Incidental Mutation 'R0653:Cenpf'
ID62356
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R0653 (G1)
Quality Score83
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189659986 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 550 (K550E)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably damaging
Transcript: ENSMUST00000165962
AA Change: K533E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605
AA Change: K533E

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: K550E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: K550E

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
R7698:Cenpf UTSW 1 189662072 missense probably benign 0.01
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTGATGCTTTTGGTCCGAGGA -3'
(R):5'- TGTCAAGTTTTACAGGATGTGACAGCC -3'

Sequencing Primer
(F):5'- TTCTCTCATTAGAGTCAGGACTTAC -3'
(R):5'- CAGGATGTGACAGCCtattaatttc -3'
Posted On2013-07-30