Incidental Mutation 'R0653:Zfp30'
ID62374
Institutional Source Beutler Lab
Gene Symbol Zfp30
Ensembl Gene ENSMUSG00000047473
Gene Namezinc finger protein 30
SynonymsZfp-30, 2610306P15Rik
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0653 (G1)
Quality Score126
Status Not validated
Chromosome7
Chromosomal Location29783998-29794702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29792753 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 225 (R225Q)
Ref Sequence ENSEMBL: ENSMUSP00000032803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032803] [ENSMUST00000122387]
Predicted Effect probably damaging
Transcript: ENSMUST00000032803
AA Change: R225Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032803
Gene: ENSMUSG00000047473
AA Change: R225Q

DomainStartEndE-ValueType
KRAB 21 82 4.61e-37 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 7.78e-3 SMART
ZnF_C2H2 243 265 5.06e-2 SMART
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 319 3.72e0 SMART
ZnF_C2H2 327 349 3.24e0 SMART
ZnF_C2H2 355 377 3.89e-3 SMART
ZnF_C2H2 383 405 4.79e-3 SMART
ZnF_C2H2 411 433 1.36e-2 SMART
ZnF_C2H2 439 461 1.36e-2 SMART
ZnF_C2H2 467 489 7.26e-3 SMART
ZnF_C2H2 495 517 2.09e-3 SMART
ZnF_C2H2 523 545 6.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122387
AA Change: R144Q

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113426
Gene: ENSMUSG00000047473
AA Change: R144Q

DomainStartEndE-ValueType
ZnF_C2H2 106 128 5.9e-3 SMART
ZnF_C2H2 134 156 7.78e-3 SMART
ZnF_C2H2 162 184 5.06e-2 SMART
ZnF_C2H2 190 212 1.47e-3 SMART
ZnF_C2H2 218 238 3.72e0 SMART
ZnF_C2H2 246 268 3.24e0 SMART
ZnF_C2H2 274 296 3.89e-3 SMART
ZnF_C2H2 302 324 4.79e-3 SMART
ZnF_C2H2 330 352 1.36e-2 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 386 408 7.26e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 6.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126504
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Zfp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
elo UTSW 7 29793066 nonsense probably null
R0022:Zfp30 UTSW 7 29792435 missense possibly damaging 0.68
R0218:Zfp30 UTSW 7 29793638 missense probably damaging 1.00
R0349:Zfp30 UTSW 7 29793604 missense probably damaging 1.00
R0537:Zfp30 UTSW 7 29792735 missense probably damaging 0.98
R1836:Zfp30 UTSW 7 29793380 missense probably damaging 0.96
R1966:Zfp30 UTSW 7 29792452 missense probably benign
R2100:Zfp30 UTSW 7 29793526 missense probably benign 0.30
R3696:Zfp30 UTSW 7 29793390 missense probably damaging 1.00
R3723:Zfp30 UTSW 7 29793353 missense probably damaging 0.97
R4571:Zfp30 UTSW 7 29793202 missense probably damaging 1.00
R5027:Zfp30 UTSW 7 29793066 nonsense probably null
R5070:Zfp30 UTSW 7 29786266 utr 5 prime probably benign
R6013:Zfp30 UTSW 7 29789421 missense possibly damaging 0.79
R7274:Zfp30 UTSW 7 29792618 missense probably benign
R7484:Zfp30 UTSW 7 29792806 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAAGACTCCCTTTTGGGGAAAGAC -3'
(R):5'- CCGCACTCTTTACAATCGTAGGGC -3'

Sequencing Primer
(F):5'- CTCTCATAGGGTATATTTCAGACACG -3'
(R):5'- ACAATCGTAGGGCTTCTCG -3'
Posted On2013-07-30