Incidental Mutation 'R0653:Umodl1'
ID 62413
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 038838-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0653 (G1)
Quality Score 118
Status Not validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 31203002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 452 (Q452K)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably benign
Transcript: ENSMUST00000066554
AA Change: Q452K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Q452K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
AA Change: Q452K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Q452K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114555
AA Change: Q452K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Q452K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,066,371 (GRCm39) R612* probably null Het
Adgra1 A G 7: 139,456,063 (GRCm39) T564A probably damaging Het
Akr1c18 A T 13: 4,195,307 (GRCm39) D50E probably damaging Het
Atg9a C A 1: 75,166,972 (GRCm39) L26F probably damaging Het
Atp11b A G 3: 35,893,343 (GRCm39) T899A probably damaging Het
Atxn2 A G 5: 121,910,841 (GRCm39) E358G probably damaging Het
Bmp3 A G 5: 99,019,970 (GRCm39) Y131C probably damaging Het
Brip1 T C 11: 86,043,484 (GRCm39) E360G possibly damaging Het
Casd1 A T 6: 4,608,075 (GRCm39) I76L probably benign Het
Casq2 G A 3: 102,020,482 (GRCm39) probably null Het
Ccdc185 T A 1: 182,575,129 (GRCm39) Q520L possibly damaging Het
Cenpf T C 1: 189,392,183 (GRCm39) K550E probably damaging Het
Ciz1 T C 2: 32,262,418 (GRCm39) S521P probably damaging Het
Clstn2 A T 9: 97,340,257 (GRCm39) V705E probably damaging Het
Dagla A G 19: 10,225,789 (GRCm39) Y792H probably damaging Het
Dgke A T 11: 88,950,995 (GRCm39) C73S probably benign Het
Egflam A G 15: 7,279,509 (GRCm39) probably null Het
Farp1 T C 14: 121,471,258 (GRCm39) probably null Het
Fos A G 12: 85,522,790 (GRCm39) E234G probably benign Het
Gtf3c5 A T 2: 28,468,008 (GRCm39) M151K probably benign Het
Hgs G A 11: 120,359,904 (GRCm39) R36H probably damaging Het
Lats2 G A 14: 57,937,653 (GRCm39) Q279* probably null Het
Lysmd4 T A 7: 66,875,788 (GRCm39) D150E probably benign Het
Mex3b A G 7: 82,518,242 (GRCm39) K186E probably damaging Het
Myo9a A C 9: 59,832,274 (GRCm39) Q2601P probably damaging Het
Nckap5l C A 15: 99,321,127 (GRCm39) V1218F probably damaging Het
Nr5a2 A G 1: 136,876,543 (GRCm39) V40A probably benign Het
Obscn C A 11: 58,898,534 (GRCm39) probably benign Het
Or2y1d C A 11: 49,322,078 (GRCm39) Y258* probably null Het
Or4c114 A G 2: 88,904,808 (GRCm39) I209T possibly damaging Het
Or8g4 A G 9: 39,661,934 (GRCm39) N84S probably benign Het
Pclo T A 5: 14,732,269 (GRCm39) probably benign Het
Reln T C 5: 22,118,228 (GRCm39) I2939V probably benign Het
Rtn4 A T 11: 29,657,256 (GRCm39) K470I probably damaging Het
Sbno1 A G 5: 124,524,955 (GRCm39) I1050T possibly damaging Het
Scaf11 G T 15: 96,316,522 (GRCm39) S17* probably null Het
Scn9a A T 2: 66,363,721 (GRCm39) N841K probably damaging Het
Slc35e3 C A 10: 117,576,711 (GRCm39) E207* probably null Het
Slc6a20b A G 9: 123,426,377 (GRCm39) F503L probably damaging Het
Spag16 G T 1: 69,909,504 (GRCm39) K200N probably damaging Het
Supt6 G T 11: 78,116,841 (GRCm39) Q604K probably benign Het
Taok1 A G 11: 77,469,550 (GRCm39) probably null Het
Tjp1 A T 7: 64,964,503 (GRCm39) H889Q probably damaging Het
Tmed6 A T 8: 107,792,283 (GRCm39) probably null Het
Tsen54 A T 11: 115,705,887 (GRCm39) E68V probably damaging Het
Ttn A G 2: 76,559,878 (GRCm39) S21181P probably damaging Het
Ube3d A T 9: 86,334,043 (GRCm39) M33K possibly damaging Het
Wif1 G T 10: 120,935,704 (GRCm39) A354S probably benign Het
Wnk2 A G 13: 49,210,492 (GRCm39) F1788L possibly damaging Het
Zfhx3 A T 8: 109,673,440 (GRCm39) I1497F possibly damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp30 G A 7: 29,492,178 (GRCm39) R225Q probably damaging Het
Zfp87 T C 13: 74,520,190 (GRCm39) E296G probably damaging Het
Zfp874b A G 13: 67,623,052 (GRCm39) F86S possibly damaging Het
Zfyve19 A G 2: 119,041,696 (GRCm39) S88G probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTGACTGGCTCCCTATTTCAC -3'
(R):5'- ACATACCTTGCACGAATGTCCTCTG -3'

Sequencing Primer
(F):5'- ACATTCCCTTCAAGGACAGTTGG -3'
(R):5'- TCTGCTGGTCAACCTGGAAC -3'
Posted On 2013-07-30