Mutagenetix > Incidental Mutations

Incidental Mutation 'R0652:Greb1'

62322

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

038837-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0652 (G1)

Quality Score

143

Status

Not validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16696456 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1271 (Y1271C)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1271C

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1243C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161036

Predicted Effect

probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1271C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Meta Mutation Damage Score

0.7847

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.3%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,152,063	N387D	probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Ahi1	C	A	10: 20,979,461	H556Q	probably damaging	Het
Amph	A	G	13: 19,086,621		probably null	Het
Apol7a	T	C	15: 77,389,855		probably benign	Het
Apoo-ps	A	T	13: 107,414,410		noncoding transcript	Het
Arpc1b	A	G	5: 145,126,860	D306G	probably damaging	Het
Astn2	T	C	4: 65,794,558	D615G	probably damaging	Het
Atm	A	G	9: 53,486,014	V1673A	probably damaging	Het
B3gnt3	A	T	8: 71,693,822	V21E	probably benign	Het
Bco1	A	G	8: 117,105,696	D77G	probably damaging	Het
Brinp2	A	T	1: 158,246,621	H643Q	probably damaging	Het
Bsn	A	G	9: 108,105,742	F3604S	unknown	Het
Cacna1c	A	G	6: 118,602,229	F1753L	probably damaging	Het
Cd74	T	C	18: 60,811,885	S201P	probably damaging	Het
Cep192	T	A	18: 67,807,265	L101Q	probably benign	Het
Cfap161	T	C	7: 83,793,276	I110V	probably null	Het
Cnksr3	T	C	10: 7,120,463	D257G	probably damaging	Het
Col14a1	A	C	15: 55,344,882	E121A	unknown	Het
Cpne3	T	C	4: 19,532,486	D309G	probably benign	Het
Ctnnd1	A	G	2: 84,602,896	I609T	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Dock7	T	C	4: 99,055,349	D552G	possibly damaging	Het
Dpyd	A	G	3: 119,427,275	D965G	probably damaging	Het
Efcab2	T	A	1: 178,481,346	M138K	probably damaging	Het
Eml3	T	C	19: 8,933,285	S204P	probably damaging	Het
Fbxw16	T	A	9: 109,436,168	S432C	possibly damaging	Het
Fbxw20	T	G	9: 109,232,332	Q116H	probably damaging	Het
Fech	A	G	18: 64,458,169	S395P	probably damaging	Het
Fgf7	A	G	2: 126,035,955	K81E	probably benign	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Ganab	A	T	19: 8,915,402		probably null	Het
Gfra1	T	C	19: 58,300,554	N153S	possibly damaging	Het
Gja4	T	A	4: 127,312,127	Y281F	probably benign	Het
Gm15448	T	A	7: 3,822,763	Y369F	probably benign	Het
Gm4763	T	A	7: 24,724,197	N14I	possibly damaging	Het
Gm5141	T	C	13: 62,774,132	T407A	probably damaging	Het
Gm5422	T	C	10: 31,249,281		noncoding transcript	Het
Hp1bp3	C	A	4: 138,228,769	N50K	possibly damaging	Het
Hspg2	T	C	4: 137,514,722	F589S	probably damaging	Het
Ido1	A	G	8: 24,585,244	F183S	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kdm4a	T	C	4: 118,175,689	D60G	probably benign	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Map1a	A	G	2: 121,302,783	D1360G	probably benign	Het
Megf10	C	T	18: 57,277,724	P702S	probably benign	Het
Met	A	G	6: 17,491,710	E157G	probably benign	Het
Mff	A	G	1: 82,750,564	D187G	possibly damaging	Het
Mlph	A	T	1: 90,942,908	I514F	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Myo15b	T	C	11: 115,864,642	V976A	probably benign	Het
Myo9a	A	G	9: 59,871,926	D1655G	probably benign	Het
Ncoa6	C	T	2: 155,391,211	G2059D	probably benign	Het
Ndst4	A	T	3: 125,611,539	H481L	possibly damaging	Het
Nipbl	A	G	15: 8,303,480	S2220P	probably benign	Het
Nom1	C	A	5: 29,435,311	P212T	probably damaging	Het
Nsd1	A	G	13: 55,247,586	D1000G	possibly damaging	Het
Nudt9	T	C	5: 104,050,601	F44S	possibly damaging	Het
Numb	C	T	12: 83,795,792	V537I	probably damaging	Het
Olfr1404	T	A	1: 173,215,957	I102N	possibly damaging	Het
Olfr1463	A	T	19: 13,234,535	Y95F	possibly damaging	Het
Olfr183	A	G	16: 58,999,700	N5S	probably damaging	Het
Olfr60	A	T	7: 140,345,632	M119K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr801	T	A	10: 129,670,379	T47S	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pcdh10	T	A	3: 45,379,764	V171E	probably damaging	Het
Plxna4	T	C	6: 32,185,501	N1359S	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Prr5l	T	C	2: 101,772,290	T2A	possibly damaging	Het
Rbp3	T	A	14: 33,958,648	I1069N	possibly damaging	Het
Rnf144b	A	G	13: 47,220,507	Y60C	probably damaging	Het
Sbno2	A	T	10: 80,067,294	V396E	probably damaging	Het
Sdk1	A	G	5: 141,954,958	T494A	probably benign	Het
Serac1	G	T	17: 6,051,756	D384E	probably damaging	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Sigirr	A	T	7: 141,093,067	V69D	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
St6gal2	T	C	17: 55,498,289	Y396H	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr4	T	A	4: 139,401,326	I599N	probably damaging	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Vmn2r96	T	A	17: 18,597,568	M469K	probably benign	Het
Wasf1	T	A	10: 40,931,906		probably null	Het
Wdr20rt	T	C	12: 65,225,915	S51P	probably damaging	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGGCAGTAAAACTGAAGACGACC -3'
(R):5'- ACAGCCTGATTCTAGCCTCAGGAC -3'

Sequencing Primer
(F):5'- GGCATGATACCCACCTGAG -3'
(R):5'- TCGGGCTCATCATCCACAT -3'

Posted On

2013-07-30