E probably damaging Het
Qsox2 C A 2: 26,217,666 A272S probably damaging Het
Rab14 C A 2: 35,186,707 L106F Het
Rabgap1 G A 2: 37,560,544 D895N probably benign Het
Rabif G T 1: 134,494,757 R25L probably benign Het
Rabif G T 1: 134,506,232 A95S possibly damaging Het
Rad17 G C 13: 100,627,632 P444A probably benign Het
Rad21l G T 2: 151,655,232 L321I probably damaging Het
Rag1 C A 2: 101,643,259 G513C probably damaging Het
Ralgapa1 G A 12: 55,709,080 L1104F probably damaging Het
Ralgps2 C A 1: 156,829,075 A320S probably benign Het
Ran C T 5: 129,022,102 P116L probably damaging Het
Ranbp17 T C 11: 33,481,108 R290G probably damaging Het
Ranbp2 G T 10: 58,461,886 V372F probably damaging Het
Rap1gap2 TCCCC TCCCCC 11: 74,610,877 probably null Het
Rapgef5 T C 12: 117,595,288 L173P probably damaging Het
Rapgefl1 G A 11: 98,845,981 D314N probably damaging Het
Rapsn C G 2: 91,036,598 L82V probably benign Het
Rasal1 C T 5: 120,652,816 S23F probably damaging Het
Rasal1 A G 5: 120,664,849 N390S probably benign Het
Rasgrp1 A T 2: 117,301,974 C126S probably damaging Het
Rassf5 G T 1: 131,182,217 P201H probably damaging Het
Rassf8 G T 6: 145,816,642 E380* probably null Het
Rbak C A 5: 143,176,547 E20D probably damaging Het
Rbbp8 G A 18: 11,732,262 C736Y probably benign Het
Rbm17 C A 2: 11,596,768 G90W probably damaging Het
Rbm25 G T 12: 83,672,884 R559S possibly damaging Het
Rbm27 TGGGG TGGG 18: 42,333,234 probably null Het
Rbm28 C A 6: 29,128,547 G633C probably damaging Het
Rbm44 G A 1: 91,153,400 A437T probably benign Het
Rbm47 C T 5: 66,022,672 A500T probably benign Het
Rbm47 C A 5: 66,026,979 V94L probably benign Het
Rbms2 G C 10: 128,137,988 P224A probably benign Het
Rcl1 G C 19: 29,101,617 R38T probably benign Het
Reg3b G T 6: 78,372,828 G117V probably benign Het
Rel T G 11: 23,745,472 E270D probably damaging Het
Rela A T 19: 5,641,649 M284L probably benign Het
Reln A C 5: 21,979,024 V1659G probably damaging Het
Reps1 A C 10: 18,123,125 K722T probably damaging Het
Reps2 A C X: 162,522,968 F296V probably damaging Het
Rere A G 4: 150,468,783 D144G probably damaging Het
Ret T G 6: 118,163,207 K1008T probably damaging Het
Retreg2 G C 1: 75,145,743 A310P probably damaging Het
Rftn1 C G 17: 50,169,003 A49P probably damaging Het
Rfwd3 G C 8: 111,273,095 C750W probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rfx6 G T 10: 51,718,093 V370L probably benign Het
Rfx6 G T 10: 51,725,831 G749* probably null Het
Rgl3 C A 9: 21,981,403 V296L possibly damaging Het
Rgs12 G C 5: 34,965,769 A299P probably damaging Het
Rgs20 G T 1: 5,070,114 Q22K probably benign Het
Rhbdf1 T A 11: 32,215,125 probably null Het
Rhd G T 4: 134,879,975 V140L probably benign Het
Rhd C A 4: 134,884,524 L218I probably damaging Het
Rhob C T 12: 8,499,326 V103I probably benign Het
Rhobtb1 G T 10: 69,289,551 W650C probably damaging Het
Rhot1 A T 11: 80,242,621 K243* probably null Het
Rhox2a G T X: 37,249,484 E183D probably benign Het
Rhox3h C A X: 37,661,078 R112L possibly damaging Het
Rhox4g C T X: 37,650,763 A50T probably benign Het
Ric8b A C 10: 84,947,544 M89L probably benign Het
Rimbp3 G A 16: 17,209,474 S254N possibly damaging Het
Rims1 T A 1: 22,484,671 K445* probably null Het
Rims3 G C 4: 120,889,072 G185A probably damaging Het
Riok1 T A 13: 38,058,723 D474E possibly damaging Het
Ripk2 C A 4: 16,151,943 R205S probably damaging Het
Ripk4 G C 16: 97,750,102 P222A probably damaging Het
Rlf C T 4: 121,150,428 E562K probably damaging Het
Rnase11 T A 14: 51,049,888 T70S possibly damaging Het
Rnase2a C G 14: 51,255,829 Q26H probably damaging Het
Rnaset2b C G 17: 6,991,786 D150E possibly damaging Het
Rnf123 C G 9: 108,058,395 A962P probably damaging Het
Rnf123 C A 9: 108,062,981 G738W probably damaging Het
Rnf138rt1 G C X: 163,760,710 Q92E probably benign Het
Rnf19b A T 4: 129,078,905 probably null Het
Rnf213 G C 11: 119,441,410 A2483P Het
Rnf213 A C 11: 119,482,998 E4970A Het
Rnf216 C A 5: 143,098,443 M1I probably null Het
Rnf32 C A 5: 29,225,250 L356I probably damaging Het
Rnpep C A 1: 135,271,755 L288F probably benign Het
Rnpep C A 1: 135,283,836 G58V probably benign Het
Robo1 A T 16: 72,977,800 H655L probably benign Het
Robo2 G T 16: 73,933,591 N1044K probably benign Het
Rora G T 9: 69,364,372 G211C probably damaging Het
Ros1 T G 10: 52,091,109 K1688N possibly damaging Het
Rp1l1 A C 14: 64,029,144 Q726H probably damaging Het
Rpf2 C A 10: 40,243,872 G60* probably null Het
Rpl18 G T 7: 45,718,096 probably benign Het
Rpl37 C G 15: 5,118,592 P84A probably benign Het
Rpp38 T G 2: 3,329,522 E114D probably damaging Het
Rps6kl1 C A 12: 85,139,355 R326S probably benign Het
Rpsa A T 9: 120,130,346 I161F probably damaging Het