Incidental Mutation 'R0653:Olfr967'
ID62382
Institutional Source Beutler Lab
Gene Symbol Olfr967
Ensembl Gene ENSMUSG00000055820
Gene Nameolfactory receptor 967
SynonymsGA_x6K02T2PVTD-33447884-33448816, MOR171-30P
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0653 (G1)
Quality Score131
Status Not validated
Chromosome9
Chromosomal Location39746249-39751493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39750638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 84 (N84S)
Ref Sequence ENSEMBL: ENSMUSP00000150183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069561] [ENSMUST00000213358]
Predicted Effect probably benign
Transcript: ENSMUST00000069561
AA Change: N84S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064201
Gene: ENSMUSG00000055820
AA Change: N84S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.6e-50 PFAM
Pfam:7tm_1 41 290 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213358
AA Change: N84S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Olfr967
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Olfr967 APN 9 39750491 missense probably damaging 0.99
IGL02900:Olfr967 APN 9 39750605 missense probably benign 0.01
R0099:Olfr967 UTSW 9 39750661 missense possibly damaging 0.95
R0586:Olfr967 UTSW 9 39751118 missense probably damaging 0.98
R0839:Olfr967 UTSW 9 39750391 missense probably benign
R1701:Olfr967 UTSW 9 39751069 missense probably damaging 1.00
R1744:Olfr967 UTSW 9 39750415 missense probably benign 0.33
R1902:Olfr967 UTSW 9 39750806 missense probably benign 0.01
R4696:Olfr967 UTSW 9 39750728 missense probably damaging 0.98
R5252:Olfr967 UTSW 9 39750488 missense probably damaging 0.98
R5660:Olfr967 UTSW 9 39750767 missense probably damaging 1.00
R6272:Olfr967 UTSW 9 39750520 missense probably benign 0.39
R6976:Olfr967 UTSW 9 39751244 missense probably damaging 1.00
R7078:Olfr967 UTSW 9 39750491 missense possibly damaging 0.92
R7167:Olfr967 UTSW 9 39750569 missense probably damaging 0.96
R7701:Olfr967 UTSW 9 39751301 missense probably benign
R8026:Olfr967 UTSW 9 39750796 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGAACTGCTTGACCTTGGTTTCACAC -3'
(R):5'- TCATCCAGGTGCAGACTTGATAGGAC -3'

Sequencing Primer
(F):5'- TCCTTGCTGGATTAACAAGCAC -3'
(R):5'- TGCAGACTTGATAGGACATCATAGC -3'
Posted On2013-07-30