Incidental Mutation 'R0653:Akr1c18'
ID62401
Institutional Source Beutler Lab
Gene Symbol Akr1c18
Ensembl Gene ENSMUSG00000021214
Gene Namealdo-keto reductase family 1, member C18
Synonyms20alpha-HSD, 20alpha-hydroxysteroid dehydrogenase
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0653 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location4132615-4150654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4145308 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000106332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021635] [ENSMUST00000110704]
Predicted Effect probably damaging
Transcript: ENSMUST00000021635
AA Change: D50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021635
Gene: ENSMUSG00000021214
AA Change: D50E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 4.2e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110704
AA Change: D50E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106332
Gene: ENSMUSG00000021214
AA Change: D50E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 275 1.1e-50 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display prolonged pregnancies and decreased number of pups. Some cannot induce parturition while others are able to give birth but show a prolonged estrous cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Akr1c18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Akr1c18 APN 13 4137233 missense probably damaging 1.00
IGL01458:Akr1c18 APN 13 4137144 missense probably damaging 1.00
R0321:Akr1c18 UTSW 13 4135244 missense probably damaging 1.00
R0514:Akr1c18 UTSW 13 4137191 missense probably benign 0.00
R1006:Akr1c18 UTSW 13 4136655 missense probably benign 0.00
R1345:Akr1c18 UTSW 13 4145214 missense possibly damaging 0.94
R1656:Akr1c18 UTSW 13 4145253 missense probably benign 0.12
R1887:Akr1c18 UTSW 13 4143288 missense probably benign 0.02
R2015:Akr1c18 UTSW 13 4145309 missense probably damaging 1.00
R2570:Akr1c18 UTSW 13 4142164 missense probably benign 0.04
R3951:Akr1c18 UTSW 13 4135285 missense probably benign 0.06
R4717:Akr1c18 UTSW 13 4136718 missense probably benign 0.00
R5414:Akr1c18 UTSW 13 4136735 missense probably damaging 1.00
R5540:Akr1c18 UTSW 13 4137179 missense probably benign 0.22
R5723:Akr1c18 UTSW 13 4144329 nonsense probably null
R6797:Akr1c18 UTSW 13 4145277 missense probably benign 0.02
R7343:Akr1c18 UTSW 13 4137237 missense probably damaging 0.99
R7741:Akr1c18 UTSW 13 4144333 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGCACAATTCACCAAGTACAGGTTCA -3'
(R):5'- CAGGCAACATCTCTTTACCTGGTCTTT -3'

Sequencing Primer
(F):5'- CCAAGTACAGGTTCAATTACACAGTG -3'
(R):5'- TTAACCAAACTTGGTGGACAAGAC -3'
Posted On2013-07-30