Incidental Mutation 'R0653:Nckap5l'
ID62412
Institutional Source Beutler Lab
Gene Symbol Nckap5l
Ensembl Gene ENSMUSG00000023009
Gene NameNCK-associated protein 5-like
Synonyms
MMRRC Submission 038838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R0653 (G1)
Quality Score102
Status Not validated
Chromosome15
Chromosomal Location99422035-99457748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99423246 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1218 (V1218F)
Ref Sequence ENSEMBL: ENSMUSP00000023747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023747]
Predicted Effect probably damaging
Transcript: ENSMUST00000023747
AA Change: V1218F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023747
Gene: ENSMUSG00000023009
AA Change: V1218F

DomainStartEndE-ValueType
coiled coil region 22 104 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 158 178 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 351 364 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
low complexity region 799 817 N/A INTRINSIC
Pfam:NCKAP5 871 1173 6.8e-89 PFAM
low complexity region 1205 1217 N/A INTRINSIC
low complexity region 1302 1318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160500
Predicted Effect probably benign
Transcript: ENSMUST00000161004
SMART Domains Protein: ENSMUSP00000125080
Gene: ENSMUSG00000023009

DomainStartEndE-ValueType
Pfam:NCKAP5 5 112 1.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,545 R612* probably null Het
Adgra1 A G 7: 139,876,147 T564A probably damaging Het
Akr1c18 A T 13: 4,145,308 D50E probably damaging Het
Atg9a C A 1: 75,190,328 L26F probably damaging Het
Atp11b A G 3: 35,839,194 T899A probably damaging Het
Atxn2 A G 5: 121,772,778 E358G probably damaging Het
Bmp3 A G 5: 98,872,111 Y131C probably damaging Het
Brip1 T C 11: 86,152,658 E360G possibly damaging Het
Casd1 A T 6: 4,608,075 I76L probably benign Het
Casq2 G A 3: 102,113,166 probably null Het
Ccdc185 T A 1: 182,747,564 Q520L possibly damaging Het
Cenpf T C 1: 189,659,986 K550E probably damaging Het
Ciz1 T C 2: 32,372,406 S521P probably damaging Het
Clstn2 A T 9: 97,458,204 V705E probably damaging Het
Dagla A G 19: 10,248,425 Y792H probably damaging Het
Dgke A T 11: 89,060,169 C73S probably benign Het
Egflam A G 15: 7,250,028 probably null Het
Farp1 T C 14: 121,233,846 probably null Het
Fos A G 12: 85,476,016 E234G probably benign Het
Gtf3c5 A T 2: 28,577,996 M151K probably benign Het
Hgs G A 11: 120,469,078 R36H probably damaging Het
Lats2 G A 14: 57,700,196 Q279* probably null Het
Lysmd4 T A 7: 67,226,040 D150E probably benign Het
Mex3b A G 7: 82,869,034 K186E probably damaging Het
Myo9a A C 9: 59,924,991 Q2601P probably damaging Het
Nr5a2 A G 1: 136,948,805 V40A probably benign Het
Obscn C A 11: 59,007,708 probably benign Het
Olfr1219 A G 2: 89,074,464 I209T possibly damaging Het
Olfr1389 C A 11: 49,431,251 Y258* probably null Het
Olfr967 A G 9: 39,750,638 N84S probably benign Het
Pclo T A 5: 14,682,255 probably benign Het
Reln T C 5: 21,913,230 I2939V probably benign Het
Rtn4 A T 11: 29,707,256 K470I probably damaging Het
Sbno1 A G 5: 124,386,892 I1050T possibly damaging Het
Scaf11 G T 15: 96,418,641 S17* probably null Het
Scn9a A T 2: 66,533,377 N841K probably damaging Het
Slc35e3 C A 10: 117,740,806 E207* probably null Het
Slc6a20b A G 9: 123,597,312 F503L probably damaging Het
Spag16 G T 1: 69,870,345 K200N probably damaging Het
Supt6 G T 11: 78,226,015 Q604K probably benign Het
Taok1 A G 11: 77,578,724 probably null Het
Tjp1 A T 7: 65,314,755 H889Q probably damaging Het
Tmed6 A T 8: 107,065,651 probably null Het
Tsen54 A T 11: 115,815,061 E68V probably damaging Het
Ttn A G 2: 76,729,534 S21181P probably damaging Het
Ube2cbp A T 9: 86,451,990 M33K possibly damaging Het
Umodl1 C A 17: 30,984,028 Q452K probably benign Het
Wif1 G T 10: 121,099,799 A354S probably benign Het
Wnk2 A G 13: 49,057,016 F1788L possibly damaging Het
Zfhx3 A T 8: 108,946,808 I1497F possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp30 G A 7: 29,792,753 R225Q probably damaging Het
Zfp72 T C 13: 74,372,071 E296G probably damaging Het
Zfp874b A G 13: 67,474,933 F86S possibly damaging Het
Zfyve19 A G 2: 119,211,215 S88G probably benign Het
Other mutations in Nckap5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Nckap5l APN 15 99423127 unclassified probably benign
IGL02568:Nckap5l APN 15 99425683 missense probably damaging 1.00
IGL02615:Nckap5l APN 15 99429382 missense possibly damaging 0.89
IGL02896:Nckap5l APN 15 99427210 missense possibly damaging 0.89
R1931:Nckap5l UTSW 15 99427261 missense probably damaging 1.00
R1969:Nckap5l UTSW 15 99422818 missense probably damaging 1.00
R4434:Nckap5l UTSW 15 99422863 missense probably benign
R4490:Nckap5l UTSW 15 99426130 missense probably benign 0.00
R4606:Nckap5l UTSW 15 99429323 unclassified probably benign
R4817:Nckap5l UTSW 15 99423186 missense probably damaging 1.00
R5008:Nckap5l UTSW 15 99425850 missense possibly damaging 0.68
R5011:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5013:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5503:Nckap5l UTSW 15 99425622 missense probably damaging 1.00
R5627:Nckap5l UTSW 15 99427706 missense possibly damaging 0.69
R5715:Nckap5l UTSW 15 99423576 missense probably benign 0.01
R6000:Nckap5l UTSW 15 99426885 missense probably damaging 1.00
R6072:Nckap5l UTSW 15 99426654 missense probably damaging 1.00
R6104:Nckap5l UTSW 15 99423988 missense probably benign
R6198:Nckap5l UTSW 15 99425988 missense probably damaging 1.00
R6225:Nckap5l UTSW 15 99428024 missense possibly damaging 0.94
R6529:Nckap5l UTSW 15 99426594 missense probably benign 0.27
R6751:Nckap5l UTSW 15 99423161 missense probably damaging 1.00
R6866:Nckap5l UTSW 15 99426468 missense probably benign
R6869:Nckap5l UTSW 15 99426453 missense probably damaging 1.00
R7163:Nckap5l UTSW 15 99433473 missense probably damaging 0.98
R7174:Nckap5l UTSW 15 99424003 missense probably benign 0.09
R7239:Nckap5l UTSW 15 99426209 missense probably damaging 1.00
R7447:Nckap5l UTSW 15 99427476 missense probably damaging 1.00
R7479:Nckap5l UTSW 15 99423246 missense probably damaging 1.00
R7519:Nckap5l UTSW 15 99426247 missense probably benign 0.01
R7554:Nckap5l UTSW 15 99429380 missense probably benign 0.01
R7562:Nckap5l UTSW 15 99423285 splice site probably null
X0062:Nckap5l UTSW 15 99429410 missense probably benign 0.00
Z1177:Nckap5l UTSW 15 99424201 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTGTACACAGCTCAGAGACATC -3'
(R):5'- AACCTTGGACAGTGGCATTGGGAC -3'

Sequencing Primer
(F):5'- GCTCAGAGACATCCATCTCC -3'
(R):5'- GCATTGGGACCTTCCCAC -3'
Posted On2013-07-30