Incidental Mutation 'R0653:Bmp3'
ID62370
Institutional Source Beutler Lab
Gene Symbol Bmp3
Ensembl Gene ENSMUSG00000029335
Gene Namebone morphogenetic protein 3
Synonyms9530029I04Rik
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0653 (G1)
Quality Score103
Status Not validated
Chromosome5
Chromosomal Location98854415-98884396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98872111 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 131 (Y131C)
Ref Sequence ENSEMBL: ENSMUSP00000142907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031278] [ENSMUST00000197143] [ENSMUST00000200388]
Predicted Effect probably damaging
Transcript: ENSMUST00000031278
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031278
Gene: ENSMUSG00000029335
AA Change: Y131C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 34 231 7.9e-9 PFAM
TGFB 366 468 6.17e-60 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197143
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142662
Gene: ENSMUSG00000029335
AA Change: Y131C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.2e-9 PFAM
TGFB 366 433 5.1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200388
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142907
Gene: ENSMUSG00000029335
AA Change: Y131C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.4e-9 PFAM
TGFB 366 442 3.9e-11 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein suppresses osteoblast differentiation, and negatively regulates bone density, by modulating TGF-beta receptor availability to other ligands. Homozygous knockout mice for this gene exhibit increased bone density and volume, while overexpression of this gene in a transgenic mouse causes bone defects resulting in spontaneous rib fractures. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in increased bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Bmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Bmp3 APN 5 98872379 missense possibly damaging 0.47
IGL02396:Bmp3 APN 5 98872719 missense possibly damaging 0.47
IGL03058:Bmp3 APN 5 98872094 missense probably damaging 1.00
IGL03189:Bmp3 APN 5 98872720 missense probably benign 0.23
IGL03400:Bmp3 APN 5 98872098 missense probably damaging 1.00
PIT4377001:Bmp3 UTSW 5 98879749 missense unknown
R0139:Bmp3 UTSW 5 98879909 missense possibly damaging 0.72
R0881:Bmp3 UTSW 5 98872602 missense possibly damaging 0.95
R1261:Bmp3 UTSW 5 98879926 missense probably damaging 1.00
R1413:Bmp3 UTSW 5 98872405 missense probably damaging 0.98
R1481:Bmp3 UTSW 5 98872470 missense probably damaging 1.00
R3009:Bmp3 UTSW 5 98879837 missense probably damaging 1.00
R4507:Bmp3 UTSW 5 98879774 missense probably damaging 1.00
R4750:Bmp3 UTSW 5 98872558 missense possibly damaging 0.89
R4833:Bmp3 UTSW 5 98855207 missense probably damaging 1.00
R4921:Bmp3 UTSW 5 98872061 missense probably damaging 1.00
R5022:Bmp3 UTSW 5 98872824 missense probably damaging 1.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R7179:Bmp3 UTSW 5 98872763 missense probably damaging 1.00
R7448:Bmp3 UTSW 5 98872218 missense probably damaging 0.96
R7880:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
R7963:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCAACGATGCTGCCATTTCT -3'
(R):5'- TGACCACATCTACAGACAGATGACCC -3'

Sequencing Primer
(F):5'- atgaatctgttaccaagtctaaagtc -3'
(R):5'- CAGATGACCCAAGAGCTGG -3'
Posted On2013-07-30