Incidental Mutation 'R0653:Ciz1'
ID62360
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0653 (G1)
Quality Score82
Status Not validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32372406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 521 (S521P)
Ref Sequence ENSEMBL: ENSMUSP00000108964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000125818] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079] [ENSMUST00000146423]
Predicted Effect probably damaging
Transcript: ENSMUST00000048964
AA Change: S521P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: S521P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113331
AA Change: S497P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: S497P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113332
AA Change: S467P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: S467P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113334
AA Change: S521P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: S521P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113338
AA Change: S521P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: S521P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125482
AA Change: S199P
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205
AA Change: S199P

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000125818
SMART Domains Protein: ENSMUSP00000117937
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
Blast:ZnF_U1 4 31 3e-6 BLAST
ZnF_U1 33 67 2.08e-1 SMART
ZnF_C2H2 36 60 3.02e0 SMART
low complexity region 96 116 N/A INTRINSIC
ZnF_U1 151 186 1.43e-4 SMART
ZnF_C2H2 154 179 9.56e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132028
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134141
Predicted Effect probably benign
Transcript: ENSMUST00000136079
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect probably benign
Transcript: ENSMUST00000139637
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect probably benign
Transcript: ENSMUST00000146423
SMART Domains Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 43 1.4e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149184
Predicted Effect probably benign
Transcript: ENSMUST00000151806
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R2116:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R3161:Ciz1 UTSW 2 32370063 missense probably benign 0.11
R3732:Ciz1 UTSW 2 32367483 missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4687:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 unclassified probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32370051 missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
R7200:Ciz1 UTSW 2 32364287 missense probably damaging 1.00
R7498:Ciz1 UTSW 2 32371749 missense probably benign
R7574:Ciz1 UTSW 2 32367368 missense probably benign 0.16
R7910:Ciz1 UTSW 2 32370127 critical splice donor site probably null
R7991:Ciz1 UTSW 2 32370127 critical splice donor site probably null
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGCCAGTCCTTCTCCTAAC -3'
(R):5'- AAGACCCAAGGGTGGGATATACCTC -3'

Sequencing Primer
(F):5'- agagaggtggaggcagg -3'
(R):5'- GATCTGAACCAGGTTTTCCTAGATCC -3'
Posted On2013-07-30