Mutagenetix > Incidental Mutation

Incidental Mutation 'R0652:Bsn'

62308

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

038837-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R0652 (G1)

Quality Score

117

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108105742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 3604 (F3604S)

Ref Sequence

ENSEMBL: ENSMUSP00000035208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000035208
AA Change: F3604S

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: F3604S

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000124763
AA Change: F832S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198370

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.3%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,152,063	N387D	probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Ahi1	C	A	10: 20,979,461	H556Q	probably damaging	Het
Amph	A	G	13: 19,086,621		probably null	Het
Apol7a	T	C	15: 77,389,855		probably benign	Het
Apoo-ps	A	T	13: 107,414,410		noncoding transcript	Het
Arpc1b	A	G	5: 145,126,860	D306G	probably damaging	Het
Astn2	T	C	4: 65,794,558	D615G	probably damaging	Het
Atm	A	G	9: 53,486,014	V1673A	probably damaging	Het
B3gnt3	A	T	8: 71,693,822	V21E	probably benign	Het
Bco1	A	G	8: 117,105,696	D77G	probably damaging	Het
Brinp2	A	T	1: 158,246,621	H643Q	probably damaging	Het
Cacna1c	A	G	6: 118,602,229	F1753L	probably damaging	Het
Cd74	T	C	18: 60,811,885	S201P	probably damaging	Het
Cep192	T	A	18: 67,807,265	L101Q	probably benign	Het
Cfap161	T	C	7: 83,793,276	I110V	probably null	Het
Cnksr3	T	C	10: 7,120,463	D257G	probably damaging	Het
Col14a1	A	C	15: 55,344,882	E121A	unknown	Het
Cpne3	T	C	4: 19,532,486	D309G	probably benign	Het
Ctnnd1	A	G	2: 84,602,896	I609T	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Dock7	T	C	4: 99,055,349	D552G	possibly damaging	Het
Dpyd	A	G	3: 119,427,275	D965G	probably damaging	Het
Efcab2	T	A	1: 178,481,346	M138K	probably damaging	Het
Eml3	T	C	19: 8,933,285	S204P	probably damaging	Het
Fbxw16	T	A	9: 109,436,168	S432C	possibly damaging	Het
Fbxw20	T	G	9: 109,232,332	Q116H	probably damaging	Het
Fech	A	G	18: 64,458,169	S395P	probably damaging	Het
Fgf7	A	G	2: 126,035,955	K81E	probably benign	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Ganab	A	T	19: 8,915,402		probably null	Het
Gfra1	T	C	19: 58,300,554	N153S	possibly damaging	Het
Gja4	T	A	4: 127,312,127	Y281F	probably benign	Het
Gm15448	T	A	7: 3,822,763	Y369F	probably benign	Het
Gm4763	T	A	7: 24,724,197	N14I	possibly damaging	Het
Gm5141	T	C	13: 62,774,132	T407A	probably damaging	Het
Gm5422	T	C	10: 31,249,281		noncoding transcript	Het
Greb1	T	C	12: 16,696,456	Y1271C	probably damaging	Het
Hp1bp3	C	A	4: 138,228,769	N50K	possibly damaging	Het
Hspg2	T	C	4: 137,514,722	F589S	probably damaging	Het
Ido1	A	G	8: 24,585,244	F183S	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kdm4a	T	C	4: 118,175,689	D60G	probably benign	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Map1a	A	G	2: 121,302,783	D1360G	probably benign	Het
Megf10	C	T	18: 57,277,724	P702S	probably benign	Het
Met	A	G	6: 17,491,710	E157G	probably benign	Het
Mff	A	G	1: 82,750,564	D187G	possibly damaging	Het
Mlph	A	T	1: 90,942,908	I514F	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Myo15b	T	C	11: 115,864,642	V976A	probably benign	Het
Myo9a	A	G	9: 59,871,926	D1655G	probably benign	Het
Ncoa6	C	T	2: 155,391,211	G2059D	probably benign	Het
Ndst4	A	T	3: 125,611,539	H481L	possibly damaging	Het
Nipbl	A	G	15: 8,303,480	S2220P	probably benign	Het
Nom1	C	A	5: 29,435,311	P212T	probably damaging	Het
Nsd1	A	G	13: 55,247,586	D1000G	possibly damaging	Het
Nudt9	T	C	5: 104,050,601	F44S	possibly damaging	Het
Numb	C	T	12: 83,795,792	V537I	probably damaging	Het
Olfr1404	T	A	1: 173,215,957	I102N	possibly damaging	Het
Olfr1463	A	T	19: 13,234,535	Y95F	possibly damaging	Het
Olfr183	A	G	16: 58,999,700	N5S	probably damaging	Het
Olfr60	A	T	7: 140,345,632	M119K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr801	T	A	10: 129,670,379	T47S	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pcdh10	T	A	3: 45,379,764	V171E	probably damaging	Het
Plxna4	T	C	6: 32,185,501	N1359S	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Prr5l	T	C	2: 101,772,290	T2A	possibly damaging	Het
Rbp3	T	A	14: 33,958,648	I1069N	possibly damaging	Het
Rnf144b	A	G	13: 47,220,507	Y60C	probably damaging	Het
Sbno2	A	T	10: 80,067,294	V396E	probably damaging	Het
Sdk1	A	G	5: 141,954,958	T494A	probably benign	Het
Serac1	G	T	17: 6,051,756	D384E	probably damaging	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Sigirr	A	T	7: 141,093,067	V69D	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
St6gal2	T	C	17: 55,498,289	Y396H	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr4	T	A	4: 139,401,326	I599N	probably damaging	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Vmn2r96	T	A	17: 18,597,568	M469K	probably benign	Het
Wasf1	T	A	10: 40,931,906		probably null	Het
Wdr20rt	T	C	12: 65,225,915	S51P	probably damaging	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1946:Bsn	UTSW	9	108114651	missense	probably damaging	0.99
R1978:Bsn	UTSW	9	108114549	missense	probably benign	0.35
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2136:Bsn	UTSW	9	108113231	missense	probably damaging	1.00
R2172:Bsn	UTSW	9	108109992	intron	probably benign
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4936:Bsn	UTSW	9	108111761	missense	probably damaging	1.00
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGAATAATCAGCAGAGCTGGGG -3'
(R):5'- TGGTTTCTGACAGCGAAGGTAATGG -3'

Sequencing Primer
(F):5'- TTCTGCATGGCAGGGGC -3'
(R):5'- TGAAAATGCTCTGCACCTGG -3'

Posted On

2013-07-30