Incidental Mutation 'R0653:4933427D14Rik'
ID62393
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0653 (G1)
Quality Score152
Status Not validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72175545 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 612 (R612*)
Ref Sequence ENSEMBL: ENSMUSP00000122273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530]
Predicted Effect probably null
Transcript: ENSMUST00000108506
AA Change: R612*
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807
AA Change: R612*

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131546
AA Change: R612*
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807
AA Change: R612*

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156696
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R1797:4933427D14Rik UTSW 11 72198459 missense possibly damaging 0.77
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5556:4933427D14Rik UTSW 11 72175200 splice site probably null
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5683:4933427D14Rik UTSW 11 72202440 missense probably benign
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGATGCCCTTGGCTTCTATCTCTG -3'
(R):5'- TGGGCCGTTAGGTGACATTCACAG -3'

Sequencing Primer
(F):5'- CTATCTCTGCTCTCCTGAAGAC -3'
(R):5'- TAACATGTCCTGAGATCAGTGG -3'
Posted On2013-07-30