Incidental Mutation 'R0653:Taok1'
ID62394
Institutional Source Beutler Lab
Gene Symbol Taok1
Ensembl Gene ENSMUSG00000017291
Gene NameTAO kinase 1
SynonymsD130018F14Rik, 2810468K05Rik
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R0653 (G1)
Quality Score92
Status Not validated
Chromosome11
Chromosomal Location77529162-77607815 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 77578724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017435] [ENSMUST00000058496]
Predicted Effect probably null
Transcript: ENSMUST00000017435
SMART Domains Protein: ENSMUSP00000017435
Gene: ENSMUSG00000017291

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000058496
SMART Domains Protein: ENSMUSP00000055470
Gene: ENSMUSG00000017291

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Taok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Taok1 APN 11 77571684 missense probably damaging 1.00
IGL01629:Taok1 APN 11 77538204 missense possibly damaging 0.63
IGL02198:Taok1 APN 11 77575677 splice site probably benign
IGL02392:Taok1 APN 11 77549352 missense probably benign 0.13
IGL02415:Taok1 APN 11 77540240 unclassified probably benign
IGL02428:Taok1 APN 11 77549277 missense probably benign 0.01
IGL02972:Taok1 APN 11 77559758 missense probably benign 0.04
IGL03200:Taok1 APN 11 77575652 nonsense probably null
IGL03203:Taok1 APN 11 77540085 missense probably damaging 0.96
IGL03292:Taok1 APN 11 77540136 missense probably benign 0.07
IGL03351:Taok1 APN 11 77560328 missense probably damaging 0.96
R0070:Taok1 UTSW 11 77553717 missense probably benign
R0497:Taok1 UTSW 11 77573804 missense probably damaging 0.97
R0535:Taok1 UTSW 11 77553704 missense probably benign 0.00
R0558:Taok1 UTSW 11 77559844 missense possibly damaging 0.89
R1249:Taok1 UTSW 11 77571637 missense probably damaging 1.00
R1424:Taok1 UTSW 11 77549364 missense probably benign 0.00
R1597:Taok1 UTSW 11 77579800 missense probably benign 0.31
R2112:Taok1 UTSW 11 77571646 missense probably benign 0.01
R3716:Taok1 UTSW 11 77541810 missense probably benign 0.09
R4013:Taok1 UTSW 11 77559833 missense possibly damaging 0.95
R4058:Taok1 UTSW 11 77549438 missense probably benign 0.05
R4831:Taok1 UTSW 11 77553674 missense probably null 0.34
R5036:Taok1 UTSW 11 77549331 missense probably benign 0.01
R5917:Taok1 UTSW 11 77560318 missense probably damaging 0.99
R6271:Taok1 UTSW 11 77573783 missense probably damaging 1.00
R6286:Taok1 UTSW 11 77553773 missense probably benign 0.00
R6860:Taok1 UTSW 11 77541801 missense probably benign 0.01
R6933:Taok1 UTSW 11 77555653 missense probably benign
R7139:Taok1 UTSW 11 77571633 missense probably damaging 1.00
R7143:Taok1 UTSW 11 77537988 missense probably benign
R7305:Taok1 UTSW 11 77541674 nonsense probably null
R7340:Taok1 UTSW 11 77579817 missense possibly damaging 0.89
R7508:Taok1 UTSW 11 77545326 missense probably damaging 0.97
R7569:Taok1 UTSW 11 77555614 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCAAGGAATCCTGTCATCCCAAATT -3'
(R):5'- TGTGTCGTATTAAGCAACAAGCTGAGT -3'

Sequencing Primer
(F):5'- TCCTGAAGGTATGAATGAACTCTGG -3'
(R):5'- TCCCTCCACATAGAAATGGC -3'
Posted On2013-07-30