Incidental Mutation 'R0653:Wnk2'
ID62403
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R0653 (G1)
Quality Score195
Status Not validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49057016 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1788 (F1788L)
Ref Sequence ENSEMBL: ENSMUSP00000125448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159196] [ENSMUST00000159559] [ENSMUST00000160087] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035538
AA Change: F1788L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: F1788L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000049265
AA Change: F1788L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: F1788L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091623
AA Change: F1788L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: F1788L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110096
AA Change: F1689L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989
AA Change: F1689L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110097
AA Change: F1788L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: F1788L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159196
AA Change: F283L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124598
Gene: ENSMUSG00000037989
AA Change: F283L

DomainStartEndE-ValueType
low complexity region 82 92 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 331 362 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159559
AA Change: F1776L

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: F1776L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159633
Predicted Effect probably benign
Transcript: ENSMUST00000160087
AA Change: F929L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124614
Gene: ENSMUSG00000037989
AA Change: F929L

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
low complexity region 255 278 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
low complexity region 459 495 N/A INTRINSIC
low complexity region 571 583 N/A INTRINSIC
low complexity region 591 599 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 729 738 N/A INTRINSIC
low complexity region 961 972 N/A INTRINSIC
coiled coil region 977 1008 N/A INTRINSIC
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162403
AA Change: F1678L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989
AA Change: F1678L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162581
AA Change: F1788L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: F1788L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1891:Wnk2 UTSW 13 49052724 nonsense probably null
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4888:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5243:Wnk2 UTSW 13 49072578 missense possibly damaging 0.51
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5877:Wnk2 UTSW 13 49067306 missense probably damaging 0.98
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
R7011:Wnk2 UTSW 13 49071091 missense probably damaging 0.99
R7097:Wnk2 UTSW 13 49102838 missense possibly damaging 0.86
R7121:Wnk2 UTSW 13 49147177 missense probably benign 0.26
R7123:Wnk2 UTSW 13 49081986 missense possibly damaging 0.90
R7423:Wnk2 UTSW 13 49038132 missense probably benign 0.07
R7502:Wnk2 UTSW 13 49147244 splice site probably null
R7529:Wnk2 UTSW 13 49100981 missense possibly damaging 0.50
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAAACGTACTTTTCTCGCAGAC -3'
(R):5'- TTTTCCGTGGTCAGCACACAGG -3'

Sequencing Primer
(F):5'- TGGAAGGAGGTGATGCTGAT -3'
(R):5'- GATGTCTACCTGGATGAGATCCC -3'
Posted On2013-07-30