Incidental Mutation 'R0653:Sbno1'
ID62372
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0653 (G1)
Quality Score86
Status Not validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124386892 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1050 (I1050T)
Ref Sequence ENSEMBL: ENSMUSP00000130860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000199808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065263
AA Change: I1051T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: I1051T

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168651
AA Change: I1050T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: I1050T

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199245
Predicted Effect possibly damaging
Transcript: ENSMUST00000199808
AA Change: I1051T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: I1051T

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
R7535:Sbno1 UTSW 5 124413279 missense possibly damaging 0.48
R7673:Sbno1 UTSW 5 124413216 missense probably benign
R7692:Sbno1 UTSW 5 124405646 missense probably benign 0.35
R7745:Sbno1 UTSW 5 124392899 missense probably benign 0.00
R7762:Sbno1 UTSW 5 124374666 missense probably benign 0.19
R8012:Sbno1 UTSW 5 124384502 missense probably benign 0.43
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTCACCAAGTTGAGTTCCGAGTTG -3'
(R):5'- TCTGAAAAGGCACAAATAGGCGGTC -3'

Sequencing Primer
(F):5'- gaagccaggccttcatacat -3'
(R):5'- GGCGGTCGTAATTAATGTCCTG -3'
Posted On2013-07-30