Mutagenetix > Incidental Mutations

Incidental Mutation 'R0652:Amph'

62325

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

038837-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R0652 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 19086621 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

Predicted Effect

probably null
Transcript: ENSMUST00000003345

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200273

Predicted Effect

probably null
Transcript: ENSMUST00000200466

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222698

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.3%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,152,063	N387D	probably benign	Het
Adgrg5	T	A	8: 94,934,157		probably null	Het
Ahi1	C	A	10: 20,979,461	H556Q	probably damaging	Het
Apol7a	T	C	15: 77,389,855		probably benign	Het
Apoo-ps	A	T	13: 107,414,410		noncoding transcript	Het
Arpc1b	A	G	5: 145,126,860	D306G	probably damaging	Het
Astn2	T	C	4: 65,794,558	D615G	probably damaging	Het
Atm	A	G	9: 53,486,014	V1673A	probably damaging	Het
B3gnt3	A	T	8: 71,693,822	V21E	probably benign	Het
Bco1	A	G	8: 117,105,696	D77G	probably damaging	Het
Brinp2	A	T	1: 158,246,621	H643Q	probably damaging	Het
Bsn	A	G	9: 108,105,742	F3604S	unknown	Het
Cacna1c	A	G	6: 118,602,229	F1753L	probably damaging	Het
Cd74	T	C	18: 60,811,885	S201P	probably damaging	Het
Cep192	T	A	18: 67,807,265	L101Q	probably benign	Het
Cfap161	T	C	7: 83,793,276	I110V	probably null	Het
Cnksr3	T	C	10: 7,120,463	D257G	probably damaging	Het
Col14a1	A	C	15: 55,344,882	E121A	unknown	Het
Cpne3	T	C	4: 19,532,486	D309G	probably benign	Het
Ctnnd1	A	G	2: 84,602,896	I609T	probably benign	Het
Cyp2s1	A	G	7: 25,809,258	V253A	probably damaging	Het
Dock7	T	C	4: 99,055,349	D552G	possibly damaging	Het
Dpyd	A	G	3: 119,427,275	D965G	probably damaging	Het
Efcab2	T	A	1: 178,481,346	M138K	probably damaging	Het
Eml3	T	C	19: 8,933,285	S204P	probably damaging	Het
Fbxw16	T	A	9: 109,436,168	S432C	possibly damaging	Het
Fbxw20	T	G	9: 109,232,332	Q116H	probably damaging	Het
Fech	A	G	18: 64,458,169	S395P	probably damaging	Het
Fgf7	A	G	2: 126,035,955	K81E	probably benign	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Ganab	A	T	19: 8,915,402		probably null	Het
Gfra1	T	C	19: 58,300,554	N153S	possibly damaging	Het
Gja4	T	A	4: 127,312,127	Y281F	probably benign	Het
Gm15448	T	A	7: 3,822,763	Y369F	probably benign	Het
Gm4763	T	A	7: 24,724,197	N14I	possibly damaging	Het
Gm5141	T	C	13: 62,774,132	T407A	probably damaging	Het
Gm5422	T	C	10: 31,249,281		noncoding transcript	Het
Greb1	T	C	12: 16,696,456	Y1271C	probably damaging	Het
Hp1bp3	C	A	4: 138,228,769	N50K	possibly damaging	Het
Hspg2	T	C	4: 137,514,722	F589S	probably damaging	Het
Ido1	A	G	8: 24,585,244	F183S	probably damaging	Het
Iqgap1	T	A	7: 80,736,395	K936I	probably damaging	Het
Kdm4a	T	C	4: 118,175,689	D60G	probably benign	Het
L3mbtl4	G	A	17: 68,774,291	C558Y	probably damaging	Het
Lrrc28	T	C	7: 67,618,085	N98S	probably damaging	Het
Map1a	A	G	2: 121,302,783	D1360G	probably benign	Het
Megf10	C	T	18: 57,277,724	P702S	probably benign	Het
Met	A	G	6: 17,491,710	E157G	probably benign	Het
Mff	A	G	1: 82,750,564	D187G	possibly damaging	Het
Mlph	A	T	1: 90,942,908	I514F	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Myo15b	T	C	11: 115,864,642	V976A	probably benign	Het
Myo9a	A	G	9: 59,871,926	D1655G	probably benign	Het
Ncoa6	C	T	2: 155,391,211	G2059D	probably benign	Het
Ndst4	A	T	3: 125,611,539	H481L	possibly damaging	Het
Nipbl	A	G	15: 8,303,480	S2220P	probably benign	Het
Nom1	C	A	5: 29,435,311	P212T	probably damaging	Het
Nsd1	A	G	13: 55,247,586	D1000G	possibly damaging	Het
Nudt9	T	C	5: 104,050,601	F44S	possibly damaging	Het
Numb	C	T	12: 83,795,792	V537I	probably damaging	Het
Olfr1404	T	A	1: 173,215,957	I102N	possibly damaging	Het
Olfr1463	A	T	19: 13,234,535	Y95F	possibly damaging	Het
Olfr183	A	G	16: 58,999,700	N5S	probably damaging	Het
Olfr60	A	T	7: 140,345,632	M119K	probably damaging	Het
Olfr638	A	G	7: 104,003,239		probably null	Het
Olfr801	T	A	10: 129,670,379	T47S	probably benign	Het
Osgin1	A	T	8: 119,445,472	Y335F	probably damaging	Het
Pcdh10	T	A	3: 45,379,764	V171E	probably damaging	Het
Plxna4	T	C	6: 32,185,501	N1359S	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Prr5l	T	C	2: 101,772,290	T2A	possibly damaging	Het
Rbp3	T	A	14: 33,958,648	I1069N	possibly damaging	Het
Rnf144b	A	G	13: 47,220,507	Y60C	probably damaging	Het
Sbno2	A	T	10: 80,067,294	V396E	probably damaging	Het
Sdk1	A	G	5: 141,954,958	T494A	probably benign	Het
Serac1	G	T	17: 6,051,756	D384E	probably damaging	Het
Sgk1	A	G	10: 21,882,657	N7D	probably damaging	Het
Sigirr	A	T	7: 141,093,067	V69D	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
St6gal2	T	C	17: 55,498,289	Y396H	probably benign	Het
Ttn	A	T	2: 76,768,612	F19319Y	probably damaging	Het
Ubr4	T	A	4: 139,401,326	I599N	probably damaging	Het
Vmn1r213	A	G	13: 23,011,394		probably benign	Het
Vmn2r96	T	A	17: 18,597,568	M469K	probably benign	Het
Wasf1	T	A	10: 40,931,906		probably null	Het
Wdr20rt	T	C	12: 65,225,915	S51P	probably damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- AGAACACTGACCACATTGCCTTGAC -3'
(R):5'- TGAAGCGTTCACTAAGAGGCCAC -3'

Sequencing Primer
(F):5'- ATCTCAGGAAGGATGGCTTACTATG -3'
(R):5'- CACTAAGAGGCCACTTTGATTTCTG -3'

Posted On

2013-07-30