Incidental Mutation 'R0652:Osgin1'
ID62304
Institutional Source Beutler Lab
Gene Symbol Osgin1
Ensembl Gene ENSMUSG00000074063
Gene Nameoxidative stress induced growth inhibitor 1
Synonyms1700012B18Rik
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0652 (G1)
Quality Score154
Status Not validated
Chromosome8
Chromosomal Location119434124-119446256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119445472 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 335 (Y335F)
Ref Sequence ENSEMBL: ENSMUSP00000114467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098363] [ENSMUST00000098365] [ENSMUST00000131448] [ENSMUST00000152420] [ENSMUST00000212112]
Predicted Effect probably benign
Transcript: ENSMUST00000098363
SMART Domains Protein: ENSMUSP00000095966
Gene: ENSMUSG00000031837

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
EFh 67 95 4.06e-2 SMART
EFh 101 129 3.21e0 SMART
low complexity region 185 196 N/A INTRINSIC
Pfam:ABM 289 363 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126414
Predicted Effect probably benign
Transcript: ENSMUST00000131448
SMART Domains Protein: ENSMUSP00000120477
Gene: ENSMUSG00000074063

DomainStartEndE-ValueType
SCOP:d1foha5 12 38 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145604
Predicted Effect probably damaging
Transcript: ENSMUST00000152420
AA Change: Y335F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114467
Gene: ENSMUSG00000074063
AA Change: Y335F

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 205 465 3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212112
Meta Mutation Damage Score 0.4319 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Ctnnd1 A G 2: 84,602,896 I609T probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr1463 A T 19: 13,234,535 Y95F possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wasf1 T A 10: 40,931,906 probably null Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Osgin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Osgin1 APN 8 119445046 missense probably damaging 0.97
IGL02347:Osgin1 APN 8 119445538 missense probably benign 0.02
IGL02803:Osgin1 APN 8 119443267 missense probably benign 0.00
IGL03111:Osgin1 APN 8 119443049 missense probably damaging 0.96
R0137:Osgin1 UTSW 8 119442480 missense possibly damaging 0.73
R0265:Osgin1 UTSW 8 119445657 missense possibly damaging 0.94
R0520:Osgin1 UTSW 8 119442508 missense probably damaging 1.00
R0650:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0687:Osgin1 UTSW 8 119445832 missense probably damaging 1.00
R1439:Osgin1 UTSW 8 119443113 splice site probably null
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R2058:Osgin1 UTSW 8 119445673 missense possibly damaging 0.87
R2982:Osgin1 UTSW 8 119442535 missense probably damaging 1.00
R3880:Osgin1 UTSW 8 119441452 missense probably benign
R4076:Osgin1 UTSW 8 119445033 missense possibly damaging 0.64
R4594:Osgin1 UTSW 8 119445253 missense possibly damaging 0.49
R4914:Osgin1 UTSW 8 119442544 missense possibly damaging 0.91
R4991:Osgin1 UTSW 8 119445289 missense probably damaging 1.00
R5689:Osgin1 UTSW 8 119444989 makesense probably null
R6215:Osgin1 UTSW 8 119445444 missense probably benign 0.01
R7008:Osgin1 UTSW 8 119441494 missense possibly damaging 0.92
R7136:Osgin1 UTSW 8 119441437 start codon destroyed probably null 0.51
R7380:Osgin1 UTSW 8 119445431 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCTACTTGACTACCAAGGACCACG -3'
(R):5'- TCTATGACCAAGTCAGCACCTGCC -3'

Sequencing Primer
(F):5'- ATGCTAGGCATCCCAGGAG -3'
(R):5'- GCCAATGAGGACCAGCAC -3'
Posted On2013-07-30