Incidental Mutation 'R0653:Mex3b'
ID62378
Institutional Source Beutler Lab
Gene Symbol Mex3b
Ensembl Gene ENSMUSG00000057706
Gene Namemex3 RNA binding family member B
Synonyms4931439A04Rik, Rkhd3
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R0653 (G1)
Quality Score160
Status Not validated
Chromosome7
Chromosomal Location82867333-82871515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82869034 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 186 (K186E)
Ref Sequence ENSEMBL: ENSMUSP00000082168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082237]
Predicted Effect probably damaging
Transcript: ENSMUST00000082237
AA Change: K186E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082168
Gene: ENSMUSG00000057706
AA Change: K186E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 35 61 N/A INTRINSIC
KH 71 139 2.54e-9 SMART
KH 166 233 1.6e-15 SMART
low complexity region 262 270 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 389 424 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 494 515 N/A INTRINSIC
RING 525 564 3.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209046
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to partial neonatal lethality, decreased body weight and subfertility. Males show seminiferous tubule obstruction, oligozoospermia, abnormalities in Sertoli cell barrier morphology and function, and impaired Sertoli cell and macrophage phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Mex3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Mex3b APN 7 82868908 missense probably damaging 1.00
IGL01112:Mex3b APN 7 82869703 missense probably benign 0.41
IGL01490:Mex3b APN 7 82869827 missense possibly damaging 0.71
IGL01809:Mex3b APN 7 82869712 missense probably benign
IGL02328:Mex3b APN 7 82869712 missense probably benign
R0218:Mex3b UTSW 7 82869104 missense probably damaging 1.00
R2360:Mex3b UTSW 7 82867862 missense probably benign 0.16
R4184:Mex3b UTSW 7 82870030 missense probably benign 0.00
R4397:Mex3b UTSW 7 82869823 missense possibly damaging 0.88
R4771:Mex3b UTSW 7 82869065 missense possibly damaging 0.81
R4945:Mex3b UTSW 7 82870174 missense probably benign 0.03
R5189:Mex3b UTSW 7 82869251 missense probably damaging 0.96
R6962:Mex3b UTSW 7 82869265 missense probably benign 0.00
R7021:Mex3b UTSW 7 82869872 missense possibly damaging 0.49
R7381:Mex3b UTSW 7 82868865 missense possibly damaging 0.85
R7483:Mex3b UTSW 7 82867906 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGAGGGCGAAGACCAACACTTAC -3'
(R):5'- AAAGCCCACGTCTGTGCCATTG -3'

Sequencing Primer
(F):5'- gaagaccaacacttacatcaagac -3'
(R):5'- CCATTGGCATGGAAGTCGTTC -3'
Posted On2013-07-30