Incidental Mutation 'Z1177:Fign'
ID 624142
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Name fidgetin
Synonyms Fgn
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # Z1177 ()
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 63801852-63928382 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63810034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 412 (G412E)
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
AlphaFold Q9ERZ6
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect probably damaging
Transcript: ENSMUST00000131615
AA Change: G412E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324
AA Change: G412E

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4376 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik C G 3: 68,777,240 (GRCm39) P67R probably damaging Het
1110032F04Rik G T 3: 68,777,605 (GRCm39) V189L probably benign Het
1500011B03Rik C G 5: 114,951,933 (GRCm39) C14S possibly damaging Het
1500011B03Rik G T 5: 114,947,348 (GRCm39) L60I possibly damaging Het
1700011L22Rik G A 8: 79,974,925 (GRCm39) R53W probably damaging Het
1700018B08Rik G T 8: 122,266,721 (GRCm39) P36H probably benign Het
1700024G13Rik T A 14: 32,110,322 (GRCm39) probably benign Het
1700093K21Rik T A 11: 23,468,144 (GRCm39) probably null Het
2700049A03Rik G T 12: 71,211,258 (GRCm39) G664V probably damaging Het
2810021J22Rik C G 11: 58,770,929 (GRCm39) S137C probably damaging Het
3425401B19Rik G T 14: 32,381,765 (GRCm39) T1400K possibly damaging Het
3425401B19Rik G T 14: 32,383,355 (GRCm39) P870H probably damaging Het
4833420G17Rik C A 13: 119,614,344 (GRCm39) T484K not run Het
4921504E06Rik C A 2: 19,485,343 (GRCm39) E441D possibly damaging Het
4921524L21Rik G A 18: 6,635,865 (GRCm39) G306D probably benign Het
4930444P10Rik T A 1: 16,152,246 (GRCm39) probably benign Het
4930516K23Rik C A 7: 103,708,625 (GRCm39) M61I probably damaging Het
4931429L15Rik G A 9: 46,217,136 (GRCm39) S213L probably damaging Het
4933402J07Rik G C 8: 88,312,745 (GRCm39) G177R probably damaging Het
4933405L10Rik C G 8: 106,436,605 (GRCm39) S267C possibly damaging Het
4933405L10Rik A C 8: 106,436,607 (GRCm39) S268R possibly damaging Het
4933436I01Rik G T X: 66,964,598 (GRCm39) P87Q probably damaging Het
5031439G07Rik C G 15: 84,834,843 (GRCm39) E372Q possibly damaging Het
5430401F13Rik T G 6: 131,529,684 (GRCm39) L93V possibly damaging Het
9330161L09Rik C G 12: 103,373,766 (GRCm39) R35S unknown Het
9430015G10Rik A T 4: 156,206,834 (GRCm39) M91L probably benign Het
9630041A04Rik C A 9: 101,820,012 (GRCm39) P144Q probably damaging Het
A1bg G T 15: 60,789,923 (GRCm39) H442N possibly damaging Het
A2ml1 G A 6: 128,538,579 (GRCm39) Q614* probably null Het
A2ml1 C G 6: 128,552,570 (GRCm39) V223L possibly damaging Het
A2ml1 G T 6: 128,522,039 (GRCm39) P1261H probably benign Het
A530016L24Rik G T 12: 112,461,510 (GRCm39) G25W probably damaging Het
A530064D06Rik G A 17: 48,473,674 (GRCm39) S81F probably damaging Het
Aadacl4fm1 C A 4: 144,255,282 (GRCm39) S234* probably null Het
Aadacl4fm1 C G 4: 144,255,070 (GRCm39) Y163* probably null Het
AAdacl4fm3 G C 4: 144,430,216 (GRCm39) L258V possibly damaging Het
Abat G T 16: 8,421,617 (GRCm39) probably null Het
Abca1 C A 4: 53,086,133 (GRCm39) D457Y possibly damaging Het
Abca1 C A 4: 53,079,584 (GRCm39) K881N probably benign Het
Abca1 C A 4: 53,080,799 (GRCm39) V837L probably benign Het
Abca12 C A 1: 71,321,970 (GRCm39) D1707Y probably damaging Het
Abca12 G T 1: 71,331,690 (GRCm39) L1287I probably damaging Het
Abca12 A T 1: 71,315,241 (GRCm39) F1893L possibly damaging Het
Abca13 AGTGCCTTG AG 11: 9,264,545 (GRCm39) probably null Het
Abca14 G T 7: 119,917,210 (GRCm39) R1458S probably damaging Het
Abca3 CGGG CGGGG 17: 24,627,210 (GRCm39) probably null Het
Abca4 G T 3: 121,967,563 (GRCm39) M2204I probably benign Het
Abca4 C A 3: 121,941,435 (GRCm39) H1634Q possibly damaging Het
Abca5 C G 11: 110,170,154 (GRCm39) V1314L probably benign Het
Abcb11 C A 2: 69,159,613 (GRCm39) probably null Het
Abcb11 C A 2: 69,136,873 (GRCm39) G196V probably damaging Het
Abcb1a G T 5: 8,796,544 (GRCm39) Q1171H probably damaging Het
Abcb1b G T 5: 8,887,596 (GRCm39) M827I probably benign Het
Abcb4 C T 5: 8,989,906 (GRCm39) Q820* probably null Het
Abcb6 C T 1: 75,152,769 (GRCm39) G414D probably damaging Het
Abcc1 A C 16: 14,229,357 (GRCm39) Q363P probably damaging Het
Abcc10 C A 17: 46,617,988 (GRCm39) R1095L probably damaging Het
Abcc12 C A 8: 87,254,013 (GRCm39) A924S possibly damaging Het
Abcc2 G A 19: 43,811,539 (GRCm39) W1001* probably null Het
Abcc2 T A 19: 43,792,173 (GRCm39) V318E probably benign Het
Abcc2 G T 19: 43,792,175 (GRCm39) V319L probably benign Het
Abcc3 C A 11: 94,247,834 (GRCm39) G1220W probably damaging Het
Abcc8 A T 7: 45,772,309 (GRCm39) H823Q probably benign Het
Abcc8 C T 7: 45,803,933 (GRCm39) A414T probably benign Het
Abcc9 T A 6: 142,591,664 (GRCm39) Q788L probably null Het
Abcc9 T A 6: 142,540,484 (GRCm39) Q1485L probably damaging Het
Abcc9 C A 6: 142,571,708 (GRCm39) G1140V probably benign Het
Abce1 C A 8: 80,414,098 (GRCm39) V538F probably benign Het
Abcg1 C G 17: 31,325,140 (GRCm39) A322G probably benign Het
Abcg5 C A 17: 84,983,699 (GRCm39) E113D probably benign Het
Abcg8 G T 17: 85,002,458 (GRCm39) E336* probably null Het
Abcg8 C A 17: 85,003,546 (GRCm39) P460T probably damaging Het
Abcg8 A T 17: 84,999,434 (GRCm39) R178W possibly damaging Het
Abhd12 T A 2: 150,746,334 (GRCm39) K45M probably benign Het
Abhd16a G T 17: 35,321,451 (GRCm39) G516V probably damaging Het
Abhd16a G C 17: 35,317,977 (GRCm39) probably null Het
Abi2 G C 1: 60,476,324 (GRCm39) R132P probably damaging Het
Abl2 A T 1: 156,468,676 (GRCm39) R647W probably damaging Het
Abl2 CA C 1: 156,469,123 (GRCm39) probably null Het
Ablim2 C G 5: 35,981,387 (GRCm39) H232D probably damaging Het
Ablim2 GATCGGTCCTA GA 5: 35,998,637 (GRCm39) probably benign Het
Abtb2 G C 2: 103,541,541 (GRCm39) G815R probably damaging Het
Acad12 C T 5: 121,737,257 (GRCm39) probably null Het
Acads C A 5: 115,249,188 (GRCm39) A351S probably benign Het
Acan C T 7: 78,743,918 (GRCm39) P650S probably damaging Het
Acan A C 7: 78,761,102 (GRCm39) H1938P probably benign Het
Acan G A 7: 78,749,885 (GRCm39) G1552E probably damaging Het
Acap1 T A 11: 69,773,269 (GRCm39) T671S probably benign Het
Acap3 G T 4: 155,989,975 (GRCm39) G748C probably damaging Het
Acat3 G T 17: 13,153,770 (GRCm39) Q104K probably damaging Het
Accs C G 2: 93,678,498 (GRCm39) A19P probably benign Het
Ace C A 11: 105,878,960 (GRCm39) L1172M probably damaging Het
Acin1 C T 14: 54,880,207 (GRCm39) R1332Q unknown Het
Aco2 G T 15: 81,779,513 (GRCm39) A106S probably damaging Het
Aco2 T A 15: 81,779,511 (GRCm39) M105K probably damaging Het
Acot5 G T 12: 84,116,668 (GRCm39) R143L probably benign Het
Acox1 C A 11: 116,065,889 (GRCm39) Q503H probably benign Het
Acox1 C A 11: 116,074,371 (GRCm39) E117* probably null Het
Acox1 G T 11: 116,065,891 (GRCm39) Q503K probably benign Het
Acox2 G A 14: 8,256,852 (GRCm38) P4S probably benign Het
Acp3 G T 9: 104,191,617 (GRCm39) P223H probably damaging Het
Acr G A 15: 89,454,082 (GRCm39) E140K possibly damaging Het
Acsbg1 C G 9: 54,529,250 (GRCm39) S321T possibly damaging Het
Acsbg1 C A 9: 54,522,218 (GRCm39) G499C probably damaging Het
Acsbg2 C A 17: 57,160,898 (GRCm39) G249W probably benign Het
Acsbg3 AT ATT 17: 57,190,463 (GRCm39) probably null Het
Acsf3 G T 8: 123,506,703 (GRCm39) probably benign Het
Acsl6 G T 11: 54,210,998 (GRCm39) E24* probably null Het
Acsm1 C A 7: 119,261,501 (GRCm39) L573I probably benign Het
Acsm2 T A 7: 119,177,316 (GRCm39) L277Q probably damaging Het
Acsm4 C A 7: 119,310,594 (GRCm39) H494N probably damaging Het
Acss2 G T 2: 155,359,877 (GRCm39) probably benign Het
Acss3 G C 10: 106,840,638 (GRCm39) F374L probably damaging Het
Acta1 C A 8: 124,620,210 (GRCm39) probably null Het
Actc1 C A 2: 113,877,994 (GRCm39) E363* probably null Het
Actg1 G T 11: 120,238,935 (GRCm39) L52I probably benign Het
Actl9 G T 17: 33,652,087 (GRCm39) G49V probably damaging Het
Actn2 G T 13: 12,303,448 (GRCm39) L451M probably damaging Het
Actn4 T G 7: 28,618,474 (GRCm39) N62T probably damaging Het
Actr5 G A 2: 158,478,625 (GRCm39) V492I probably benign Het
Actr8 G T 14: 29,708,358 (GRCm39) W212L probably damaging Het
Actr8 G T 14: 29,709,199 (GRCm39) V268L probably damaging Het
Actrt3 A T 3: 30,652,152 (GRCm39) L314Q possibly damaging Het
Adam2 C T 14: 66,293,970 (GRCm39) A286T probably damaging Het
Adam26b G T 8: 43,973,735 (GRCm39) S422R probably benign Het
Adam26b G A 8: 43,974,459 (GRCm39) T181I probably benign Het
Adam28 C A 14: 68,864,233 (GRCm39) W523C probably damaging Het
Adam29 A G 8: 56,324,531 (GRCm39) I641T probably damaging Het
Adam30 A T 3: 98,068,295 (GRCm39) T43S probably damaging Het
Adam33 T A 2: 130,900,582 (GRCm39) H86L possibly damaging Het
Adam34l C A 8: 44,079,583 (GRCm39) V214L probably damaging Het
Adam39 C A 8: 41,278,332 (GRCm39) T241K probably benign Het
Adamdec1 G T 14: 68,818,092 (GRCm39) T34K probably benign Het
Adamts10 G T 17: 33,764,568 (GRCm39) R696L probably damaging Het
Adamts10 G C 17: 33,764,403 (GRCm39) E676Q possibly damaging Het
Adamts12 G T 15: 11,336,469 (GRCm39) C1518F not run Het
Adamts12 G A 15: 11,317,410 (GRCm39) C1370Y probably damaging Het
Adamts14 C A 10: 61,034,622 (GRCm39) G1086C possibly damaging Het
Adamts15 G T 9: 30,813,787 (GRCm39) R793S probably damaging Het
Adamts19 G T 18: 58,971,147 (GRCm39) G244C probably damaging Het
Adamts19 G T 18: 59,023,446 (GRCm39) R280S possibly damaging Het
Adamts3 C T 5: 89,923,210 (GRCm39) V199I not run Het
Adamts3 G T 5: 89,855,723 (GRCm39) C382* probably null Het
Adamts5 C A 16: 85,666,962 (GRCm39) G510V probably damaging Het
Adamts9 C A 6: 92,831,327 (GRCm39) G1342V probably damaging Het
Adarb2 C T 13: 8,620,236 (GRCm39) P241S probably benign Het
Adck2 C T 6: 39,551,022 (GRCm39) probably benign Het
Adcy1 A T 11: 7,094,802 (GRCm39) Q576L probably damaging Het
Adcy1 G T 11: 7,050,642 (GRCm39) E287* probably null Het
Adcy10 C A 1: 165,337,845 (GRCm39) T153N possibly damaging Het
Adcy5 G A 16: 35,111,914 (GRCm39) V924M not run Het
Adcy8 G T 15: 64,571,026 (GRCm39) P1236T probably benign Het
Adgrb1 G T 15: 74,413,525 (GRCm39) G570C probably damaging Het
Adgrb1 G T 15: 74,419,532 (GRCm39) W791L probably damaging Het
Adgrb2 G C 4: 129,912,912 (GRCm39) G1313R probably damaging Het
Adgrb2 G T 4: 129,905,619 (GRCm39) D822Y probably damaging Het
Adgre1 G T 17: 57,726,374 (GRCm39) C415F probably damaging Het
Adgre4 A T 17: 56,121,152 (GRCm39) probably null Het
Adgrf1 G C 17: 43,621,038 (GRCm39) G425A probably benign Het
Adgrf5 C T 17: 43,755,944 (GRCm39) P634L probably benign Het
Adgrg1 T A 8: 95,734,258 (GRCm39) C377S probably damaging Het
Adgrv1 C G 13: 81,567,375 (GRCm39) W5266S possibly damaging Het
Adipor2 C A 6: 119,334,283 (GRCm39) G309V possibly damaging Het
Adora1 G C 1: 134,161,862 (GRCm39) H78D possibly damaging Het
Adora1 C A 1: 134,130,747 (GRCm39) R308L probably benign Het
Adora1 G A 1: 134,161,966 (GRCm39) A43V possibly damaging Het
Adora2b G A 11: 62,140,252 (GRCm39) V109I probably benign Het
Adora3 G T 3: 105,815,101 (GRCm39) A284S probably damaging Het
Adprhl1 G C 8: 13,295,476 (GRCm39) H212Q possibly damaging Het
Adrm1 G T 2: 179,817,165 (GRCm39) G279V possibly damaging Het
Adrm1 A T 2: 179,816,708 (GRCm39) S198C unknown Het
Aebp2 G T 6: 140,569,820 (GRCm39) A134S unknown Het
Aen G C 7: 78,552,514 (GRCm39) R158P possibly damaging Het
Afap1l1 C A 18: 61,885,579 (GRCm39) probably null Het
Aff1 G T 5: 103,931,619 (GRCm39) R79L possibly damaging Het
Afm C A 5: 90,669,805 (GRCm39) T44K probably benign Het
Afm C A 5: 90,699,242 (GRCm39) T562K possibly damaging Het
Afm C A 5: 90,679,475 (GRCm39) P323Q probably damaging Het
Afm C A 5: 90,679,365 (GRCm39) N286K probably benign Het
Agbl1 C A 7: 76,369,954 (GRCm39) S936R unknown Het
Agbl3 T G 6: 34,776,343 (GRCm39) F283C probably damaging Het
Agl T A 3: 116,574,685 (GRCm39) I40F Het
Agmat C A 4: 141,474,290 (GRCm39) P57Q possibly damaging Het
Ago1 C A 4: 126,347,449 (GRCm39) W433C probably damaging Het
Agrn C G 4: 156,264,033 (GRCm39) V184L possibly damaging Het
Agrn C A 4: 156,256,001 (GRCm39) E1447* probably null Het
Ahctf1 C G 1: 179,621,295 (GRCm39) A157P probably damaging Het
Ahcyl1 C T 3: 107,580,751 (GRCm39) probably null Het
Ahi1 G T 10: 20,916,906 (GRCm39) probably benign Het
Ahnak G T 19: 8,994,832 (GRCm39) G5372V probably damaging Het
Ahnak2 C A 12: 112,745,822 (GRCm39) G1676V Het
Ahrr T G 13: 74,372,895 (GRCm39) H185P probably benign Het
Ahsg C A 16: 22,717,797 (GRCm39) P337Q probably damaging Het
AI182371 A C 2: 34,985,771 (GRCm39) probably null Het
AI593442 G T 9: 52,589,212 (GRCm39) P122T possibly damaging Het
AI597479 G T 1: 43,150,279 (GRCm39) A130S probably benign Het
Aifm3 G T 16: 17,321,584 (GRCm39) R479L probably benign Het
Aifm3 G T 16: 17,318,798 (GRCm39) G206C probably benign Het
Ajap1 C A 4: 153,516,892 (GRCm39) G150C probably benign Het
Ajap1 C A 4: 153,516,893 (GRCm39) Q149H probably damaging Het
Akap13 G C 7: 75,264,753 (GRCm39) G532A probably benign Het
Akap9 A T 5: 4,096,189 (GRCm39) N2355Y probably damaging Het
Akp3 G T 1: 87,054,167 (GRCm39) probably null Het
Akr1c12 G C 13: 4,322,953 (GRCm39) L219V probably damaging Het
Akr1c20 G T 13: 4,573,243 (GRCm39) S24Y probably benign Het
Alb A T 5: 90,616,371 (GRCm39) Q292L probably damaging Het
Aldh16a1 C A 7: 44,795,327 (GRCm39) G444V probably null Het
Aldh1a2 T A 9: 71,190,804 (GRCm39) V349E probably benign Het
Aldh1b1 G C 4: 45,802,692 (GRCm39) D77H probably damaging Het
Aldh1l1 C A 6: 90,541,431 (GRCm39) A275E probably benign Het
Aldh1l2 G T 10: 83,329,344 (GRCm39) A822D probably damaging Het
Aldh1l2 G A 10: 83,369,869 (GRCm39) R4W probably benign Het
Aldh5a1 C G 13: 25,095,621 (GRCm39) G499R probably damaging Het
Aldh7a1 T A 18: 56,660,063 (GRCm39) T528S probably benign Het
Alg1 G C 16: 5,057,831 (GRCm39) G268R probably benign Het
Alg8 G T 7: 97,020,869 (GRCm39) A9S probably benign Het
Alg9 G C 9: 50,699,473 (GRCm39) G166A probably damaging Het
Alk G T 17: 72,910,058 (GRCm39) S216Y probably damaging Het
Alox12 C A 11: 70,142,305 (GRCm39) G308C possibly damaging Het
Alox8 G A 11: 69,076,047 (GRCm39) R635W probably damaging Het
Alpk1 C A 3: 127,478,956 (GRCm39) W30C Het
Als2cl G A 9: 110,717,596 (GRCm39) G279S probably benign Het
Als2cl C A 9: 110,724,885 (GRCm39) Y786* probably null Het
Alx3 C A 3: 107,512,150 (GRCm39) P263T probably damaging Het
Alx4 G T 2: 93,473,001 (GRCm39) probably benign Het
Ambra1 G T 2: 91,706,131 (GRCm39) W865C probably damaging Het
Ambra1 C A 2: 91,730,953 (GRCm39) N1030K possibly damaging Het
Ambra1 G T 2: 91,599,344 (GRCm39) A155S possibly damaging Het
Amer3 C A 1: 34,626,277 (GRCm39) S172* probably null Het
Amh G C 10: 80,643,420 (GRCm39) E535Q possibly damaging Het
Amot C A X: 144,263,454 (GRCm39) R110S Het
Ampd3 A T 7: 110,387,987 (GRCm39) Q131L probably damaging Het
Amph G C 13: 19,323,504 (GRCm39) D589H possibly damaging Het
Amy1 A T 3: 113,352,002 (GRCm39) W397R probably damaging Het
Amy2a1 C A 3: 113,324,181 (GRCm39) A120S not run Het
Anapc15 G T 7: 101,550,246 (GRCm39) E153D unknown Het
Angptl6 C A 9: 20,789,707 (GRCm39) G62C probably damaging Het
Ank2 T C 3: 126,738,006 (GRCm39) Q2626R unknown Het
Ankk1 C A 9: 49,327,244 (GRCm39) G645V probably damaging Het
Ankk1 G T 9: 49,327,787 (GRCm39) A464E probably damaging Het
Ankra2 G T 13: 98,408,785 (GRCm39) V263L possibly damaging Het
Ankrd11 C A 8: 123,626,881 (GRCm39) Q100H probably damaging Het
Ankrd17 C T 5: 90,437,184 (GRCm39) A554T possibly damaging Het
Ankrd17 C A 5: 90,431,364 (GRCm39) A807S possibly damaging Het
Ankrd2 G T 19: 42,033,438 (GRCm39) A327S Het
Ankrd2 A G 19: 42,028,598 (GRCm39) I85V Het
Ankrd22 CT CTT 19: 34,100,891 (GRCm39) probably null Het
Ankrd26 C T 6: 118,500,556 (GRCm39) E972K probably damaging Het
Ankrd26 C A 6: 118,500,493 (GRCm39) A993S possibly damaging Het
Ankrd27 G T 7: 35,303,303 (GRCm39) V228L possibly damaging Het
Ankrd33b C A 15: 31,305,279 (GRCm39) probably null Het
Ankrd35 G T 3: 96,591,086 (GRCm39) Q457H probably damaging Het
Ankrd36 C A 11: 5,593,738 (GRCm39) P448T probably damaging Het
Ankrd36 G A 11: 5,579,345 (GRCm39) S203N probably benign Het
Ankrd36 G T 11: 5,521,117 (GRCm39) W88C probably damaging Het
Ankrd45 G T 1: 160,988,322 (GRCm39) K193N possibly damaging Het
Ankrd45 G T 1: 160,988,308 (GRCm39) G189W probably damaging Het
Ankrd50 C G 3: 38,509,941 (GRCm39) A809P probably damaging Het
Ankrd53 C G 6: 83,742,765 (GRCm39) L253V possibly damaging Het
Ankrd7 G A 6: 18,866,563 (GRCm39) A28T possibly damaging Het
Ano2 G T 6: 125,990,170 (GRCm39) A764S probably damaging Het
Ano2 G A 6: 125,992,610 (GRCm39) G861E probably damaging Het
Ano7 C A 1: 93,329,249 (GRCm39) A681E probably damaging Het
Antxrl TC T 14: 33,789,887 (GRCm39) probably null Het
Anxa11 G T 14: 25,870,600 (GRCm39) G55C unknown Het
Anxa2r1 C T 13: 120,496,488 (GRCm39) C127Y possibly damaging Het
Aopep G T 13: 63,318,804 (GRCm39) R537L probably damaging Het
Aox1 C A 1: 58,393,556 (GRCm39) P1239T possibly damaging Het
Ap1s1 C A 5: 137,074,087 (GRCm39) probably benign Het
Ap2b1 G T 11: 83,256,579 (GRCm39) G713V probably damaging Het
Ap3m2 C T 8: 23,281,337 (GRCm39) S312N probably benign Het
Ap5b1 G T 19: 5,620,956 (GRCm39) G792V probably damaging Het
Apba2 G T 7: 64,399,983 (GRCm39) V725L probably benign Het
Apbb1ip G T 2: 22,765,115 (GRCm39) A599S unknown Het
Apc G T 18: 34,447,516 (GRCm39) V1471L probably benign Het
Apc2 C A 10: 80,147,870 (GRCm39) R975S probably damaging Het
Apcdd1 G T 18: 63,055,762 (GRCm39) G10* probably null Het
Aplp1 C A 7: 30,137,614 (GRCm39) R482L probably benign Het
Aplp1 T A 7: 30,137,704 (GRCm39) probably null Het
Apoa5 G A 9: 46,180,417 (GRCm39) A8T possibly damaging Het
Apob C A 12: 8,038,765 (GRCm39) L406I probably benign Het
Apob GCC GC 12: 8,065,249 (GRCm39) probably null Het
Apobec4 G T 1: 152,632,477 (GRCm39) W168C probably damaging Het
Apod C T 16: 31,116,338 (GRCm39) V131M probably damaging Het
Apol11b A C 15: 77,522,207 (GRCm39) I30R probably benign Het
Aqp4 C G 18: 15,532,938 (GRCm39) G52R possibly damaging Het
Arcn1 C G 9: 44,668,550 (GRCm39) G229R probably damaging Het
Arf6 G T 12: 69,419,181 (GRCm39) probably benign Het
Arfgap2 C T 2: 91,105,449 (GRCm39) S468L probably benign Het
Arfgap3 C A 15: 83,216,889 (GRCm39) E159* probably null Het
Arfgef3 A C 10: 18,483,524 (GRCm39) I1400S probably damaging Het
Arfgef3 C A 10: 18,503,376 (GRCm39) V1010L probably damaging Het
Arhgap20 C A 9: 51,736,224 (GRCm39) L179I probably damaging Het
Arhgap30 A C 1: 171,235,476 (GRCm39) K617Q probably benign Het
Arhgap32 G T 9: 32,171,976 (GRCm39) Q1585H probably damaging Het
Arhgap33 C G 7: 30,222,242 (GRCm39) R1230P probably damaging Het
Arhgef10l C A 4: 140,244,083 (GRCm39) R852L probably benign Het
Arhgef16 G T 4: 154,365,910 (GRCm39) S501Y probably damaging Het
Arhgef26 C A 3: 62,247,351 (GRCm39) T145N probably benign Het
Arhgef28 C A 13: 98,036,264 (GRCm39) G1665V probably benign Het
Arhgef33 G T 17: 80,691,659 (GRCm39) G50V unknown Het
Arhgef38 C A 3: 132,912,722 (GRCm39) E106* probably null Het
Arhgef4 A G 1: 34,762,447 (GRCm39) S568G unknown Het
Arhgef4 C G 1: 34,762,002 (GRCm39) S419R unknown Het
Arhgef4 C G 1: 34,763,340 (GRCm39) S865R probably benign Het
Arhgef6 C A X: 56,349,984 (GRCm39) probably benign Het
Arid1a C A 4: 133,408,227 (GRCm39) W1708C unknown Het
Arid1b G T 17: 5,046,603 (GRCm39) A464S possibly damaging Het
Arid2 A C 15: 96,288,867 (GRCm39) Q1672P probably damaging Het
Arid3a A C 10: 79,785,264 (GRCm39) Q344P probably damaging Het
Arid3c C A 4: 41,730,177 (GRCm39) R6M possibly damaging Het
Arid4a G A 12: 71,122,411 (GRCm39) E931K possibly damaging Het
Arid5b C T 10: 67,933,058 (GRCm39) R948Q probably damaging Het
Arl11 CA CAA 14: 61,548,317 (GRCm39) probably null Het
Armc1 G T 3: 19,203,738 (GRCm39) L63I probably benign Het
Armc3 C A 2: 19,290,802 (GRCm39) T427K probably benign Het
Armc5 G T 7: 127,839,797 (GRCm39) G372C probably damaging Het
Armc5 G T 7: 127,843,835 (GRCm39) R876L probably damaging Het
Armc5 C A 7: 127,840,002 (GRCm39) T440N probably damaging Het
Armc8 C T 9: 99,379,439 (GRCm39) A496T probably damaging Het
Armc9 G C 1: 86,124,077 (GRCm39) R417P probably benign Het
Armc9 G C 1: 86,104,547 (GRCm39) E265D probably damaging Het
Armcx4 C A X: 133,593,791 (GRCm39) A1233D not run Het
Armcx6 C A X: 133,650,741 (GRCm39) G30V probably damaging Het
Arnt2 G A 7: 83,912,415 (GRCm39) T575I possibly damaging Het
Arsj G T 3: 126,232,558 (GRCm39) G435C probably damaging Het
Art3 C G 5: 92,560,065 (GRCm39) L75V unknown Het
Art4 G T 6: 136,826,581 (GRCm39) P299T probably damaging Het
Arvcf T A 16: 18,207,164 (GRCm39) L41Q probably damaging Het
Asb14 T C 14: 26,634,256 (GRCm39) V487A probably benign Het
Asb3 C G 11: 31,008,965 (GRCm39) P250A possibly damaging Het
Ascc3 A T 10: 50,594,517 (GRCm39) H1204L probably benign Het
Asic2 G A 11: 81,043,066 (GRCm39) R76C possibly damaging Het
Asic2 G C 11: 80,784,837 (GRCm39) I367M possibly damaging Het
Asic2 G T 11: 81,042,916 (GRCm39) R126S probably benign Het
Asic4 A T 1: 75,445,864 (GRCm39) Q231L probably benign Het
Aspdh G T 7: 44,114,954 (GRCm39) R20L probably damaging Het
Aspg G A 12: 112,087,455 (GRCm39) V304M probably damaging Het
Asprv1 C A 6: 86,605,326 (GRCm39) S57R probably damaging Het
Asxl2 A C 12: 3,524,589 (GRCm39) S206R probably damaging Het
Asxl3 G T 18: 22,649,396 (GRCm39) V462L probably benign Het
Asxl3 C G 18: 22,656,648 (GRCm39) R1553G probably damaging Het
Atf7ip2 A T 16: 10,059,504 (GRCm39) Q348L possibly damaging Het
Atg2b C A 12: 105,602,023 (GRCm39) R1651L probably damaging Het
Atg9b C T 5: 24,596,785 (GRCm39) G44R probably benign Het
Atl3 G T 19: 7,507,918 (GRCm39) A357S probably benign Het
Atn1 C A 6: 124,721,998 (GRCm39) G952C unknown Het
Atoh8 C A 6: 72,212,110 (GRCm39) K13N probably damaging Het
Atp10b G C 11: 43,044,176 (GRCm39) G134A probably benign Het
Atp11b G T 3: 35,861,003 (GRCm39) M363I probably benign Het
Atp12a C A 14: 56,610,672 (GRCm39) T272K probably damaging Het
Atp13a5 C A 16: 29,099,787 (GRCm39) W761C probably damaging Het
Atp1a2 G T 1: 172,114,903 (GRCm39) T294K probably damaging Het
Atp1a3 C A 7: 24,679,544 (GRCm39) V904L probably benign Het
Atp1b3 C A 9: 96,215,613 (GRCm39) L267F probably damaging Het
Atp2a3 C G 11: 72,871,153 (GRCm39) S582R possibly damaging Het
Atp2b1 G T 10: 98,854,710 (GRCm39) R1101L probably damaging Het
Atp2c2 C A 8: 120,461,124 (GRCm39) T239N probably benign Het
Atp4a G T 7: 30,417,265 (GRCm39) Q549H possibly damaging Het
Atp4b GGTTCCAACAGTAGT GGT 8: 13,446,684 (GRCm39) probably benign Het
Atp4b C A 8: 13,439,794 (GRCm39) A143S probably benign Het
Atp7b C A 8: 22,484,893 (GRCm39) R1388L probably benign Het
Atp8a2 C A 14: 60,243,779 (GRCm39) R642L possibly damaging Het
Atp8b3 A T 10: 80,366,911 (GRCm39) V229E probably benign Het
Atp8b4 T A 2: 126,164,744 (GRCm39) T1191S probably benign Het
Atp8b4 A T 2: 126,275,863 (GRCm39) L123Q probably damaging Het
Atp8b5 T A 4: 43,370,669 (GRCm39) L982I probably benign Het
Atr A T 9: 95,770,153 (GRCm39) R1194S probably benign Het
Atrn G T 2: 130,787,962 (GRCm39) G255C probably damaging Het
Atxn7l3b T A 10: 112,764,359 (GRCm39) Q90L possibly damaging Het
Atxn7l3b C G 10: 112,764,384 (GRCm39) G82R probably damaging Het
AU040320 G C 4: 126,736,426 (GRCm39) Q836H probably benign Het
Aup1 A G 6: 83,034,505 (GRCm39) E437G unknown Het
Axin2 G T 11: 108,814,300 (GRCm39) G63W probably damaging Het
Axl C A 7: 25,460,951 (GRCm39) G686V probably damaging Het
B020004C17Rik C T 14: 57,252,717 (GRCm39) Q2* probably null Het
B3galt1 G T 2: 67,948,334 (GRCm39) W16C probably damaging Het
B3galt4 C A 17: 34,170,110 (GRCm39) A43S unknown Het
B3galt5 G C 16: 96,117,232 (GRCm39) Q288H probably benign Het
B3galt5 C A 16: 96,116,579 (GRCm39) R71S probably damaging Het
B3gntl1 C T 11: 121,530,640 (GRCm39) D144N probably benign Het
B4galt2 C A 4: 117,738,266 (GRCm39) M113I probably benign Het
Babam1 G T 8: 71,852,207 (GRCm39) V132F probably benign Het
Bag6 A C 17: 35,361,900 (GRCm39) Q510P unknown Het
Bahcc1 G A 11: 120,163,747 (GRCm39) V682M possibly damaging Het
Baz2b C G 2: 59,807,864 (GRCm39) A132P probably benign Het
Bbox1 C A 2: 110,100,533 (GRCm39) K221N probably benign Het
Bbs5 G A 2: 69,495,415 (GRCm39) V288M probably benign Het
Bbs7 C T 3: 36,657,069 (GRCm39) G253E probably damaging Het
BC016579 C A 16: 45,469,259 (GRCm39) V70F possibly damaging Het
BC051019 G T 7: 109,319,847 (GRCm39) P72Q probably benign Het
Bcam C A 7: 19,494,032 (GRCm39) A420S probably null Het
Bcar3 G C 3: 122,298,667 (GRCm39) R144P probably damaging Het
Bcl11b C A 12: 107,955,999 (GRCm39) G50V probably damaging Het
Bcl2a1a G T 9: 88,839,519 (GRCm39) G139V probably damaging Het
Bcl2a1c A C 9: 114,159,536 (GRCm39) T105P probably benign Het
Bcl2l11 G T 2: 127,989,113 (GRCm39) R164M probably damaging Het
Bcl2l11 C G 2: 127,970,915 (GRCm39) N121K probably damaging Het
Bdh1 C T 16: 31,273,993 (GRCm39) A186V possibly damaging Het
Bdh1 A G 16: 31,273,995 (GRCm39) K187E possibly damaging Het
Bdp1 T A 13: 100,197,904 (GRCm39) K827M probably damaging Het
Best1 G C 19: 9,970,603 (GRCm39) S79C probably damaging Het
Bfar G T 16: 13,506,674 (GRCm39) V175L probably benign Het
Bid C T 6: 120,877,219 (GRCm39) E41K probably damaging Het
Birc6 G T 17: 74,954,275 (GRCm39) A3376S probably benign Het
Bltp1 A T 3: 37,090,856 (GRCm39) S782C Het
Bltp1 G C 3: 36,974,099 (GRCm39) M616I probably benign Het
Bltp1 G C 3: 37,037,589 (GRCm39) M2463I possibly damaging Het
Bltp3a C T 17: 28,103,940 (GRCm39) R447W not run Het
Bltp3b C T 10: 89,647,934 (GRCm39) S1332F possibly damaging Het
Bmp2k G T 5: 97,201,015 (GRCm39) A312S probably damaging Het
Bmpr2 G A 1: 59,886,326 (GRCm39) R321Q not run Het
Bnc1 C A 7: 81,618,218 (GRCm39) R949L probably damaging Het
Bpifa3 C G 2: 153,978,212 (GRCm39) T138R possibly damaging Het
Bpifb3 C T 2: 153,767,709 (GRCm39) P261S probably benign Het
Bpnt1 G A 1: 185,084,466 (GRCm39) G188R probably damaging Het
Brd2 C A 17: 34,335,882 (GRCm39) probably benign Het
Brd2 C A 17: 34,335,881 (GRCm39) probably null Het
Brinp2 C A 1: 158,074,352 (GRCm39) V590L possibly damaging Het
Brpf3 G T 17: 29,040,452 (GRCm39) D958Y probably benign Het
Brsk1 G C 7: 4,707,221 (GRCm39) C258S probably damaging Het
Bsn G C 9: 108,016,394 (GRCm39) L206V probably damaging Het
Bsn C T 9: 107,982,698 (GRCm39) R913H Het
Bst1 C A 5: 43,976,374 (GRCm39) P36T probably damaging Het
Btbd10 C G 7: 112,931,896 (GRCm39) V169L probably benign Het
Btbd18 G T 2: 84,491,912 (GRCm39) G31V probably damaging Het
Btbd7 C T 12: 102,777,379 (GRCm39) E483K probably damaging Het
Btla C A 16: 45,059,635 (GRCm39) P113Q possibly damaging Het
Btnl2 G T 17: 34,582,493 (GRCm39) R353L probably benign Het
Btnl4 C A 17: 34,689,034 (GRCm39) probably null Het
Bud13 G C 9: 46,203,038 (GRCm39) R487P probably damaging Het
C1qb C A 4: 136,609,592 (GRCm39) W9C probably benign Het
C1qtnf1 G C 11: 118,334,580 (GRCm39) W20S probably benign Het
C1qtnf12 G T 4: 156,050,106 (GRCm39) R202L probably damaging Het
C1qtnf4 G T 2: 90,719,849 (GRCm39) G41C probably damaging Het
C1s2 G T 6: 124,602,693 (GRCm39) A506D possibly damaging Het
C2cd4b C G 9: 67,667,081 (GRCm39) P26A probably damaging Het
C2cd5 C A 6: 142,974,932 (GRCm39) E820D probably null Het
C3 G T 17: 57,533,171 (GRCm39) S144Y probably damaging Het
C3 G A 17: 57,524,144 (GRCm39) A964V probably benign Het
C7 C T 15: 5,044,857 (GRCm39) D394N probably benign Het
C9 C A 15: 6,521,000 (GRCm39) P482T probably damaging Het
Cabin1 C T 10: 75,483,957 (GRCm39) A2043T probably benign Het
Cables1 G T 18: 12,074,374 (GRCm39) G525V probably damaging Het
Cabp4 G T 19: 4,186,221 (GRCm39) L227M probably damaging Het
Cacna1a C A 8: 85,306,120 (GRCm39) D1289E probably damaging Het
Cacna1b G T 2: 24,551,802 (GRCm39) P1115H probably damaging Het
Cacna1b T G 2: 24,528,689 (GRCm39) M1609L probably damaging Het
Cacna1b G T 2: 24,569,000 (GRCm39) H975N probably damaging Het
Cacna1c G T 6: 118,734,622 (GRCm39) probably benign Het
Cacna1e G T 1: 154,318,038 (GRCm39) A1448E probably damaging Het
Cacna1g C A 11: 94,364,416 (GRCm39) A10S probably benign Het
Cacna1g C A 11: 94,350,422 (GRCm39) Q474H probably benign Het
Cacna1h T A 17: 25,610,352 (GRCm39) E718V probably damaging Het
Cacna1h C A 17: 25,594,866 (GRCm39) E2097D probably damaging Het
Cacna1h C A 17: 25,612,558 (GRCm39) W380L probably benign Het
Cacna1i G T 15: 80,273,584 (GRCm39) G1757C possibly damaging Het
Cacna1i G T 15: 80,265,380 (GRCm39) R1544L possibly damaging Het
Cacna1s G C 1: 136,045,424 (GRCm39) A1691P probably benign Het
Cacna2d3 A C 14: 29,069,120 (GRCm39) D232E possibly damaging Het
Cad G T 5: 31,225,765 (GRCm39) G1017V probably damaging Het
Cad G T 5: 31,232,472 (GRCm39) D1846Y probably benign Het
Cadps C G 14: 12,465,880 (GRCm38) R1010P probably damaging Het
Cadps2 C G 6: 23,626,694 (GRCm39) S198T probably damaging Het
Cadps2 A T 6: 23,385,477 (GRCm39) L782I possibly damaging Het
Cadps2 G T 6: 23,838,817 (GRCm39) P107H probably damaging Het
Calcb G T 7: 114,321,397 (GRCm39) probably null Het
Calhm5 C A 10: 33,972,325 (GRCm39) V37L probably damaging Het
Calm4 G C 13: 3,888,199 (GRCm39) V102L possibly damaging Het
Calml3 C A 13: 3,854,011 (GRCm39) D18Y probably damaging Het
Caln1 C A 5: 130,868,155 (GRCm39) C230* probably null Het
Calr4 G T 4: 109,092,930 (GRCm39) W3C probably benign Het
Calu G T 6: 29,372,514 (GRCm39) V230L probably damaging Het
Camta1 A T 4: 151,162,382 (GRCm39) L454Q probably damaging Het
Camta2 C A 11: 70,566,047 (GRCm39) G746* probably null Het
Capg G A 6: 72,533,213 (GRCm39) C166Y probably damaging Het
Capn12 T A 7: 28,587,253 (GRCm39) W380R probably damaging Het
Capn15 T A 17: 26,192,194 (GRCm39) H16L probably benign Het
Capn8 G T 1: 182,440,911 (GRCm39) E448D probably benign Het
Caprin1 C G 2: 103,606,279 (GRCm39) E320D probably null Het
Car12 C A 9: 66,659,236 (GRCm39) P39Q probably benign Het
Car3 G T 3: 14,936,696 (GRCm39) R253M Het
Car4 C G 11: 84,854,245 (GRCm39) P64R possibly damaging Het
Car5a C T 8: 122,643,112 (GRCm39) M297I probably benign Het
Car8 G C 4: 8,221,594 (GRCm39) R126G probably damaging Het
Card10 G T 15: 78,679,528 (GRCm39) P307T probably benign Het
Card11 T A 5: 140,883,996 (GRCm39) I428F probably benign Het
Card14 C A 11: 119,231,887 (GRCm39) H818Q probably damaging Het
Card9 G C 2: 26,247,563 (GRCm39) R241G probably damaging Het
Carf A C 1: 60,175,421 (GRCm39) probably null Het
Casd1 G T 6: 4,631,531 (GRCm39) W549L possibly damaging Het
Caskin1 T A 17: 24,715,661 (GRCm39) C142S probably damaging Het
Caskin2 C T 11: 115,697,607 (GRCm39) A110T possibly damaging Het
Cass4 C T 2: 172,269,495 (GRCm39) Q526* probably null Het
Cast C A 13: 74,873,582 (GRCm39) K402N probably damaging Het
Casz1 T C 4: 149,028,816 (GRCm39) L1087P probably benign Het
Casz1 C A 4: 149,017,763 (GRCm39) P351T probably damaging Het
Catsper1 A T 19: 5,393,911 (GRCm39) Q641L probably damaging Het
Catsperb G C 12: 101,412,307 (GRCm39) W131C probably damaging Het
Catspere2 G T 1: 177,984,368 (GRCm39) probably benign Het
Catsperg2 A T 7: 29,397,207 (GRCm39) W1099R possibly damaging Het
Cbarp G T 10: 79,968,894 (GRCm39) P367T probably damaging Het
Cbarp G C 10: 79,967,706 (GRCm39) R512G probably damaging Het
Cbfa2t3 G A 8: 123,357,496 (GRCm39) P605S probably benign Het
Cblc T G 7: 19,519,203 (GRCm39) D419A probably benign Het
Cbr1b C A 16: 93,426,820 (GRCm39) S140R probably damaging Het
Cbr2 G C 11: 120,621,105 (GRCm39) A164G possibly damaging Het
Cbs C G 17: 31,844,856 (GRCm39) probably null Het
Cbx4 C T 11: 118,976,592 (GRCm39) W35* probably null Het
Cbx7 G T 15: 79,818,085 (GRCm39) L6M unknown Het
Cc2d2a C T 5: 43,860,546 (GRCm39) P541S probably benign Het
Ccdc121rt1 G A 1: 181,338,304 (GRCm39) T216M probably damaging Het
Ccdc121rt2 TACACA TACA 5: 112,598,827 (GRCm39) probably null Het
Ccdc121rt2 C A 5: 112,597,872 (GRCm39) L140M probably damaging Het
Ccdc121rt3 G C 5: 112,502,784 (GRCm39) H307D probably damaging Het
Ccdc14 G C 16: 34,544,040 (GRCm39) K847N probably damaging Het
Ccdc141 G T 2: 76,845,493 (GRCm39) S1191R probably benign Het
Ccdc157 G A 11: 4,096,547 (GRCm39) Q503* probably null Het
Ccdc162 G T 10: 41,559,191 (GRCm39) A136D probably benign Het
Ccdc170 A C 10: 4,459,884 (GRCm39) T5P probably benign Het
Ccdc177 G T 12: 80,804,510 (GRCm39) A588E unknown Het
Ccdc178 G T 18: 22,242,788 (GRCm39) R276S possibly damaging Het
Ccdc185 G T 1: 182,576,079 (GRCm39) N203K possibly damaging Het
Ccdc191 G C 16: 43,759,485 (GRCm39) E429Q possibly damaging Het
Ccdc202 C A 14: 96,119,566 (GRCm39) P108T probably benign Het
Ccdc25 A T 14: 66,102,577 (GRCm39) probably null Het
Ccdc27 C A 4: 154,120,928 (GRCm39) M289I unknown Het
Ccdc33 G T 9: 58,025,868 (GRCm39) Q54K possibly damaging Het
Ccdc38 C A 10: 93,398,738 (GRCm39) S172Y probably damaging Het
Ccdc40 C T 11: 119,145,224 (GRCm39) S973L probably benign Het
Ccdc40 C G 11: 119,128,933 (GRCm39) R390G probably damaging Het
Ccdc60 C A 5: 116,426,768 (GRCm39) probably benign Het
Ccdc68 G T 18: 70,080,121 (GRCm39) probably null Het
Ccdc71l G C 12: 32,429,614 (GRCm39) R211P possibly damaging Het
Ccdc73 C A 2: 104,822,584 (GRCm39) C16* probably null Het
Ccdc7a C A 8: 129,534,405 (GRCm39) R1357L possibly damaging Het
Ccdc81 T A 7: 89,530,865 (GRCm39) Q359L probably damaging Het
Ccdc85a C A 11: 28,533,491 (GRCm39) A18S probably benign Het
Ccdc88c G T 12: 100,911,414 (GRCm39) H807N probably benign Het
Ccdc90b G A 7: 92,217,765 (GRCm39) M102I possibly damaging Het
Cchcr1 G T 17: 35,839,560 (GRCm39) Q532H probably damaging Het
Ccin G T 4: 43,984,902 (GRCm39) K436N probably benign Het
Ccl17 G T 8: 95,537,817 (GRCm39) R35L possibly damaging Het
Ccn1 C A 3: 145,354,410 (GRCm39) S167I probably benign Het
Ccna2 C A 3: 36,625,850 (GRCm39) Q41H probably benign Het
Ccnt2 G T 1: 127,730,795 (GRCm39) K557N probably damaging Het
Ccny T G 18: 9,353,494 (GRCm39) Q93P probably benign Het
Ccr4 C G 9: 114,321,907 (GRCm39) G53R probably damaging Het
Ccr8 C G 9: 119,923,565 (GRCm39) L227V probably benign Het
Cct7 G T 6: 85,443,651 (GRCm39) D340Y possibly damaging Het
Cd101 G T 3: 100,924,456 (GRCm39) Q328K probably benign Het
Cd101 A C 3: 100,919,232 (GRCm39) D627E probably benign Het
Cd109 G T 9: 78,598,595 (GRCm39) Q944H probably damaging Het
Cd163 G A 6: 124,294,344 (GRCm39) V501I probably benign Het
Cd177 C A 7: 24,459,681 (GRCm39) G11W probably damaging Het
Cd180 C A 13: 102,842,540 (GRCm39) H529N possibly damaging Het
Cd2 G C 3: 101,183,422 (GRCm39) R296G probably damaging Het
Cd200 C A 16: 45,215,051 (GRCm39) R200L possibly damaging Het
Cd209e T A 8: 3,901,181 (GRCm39) S158C probably null Het
Cd244a T A 1: 171,401,918 (GRCm39) C215S probably damaging Het
Cd248 G C 19: 5,119,193 (GRCm39) G347A probably damaging Het
Cd6 G C 19: 10,768,809 (GRCm39) R503G probably damaging Het
Cd8a G T 6: 71,351,577 (GRCm39) R179L possibly damaging Het
Cdc42bpg A T 19: 6,359,776 (GRCm39) E119V probably damaging Het
Cdc42bpg C A 19: 6,364,552 (GRCm39) N593K possibly damaging Het
Cdc42bpg G A 19: 6,364,553 (GRCm39) G594S probably damaging Het
Cdc42ep2 C A 19: 5,968,136 (GRCm39) D190Y probably damaging Het
Cdc42ep2 G A 19: 5,968,673 (GRCm39) R11C probably damaging Het
Cdc42ep3 C A 17: 79,642,307 (GRCm39) M204I probably benign Het
Cdc42ep3 C A 17: 79,642,327 (GRCm39) D198Y probably damaging Het
Cdca2 C A 14: 67,917,693 (GRCm39) K568N probably damaging Het
Cdcp3 G T 7: 130,867,595 (GRCm39) V1419F unknown Het
Cdh1 G A 8: 107,383,471 (GRCm39) V237M probably damaging Het
Cdh16 T G 8: 105,350,072 (GRCm39) probably null Het
Cdh22 C A 2: 164,988,600 (GRCm39) G252C probably damaging Het
Cdh23 T A 10: 60,270,393 (GRCm39) probably null Het
Cdh23 C A 10: 60,159,334 (GRCm39) R2149L possibly damaging Het
Cdh4 C A 2: 179,422,119 (GRCm39) A81E probably benign Het
Cdh9 C T 15: 16,850,450 (GRCm39) P528S probably benign Het
Cdhr17 G T 5: 17,061,722 (GRCm39) D823Y probably damaging Het
Cdhr17 C A 5: 17,040,977 (GRCm39) H591Q possibly damaging Het
Cdhr18 G T 14: 13,845,421 (GRCm38) P497Q Het
Cdhr18 G T 14: 13,823,754 (GRCm38) T807N Het
Cdhr2 C A 13: 54,863,484 (GRCm39) P122T probably damaging Het
Cdhr2 A T 13: 54,874,221 (GRCm39) R764S probably benign Het
Cdhr2 G T 13: 54,866,377 (GRCm39) C361F probably damaging Het
Cdipt A T 7: 126,576,116 (GRCm39) I24F probably benign Het
Cdk14 C A 5: 4,938,894 (GRCm39) G461W possibly damaging Het
Cdk5rap3 C G 11: 96,803,042 (GRCm39) probably null Het
Cdk8 G A 5: 146,236,605 (GRCm39) R340K probably damaging Het
Cdk8 G T 5: 146,238,447 (GRCm39) S379I probably benign Het
Cdk8 A T 5: 146,236,606 (GRCm39) R340S probably damaging Het
Cdkl4 G T 17: 80,858,287 (GRCm39) L111I probably damaging Het
Cdkl5 C A X: 159,607,041 (GRCm39) V736F probably benign Het
Cdkn1c C A 7: 143,014,053 (GRCm39) G131V probably damaging Het
Cdnf G A 2: 3,522,120 (GRCm39) S104N possibly damaging Het
Cdon G T 9: 35,403,196 (GRCm39) C1102F probably damaging Het
Cdyl G C 13: 36,000,053 (GRCm39) R111S probably benign Het
Ceacam12 G C 7: 17,801,440 (GRCm39) V140L probably damaging Het
Ceacam19 G T 7: 19,616,769 (GRCm39) A175D probably damaging Het
Ceacam19 G T 7: 19,620,374 (GRCm39) P86T probably damaging Het
Ceacam20 G A 7: 19,704,089 (GRCm39) probably null Het
Cebpe C A 14: 54,948,037 (GRCm39) E269* probably null Het
Cecr2 C A 6: 120,697,923 (GRCm39) T74K probably damaging Het
Cela3b G T 4: 137,155,795 (GRCm39) H37Q probably damaging Het
Celf1 G T 2: 90,835,050 (GRCm39) C177F possibly damaging Het
Celsr1 A C 15: 85,863,052 (GRCm39) C1327G probably damaging Het
Celsr2 C T 3: 108,319,536 (GRCm39) R1092Q probably damaging Het
Celsr2 C T 3: 108,320,887 (GRCm39) V642I probably benign Het
Celsr3 C A 9: 108,703,676 (GRCm39) A53E probably benign Het
Cemip C A 7: 83,596,504 (GRCm39) G1087C probably damaging Het
Cemip2 G C 19: 21,833,093 (GRCm39) G1308R probably damaging Het
Cenpe G C 3: 134,922,146 (GRCm39) V68L possibly damaging Het
Cenpj C G 14: 56,790,336 (GRCm39) R571P possibly damaging Het
Cep128 C A 12: 91,256,377 (GRCm39) M364I probably benign Het
Cep128 C A 12: 91,331,145 (GRCm39) A75S probably damaging Het
Cep131 C A 11: 119,956,541 (GRCm39) G936W probably damaging Het
Cep135 A T 5: 76,739,673 (GRCm39) Q23L probably damaging Het
Cep152 C A 2: 125,456,244 (GRCm39) V256F probably benign Het
Cep152 C T 2: 125,461,624 (GRCm39) V151M probably damaging Het
Cep162 C A 9: 87,082,033 (GRCm39) probably null Het
Cep250 A T 2: 155,818,387 (GRCm39) Q854L probably benign Het
Cep290 G T 10: 100,374,859 (GRCm39) K1368N possibly damaging Het
Cep290 G A 10: 100,333,806 (GRCm39) R286Q probably benign Het
Cep295 C A 9: 15,242,113 (GRCm39) D46Y Het
Cep89 G T 7: 35,096,506 (GRCm39) probably benign Het
Ces1b T A 8: 93,802,782 (GRCm39) T103S probably benign Het
Ces1h T A 8: 94,093,468 (GRCm39) probably null Het
Ces2b AGG AG 8: 105,559,227 (GRCm39) probably null Het
Ces2f G T 8: 105,674,867 (GRCm39) G90W probably damaging Het
Ces2g C A 8: 105,690,593 (GRCm39) L125M probably damaging Het
Ces3b G T 8: 105,811,715 (GRCm39) R77L probably damaging Het
Cfap157 A C 2: 32,668,219 (GRCm39) L407R probably damaging Het
Cfap20dc G A 14: 8,517,953 (GRCm38) Q289* probably null Het
Cfap221 C G 1: 119,912,473 (GRCm39) R138P probably damaging Het
Cfap299 C A 5: 98,949,693 (GRCm39) S209Y probably damaging Het
Cfap44 G T 16: 44,252,407 (GRCm39) V839L probably benign Het
Cfap46 T A 7: 139,181,183 (GRCm39) Q2606L unknown Het
Cfap46 G T 7: 139,210,542 (GRCm39) P1768Q unknown Het
Cfap53 A T 18: 74,438,623 (GRCm39) K267* probably null Het
Cfap54 G T 10: 92,814,888 (GRCm39) P1315H probably damaging Het
Cfap57 C T 4: 118,456,153 (GRCm39) probably null Het
Cfap61 G A 2: 145,854,082 (GRCm39) V365M possibly damaging Het
Cfap61 G C 2: 145,995,720 (GRCm39) C1095S probably damaging Het
Cfap69 C T 5: 5,636,384 (GRCm39) C747Y possibly damaging Het
Cfap74 G T 4: 155,539,370 (GRCm39) probably benign Het
Cfh G T 1: 140,071,797 (GRCm39) P297H probably damaging Het
Chd1 G T 17: 15,968,063 (GRCm39) G866C probably damaging Het
Chd2 C G 7: 73,118,334 (GRCm39) A1095P possibly damaging Het
Cherp T G 8: 73,216,760 (GRCm39) K687Q Het
Cherp C A 8: 73,228,979 (GRCm39) probably benign Het
Chil5 G T 3: 105,936,134 (GRCm39) H53N probably damaging Het
Chl1 A T 6: 103,674,910 (GRCm39) probably benign Het
Chl1 C A 6: 103,670,057 (GRCm39) Y482* probably null Het
Chmp1a C G 8: 123,933,070 (GRCm39) V128L probably benign Het
Chmp3 C A 6: 71,520,788 (GRCm39) probably benign Het
Chodl C A 16: 78,738,351 (GRCm39) S106R possibly damaging Het
Chpf2 CGGG CGGGG 5: 24,796,517 (GRCm39) probably null Het
Chrm2 G C 6: 36,501,542 (GRCm39) R466S probably damaging Het
Chrna10 C A 7: 101,762,471 (GRCm39) V240L probably benign Het
Chrna10 C A 7: 101,764,194 (GRCm39) L63F possibly damaging Het
Chrna2 T A 14: 66,388,476 (GRCm39) L497Q probably null Het
Chrna4 G C 2: 180,670,078 (GRCm39) H559Q possibly damaging Het
Chrna4 C A 2: 180,666,606 (GRCm39) V611F probably damaging Het
Chrna5 G A 9: 54,912,240 (GRCm39) A347T possibly damaging Het
Chrna6 C G 8: 27,903,717 (GRCm39) R5P probably benign Het
Chrna7 C T 7: 62,757,299 (GRCm39) probably null Het
Chrna9 T A 5: 66,128,563 (GRCm39) L257Q probably damaging Het
Chrnb1 G T 11: 69,685,015 (GRCm39) A105D possibly damaging Het
Chrng C A 1: 87,134,020 (GRCm39) N87K probably benign Het
Chrng C A 1: 87,135,985 (GRCm39) Q245K probably benign Het
Chrng C T 1: 87,136,025 (GRCm39) T201I probably damaging Het
Chrng C G 1: 87,133,717 (GRCm39) S14R unknown Het
Chst2 C A 9: 95,286,894 (GRCm39) R484L probably damaging Het
Chst3 C A 10: 60,022,082 (GRCm39) G255V probably benign Het
Ciart G C 3: 95,786,335 (GRCm39) P247A probably damaging Het
Cidec G C 6: 113,411,457 (GRCm39) L8V probably damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cilp2 C A 8: 70,335,458 (GRCm39) E513D probably damaging Het
Cilp2 A C 8: 70,337,192 (GRCm39) C206G probably damaging Het
Cilp2 G T 8: 70,337,196 (GRCm39) C204* probably null Het
Cimap3 T G 3: 105,906,921 (GRCm39) K159N probably damaging Het
Cirbp G T 10: 80,006,069 (GRCm39) A82S probably damaging Het
Cirop C G 14: 54,933,965 (GRCm39) D205H probably damaging Het
Ckap5 T G 2: 91,416,143 (GRCm39) L1023R probably damaging Het
Ckmt1 C A 2: 121,190,056 (GRCm39) P81H probably damaging Het
Clasp2 G T 9: 113,599,289 (GRCm39) G135C probably damaging Het
Clasp2 T A 9: 113,737,863 (GRCm39) L1079Q probably damaging Het
Clca3a2 C A 3: 144,792,212 (GRCm39) G350C probably damaging Het
Clcn4 C A 7: 7,296,039 (GRCm39) E268* probably null Het
Clcn4 C A 7: 7,297,755 (GRCm39) A165S probably damaging Het
Clcn6 C A 4: 148,107,827 (GRCm39) G193* probably null Het
Clcn7 G T 17: 25,371,989 (GRCm39) probably null Het
Clcnkb G T 4: 141,135,262 (GRCm39) T492K probably damaging Het
Cldn1 G T 16: 26,179,614 (GRCm39) P151H probably damaging Het
Cldn16 G T 16: 26,300,000 (GRCm39) R146L probably damaging Het
Cldn9 G C 17: 23,902,175 (GRCm39) P150R probably damaging Het
Cldnd1 G T 16: 58,550,044 (GRCm39) G76W probably damaging Het
Clec1a G A 6: 129,406,870 (GRCm39) P215L probably benign Het
Clec4a1 G T 6: 122,910,851 (GRCm39) R235S possibly damaging Het
Clec4d G T 6: 123,245,033 (GRCm39) W104C probably damaging Het
Clec4f C A 6: 83,622,203 (GRCm39) R546I possibly damaging Het
Clgn T A 8: 84,124,310 (GRCm39) M84K probably benign Het
Clic6 C T 16: 92,296,027 (GRCm39) S229F probably benign Het
Clip1 C A 5: 123,755,413 (GRCm39) A956S probably damaging Het
Clip2 C G 5: 134,545,689 (GRCm39) R334P probably damaging Het
Clip2 C A 5: 134,551,853 (GRCm39) G90C probably damaging Het
Clip4 G T 17: 72,106,092 (GRCm39) probably null Het
Clmn C A 12: 104,747,635 (GRCm39) K637N probably benign Het
Clp1 C A 2: 84,556,307 (GRCm39) D58Y probably benign Het
Clptm1 C T 7: 19,371,393 (GRCm39) probably null Het
Clpx C A 9: 65,207,279 (GRCm39) S59* probably null Het
Clspn G A 4: 126,459,970 (GRCm39) R399Q probably benign Het
Clstn2 C A 9: 97,343,409 (GRCm39) M679I probably benign Het
Clstn3 C A 6: 124,426,740 (GRCm39) G564V probably damaging Het
Clu A T 14: 66,213,370 (GRCm39) Q252L probably damaging Het
Cluh G C 11: 74,558,580 (GRCm39) K1217N possibly damaging Het
Cmah C A 13: 24,619,667 (GRCm39) Y277* probably null Het
Cmbl G T 15: 31,582,111 (GRCm39) R36L probably benign Het
Cmklr2 G T 1: 63,222,798 (GRCm39) H146N probably benign Het
Cmtr2 CGGG CGG 8: 110,948,131 (GRCm39) probably null Het
Cmya5 C G 13: 93,200,087 (GRCm39) A3414P probably benign Het
Cnga1 C A 5: 72,762,873 (GRCm39) probably null Het
Cngb1 A T 8: 95,978,764 (GRCm39) L1022Q probably damaging Het
Cnksr1 T C 4: 133,959,461 (GRCm39) D391G probably damaging Het
Cnnm3 G A 1: 36,552,114 (GRCm39) A375T possibly damaging Het
Cnot11 G T 1: 39,574,929 (GRCm39) G4C probably damaging Het
Cnot3 G T 7: 3,654,494 (GRCm39) R57L probably damaging Het
Cnpy1 C A 5: 28,412,207 (GRCm39) V109L possibly damaging Het
Cntn1 C A 15: 92,207,851 (GRCm39) P814H probably damaging Het
Cntn3 C A 6: 102,314,292 (GRCm39) V141L probably benign Het
Cntn4 G T 6: 106,527,386 (GRCm39) G423C probably damaging Het
Cntn4 C A 6: 106,639,579 (GRCm39) H570N probably damaging Het
Cntn5 C A 9: 9,673,967 (GRCm39) E712* probably null Het
Cntn5 C A 9: 10,090,241 (GRCm39) G198C probably damaging Het
Cntn6 C A 6: 104,809,545 (GRCm39) P527T probably damaging Het
Cntnap2 C T 6: 45,992,233 (GRCm39) P387S possibly damaging Het
Cntnap3 G C 13: 64,929,706 (GRCm39) P498A probably damaging Het
Cntnap5a A T 1: 116,339,898 (GRCm39) Q719L probably benign Het
Cntnap5b C T 1: 99,978,431 (GRCm39) A149V probably damaging Het
Cntrob C A 11: 69,202,275 (GRCm39) R439L possibly damaging Het
Cog4 A T 8: 111,605,647 (GRCm39) T570S probably benign Het
Cog5 G T 12: 31,851,984 (GRCm39) G280C probably damaging Het
Cog6 T C 3: 52,921,285 (GRCm39) D107G probably damaging Het
Col11a1 G T 3: 113,932,570 (GRCm39) G902C unknown Het
Col11a1 G C 3: 113,958,884 (GRCm39) probably null Het
Col11a2 G T 17: 34,270,640 (GRCm39) R537M probably benign Het
Col12a1 C CA 9: 79,546,978 (GRCm39) probably null Het
Col12a1 C A 9: 79,507,268 (GRCm39) G263V possibly damaging Het
Col13a1 C A 10: 61,741,041 (GRCm39) G150C probably damaging Het
Col14a1 A C 15: 55,235,966 (GRCm39) probably null Het
Col15a1 G T 4: 47,245,807 (GRCm39) R186L probably benign Het
Col17a1 G A 19: 47,638,743 (GRCm39) P1141L possibly damaging Het
Col18a1 T A 10: 76,948,672 (GRCm39) Q280L unknown Het
Col1a1 G A 11: 94,834,630 (GRCm39) M569I probably benign Het
Col22a1 G T 15: 71,786,969 (GRCm39) P752T unknown Het
Col24a1 G T 3: 145,048,260 (GRCm39) G619V probably damaging Het
Col25a1 G T 3: 130,316,110 (GRCm39) G297V probably damaging Het
Col27a1 G T 4: 63,199,526 (GRCm39) G928W probably damaging Het
Col28a1 T A 6: 8,175,630 (GRCm39) S73C unknown Het
Col28a1 C A 6: 8,127,352 (GRCm39) G366C probably damaging Het
Col28a1 G T 6: 8,062,283 (GRCm39) P669Q possibly damaging Het
Col2a1 C A 15: 97,881,854 (GRCm39) K781N probably damaging Het
Col2a1 G T 15: 97,896,226 (GRCm39) P162H unknown Het
Col3a1 C T 1: 45,350,960 (GRCm39) P18L unknown Het
Col4a1 C T 8: 11,285,218 (GRCm39) G388S unknown Het
Col4a1 C G 8: 11,289,024 (GRCm39) G311R unknown Het
Col4a3 G T 1: 82,667,760 (GRCm39) G1010C unknown Het
Col5a2 C G 1: 45,441,273 (GRCm39) G664A probably damaging Het
Col5a2 C A 1: 45,442,633 (GRCm39) G604V probably damaging Het
Col5a3 C A 9: 20,686,630 (GRCm39) A1332S unknown Het
Col6a2 C A 10: 76,432,184 (GRCm39) A990S possibly damaging Het
Col6a3 A T 1: 90,739,450 (GRCm39) D866E possibly damaging Het
Col6a5 C A 9: 105,807,984 (GRCm39) E1021D unknown Het
Col6a6 C A 9: 105,605,454 (GRCm39) G1644C probably damaging Het
Col6a6 C A 9: 105,666,094 (GRCm39) G21C probably null Het
Col7a1 G T 9: 108,803,991 (GRCm39) G2198W unknown Het
Col7a1 C A 9: 108,813,145 (GRCm39) H2897N unknown Het
Col7a1 C G 9: 108,805,119 (GRCm39) D2322E unknown Het
Col8a1 C A 16: 57,448,601 (GRCm39) G303V unknown Het
Col8a1 C A 16: 57,452,813 (GRCm39) L63F probably damaging Het
Col8a2 C A 4: 126,205,336 (GRCm39) P449T unknown Het
Colgalt1 G T 8: 72,075,852 (GRCm39) G500C probably damaging Het
Commd4 C A 9: 57,064,415 (GRCm39) R4L probably damaging Het
Comp G T 8: 70,829,871 (GRCm39) R365L probably benign Het
Copa AG A 1: 171,933,690 (GRCm39) probably null Het
Copg2 C T 6: 30,786,520 (GRCm39) R708Q probably benign Het
Coq7 C A 7: 118,109,372 (GRCm39) K225N unknown Het
Corin C A 5: 72,611,836 (GRCm39) R141S probably benign Het
Coro6 C A 11: 77,359,935 (GRCm39) A372D probably damaging Het
Cox10 C A 11: 63,867,296 (GRCm39) L233F possibly damaging Het
Cox4i1 G T 8: 121,395,019 (GRCm39) probably benign Het
Cpa4 G T 6: 30,574,402 (GRCm39) V64L possibly damaging Het
Cpa6 T A 1: 10,399,784 (GRCm39) probably null Het
Cplane1 G T 15: 8,204,456 (GRCm39) G78V probably damaging Het
Cplane1 C T 15: 8,239,473 (GRCm39) L1225F probably damaging Het
Cpn1 C A 19: 43,962,415 (GRCm39) G178V probably damaging Het
Cpne5 C G 17: 29,378,156 (GRCm39) R541P probably damaging Het
Cpsf7 G T 19: 10,512,882 (GRCm39) S322I probably null Het
Cpt1a G T 19: 3,420,727 (GRCm39) R395L probably damaging Het
Cpt1a A T 19: 3,416,370 (GRCm39) Q307L probably damaging Het
Cpxm2 C G 7: 131,656,730 (GRCm39) A511P probably benign Het
Cpz G T 5: 35,669,105 (GRCm39) S342* probably null Het
Cracr2a G T 6: 127,584,207 (GRCm39) A89S probably benign Het
Cracr2a A T 6: 127,646,026 (GRCm39) D706V probably damaging Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Crb1 A T 1: 139,264,766 (GRCm39) probably null Het
Crb1 T A 1: 139,176,639 (GRCm39) Q448L possibly damaging Het
Crb2 G A 2: 37,677,377 (GRCm39) G290R probably damaging Het
Crb2 G C 2: 37,680,836 (GRCm39) R588P possibly damaging Het
Crebl2 G A 6: 134,807,396 (GRCm39) D2N probably damaging Het
Crispld1 TCC TC 1: 17,834,316 (GRCm39) probably null Het
Crmp1 G T 5: 37,435,468 (GRCm39) V308L probably benign Het
Crnn T G 3: 93,056,603 (GRCm39) V463G probably damaging Het
Crocc2 A T 1: 93,154,414 (GRCm39) Q1603L probably benign Het
Crocc2 A T 1: 93,141,317 (GRCm39) R1157W probably damaging Het
Crybb2 C A 5: 113,206,302 (GRCm39) G178W probably damaging Het
Crybb2 C A 5: 113,206,301 (GRCm39) G178V probably damaging Het
Crybg3 C A 16: 59,375,756 (GRCm39) E119* probably null Het
Crybg3 C T 16: 59,376,841 (GRCm39) S1471N probably benign Het
Csf1 C A 3: 107,656,396 (GRCm39) A212S possibly damaging Het
Csf2ra C T 19: 61,213,591 (GRCm39) D373N probably benign Het
Csmd1 G T 8: 16,034,708 (GRCm39) P2488T probably damaging Het
Csmd1 C A 8: 16,250,033 (GRCm39) D982Y probably damaging Het
Csmd2 C T 4: 128,424,590 (GRCm39) L2872F Het
Csmd3 A T 15: 47,596,813 (GRCm39) S1097R Het
Csmd3 C G 15: 47,539,130 (GRCm39) G1536R Het
Csnk1g1 A T 9: 65,920,032 (GRCm39) T335S probably benign Het
Cspp1 GAA GA 1: 10,166,103 (GRCm39) probably null Het
Cstf2 G C X: 132,963,237 (GRCm39) probably null Het
Ctag2 C A X: 64,091,535 (GRCm39) P82H probably damaging Het
Ctcfl A C 2: 172,943,829 (GRCm39) M507R probably benign Het
Ctdsp2 G T 10: 126,831,941 (GRCm39) R183L probably damaging Het
Ctla2a C A 13: 61,083,814 (GRCm39) E39D probably damaging Het
Ctnna2 G T 6: 76,957,723 (GRCm39) L509I probably damaging Het
Ctnna2 G C 6: 77,618,400 (GRCm39) N187K probably benign Het
Ctnna2 G A 6: 77,735,537 (GRCm39) S60F probably benign Het
Ctnna2 G C 6: 76,950,764 (GRCm39) A569G possibly damaging Het
Ctnnd1 C A 2: 84,445,516 (GRCm39) G507V probably damaging Het
Ctrb1 A T 8: 112,413,306 (GRCm39) S235R probably damaging Het
Cts3 A T 13: 61,716,561 (GRCm39) L25* probably null Het
Cts7 T A 13: 61,503,446 (GRCm39) T173S probably benign Het
Ctse G A 1: 131,600,182 (GRCm39) probably null Het
Ctsq C T 13: 61,184,910 (GRCm39) G259R probably damaging Het
Cul7 G T 17: 46,970,495 (GRCm39) R1071L probably damaging Het
Cul7 AGGGG AGGG 17: 46,963,731 (GRCm39) probably null Het
Cul7 A T 17: 46,969,664 (GRCm39) Q977L probably damaging Het
Cul9 C A 17: 46,848,723 (GRCm39) R671L probably benign Het
Cux2 C T 5: 122,011,743 (GRCm39) R564H probably damaging Het
Cux2 G T 5: 122,015,192 (GRCm39) P234T probably benign Het
Cwf19l2 G T 9: 3,428,782 (GRCm39) G256V probably damaging Het
Cwh43 C G 5: 73,587,813 (GRCm39) N477K probably damaging Het
Cxxc4 G T 3: 133,945,811 (GRCm39) A131S unknown Het
Cyfip1 G T 7: 55,548,068 (GRCm39) G586V possibly damaging Het
Cyfip2 G A 11: 46,113,442 (GRCm39) S968F not run Het
Cylc1 C G X: 110,166,048 (GRCm39) P110A probably benign Het
Cyp17a1 G A 19: 46,661,098 (GRCm39) P62L possibly damaging Het
Cyp1a1 G A 9: 57,607,797 (GRCm39) A142T probably damaging Het
Cyp20a1 G T 1: 60,392,169 (GRCm39) R75M probably damaging Het
Cyp26b1 C G 6: 84,554,101 (GRCm39) W172S probably damaging Het
Cyp27a1 C T 1: 74,776,494 (GRCm39) R477W probably damaging Het
Cyp2ab1 C A 16: 20,132,631 (GRCm39) W222C possibly damaging Het
Cyp2b9 A T 7: 25,900,588 (GRCm39) N409Y probably benign Het
Cyp2c54 G A 19: 40,062,201 (GRCm39) L19F probably benign Het
Cyp2c66 T A 19: 39,175,070 (GRCm39) I490N probably damaging Het
Cyp2c67 C T 19: 39,632,123 (GRCm39) A82T possibly damaging Het
Cyp2d11 G T 15: 82,276,700 (GRCm39) P80T probably damaging Het
Cyp2f2 C A 7: 26,821,332 (GRCm39) Q82K possibly damaging Het
Cyp2j5 C A 4: 96,547,717 (GRCm39) probably null Het
Cyp2r1 T A 7: 114,152,574 (GRCm39) R128* probably null Het
Cyp2t4 T A 7: 26,857,665 (GRCm39) L426Q probably damaging Het
Cyp3a57 C A 5: 145,302,443 (GRCm39) P80T probably damaging Het
Cyp4a14 C T 4: 115,348,650 (GRCm39) D305N possibly damaging Het
Cyp4a32 G T 4: 115,468,542 (GRCm39) E341D probably benign Het
Cyp4f18 G T 8: 72,752,127 (GRCm39) R180S probably benign Het
Cyp4f40 G C 17: 32,895,423 (GRCm39) R515P probably damaging Het
Cyp4f40 G T 17: 32,890,133 (GRCm39) D268Y probably benign Het
Cyp4x1 G T 4: 114,967,300 (GRCm39) D425E probably damaging Het
Cyp4x1 C T 4: 114,984,722 (GRCm39) A79T probably damaging Het
Cyp8b1 G A 9: 121,745,212 (GRCm39) P40L probably damaging Het
Cyp8b1 A T 9: 121,744,597 (GRCm39) L245Q probably benign Het
Cypt14-ps G A X: 38,952,435 (GRCm39) P9L probably damaging Het
Cypt15-ps C A X: 38,435,207 (GRCm39) A15E probably damaging Het
Cyth4 G T 15: 78,504,119 (GRCm39) R363L probably damaging Het
D130043K22Rik G C 13: 25,040,817 (GRCm39) V80L probably benign Het
D130043K22Rik C A 13: 25,040,692 (GRCm39) P38H probably damaging Het
D130043K22Rik G T 13: 25,064,830 (GRCm39) G749C probably damaging Het
D130043K22Rik C A 13: 25,056,231 (GRCm39) T521N possibly damaging Het
D430041D05Rik C T 2: 104,071,536 (GRCm39) A571T possibly damaging Het
D8Ertd738e C A 8: 84,976,275 (GRCm39) A20S probably benign Het
D930020B18Rik C A 10: 121,525,817 (GRCm39) A573D probably damaging Het
Daam2 G A 17: 49,796,044 (GRCm39) R268W probably damaging Het
Daam2 C G 17: 49,771,648 (GRCm39) A833P probably damaging Het
Dab1 G T 4: 104,584,937 (GRCm39) G359V probably benign Het
Dact1 G C 12: 71,356,825 (GRCm39) R23P possibly damaging Het
Daglb G C 5: 143,458,873 (GRCm39) S140T probably null Het
Dand5 C A 8: 85,543,152 (GRCm39) R108M probably damaging Het
Dand5 C T 8: 85,542,966 (GRCm39) R170K probably benign Het
Dapk3 GC GCC 10: 81,027,603 (GRCm39) probably null Het
Daw1 G T 1: 83,187,935 (GRCm39) R318S unknown Het
Dbt G C 3: 116,339,740 (GRCm39) R376P probably damaging Het
Dcaf12l1 G T X: 43,877,701 (GRCm39) H366N probably damaging Het
Dcaf7 G T 11: 105,944,621 (GRCm39) C268F probably benign Het
Dchs1 G C 7: 105,407,758 (GRCm39) Q2025E probably benign Het
Dchs1 T A 7: 105,406,900 (GRCm39) S2202C probably damaging Het
Dchs2 T A 3: 83,178,447 (GRCm39) S1167T possibly damaging Het
Dclk1 G T 3: 55,163,434 (GRCm39) E175D probably benign Het
Dcstamp G T 15: 39,622,992 (GRCm39) G438W probably benign Het
Ddb1 G C 19: 10,585,760 (GRCm39) R158P probably damaging Het
Ddc G T 11: 11,830,552 (GRCm39) P31T probably damaging Het
Ddhd1 C A 14: 45,895,051 (GRCm39) A140S possibly damaging Het
Ddhd2 C A 8: 26,244,402 (GRCm39) A75S probably benign Het
Ddhd2 G T 8: 26,244,413 (GRCm39) T71N unknown Het
Ddr2 C A 1: 169,818,191 (GRCm39) D439Y possibly damaging Het
Ddx1 C A 12: 13,279,260 (GRCm39) G460W probably damaging Het
Ddx10 C A 9: 53,115,811 (GRCm39) A508S probably damaging Het
Ddx17 T A 15: 79,414,373 (GRCm39) Q600L probably benign Het
Ddx21 C A 10: 62,423,317 (GRCm39) probably null Het
Ddx27 G C 2: 166,875,761 (GRCm39) E697D probably benign Het
Ddx56 C G 11: 6,217,445 (GRCm39) M65I probably benign Het
Ddx60 G C 8: 62,453,622 (GRCm39) R1247P possibly damaging Het
Defa17 G T 8: 22,146,610 (GRCm39) G79W probably damaging Het
Defb11 A T 8: 22,396,362 (GRCm39) C12S probably null Het
Defb37 G T 8: 19,036,399 (GRCm39) N40K unknown Het
Degs1l C A 1: 180,882,982 (GRCm39) P248H probably damaging Het
Degs1l G A 1: 180,887,336 (GRCm39) S307N probably benign Het
Degs2 G T 12: 108,658,856 (GRCm39) P41H probably benign Het
Dek C A 13: 47,259,102 (GRCm39) E35* probably null Het
Dele1 C A 18: 38,387,356 (GRCm39) H199N probably benign Het
Dennd1a C A 2: 37,690,269 (GRCm39) G944W probably damaging Het
Dennd1c G T 17: 57,381,330 (GRCm39) Q131K probably benign Het
Dennd2a C A 6: 39,500,408 (GRCm39) Q52H probably benign Het
Dennd5a C G 7: 109,533,231 (GRCm39) G180R probably benign Het
Deptor G T 15: 54,996,855 (GRCm39) probably benign Het
Deup1 G A 9: 15,519,128 (GRCm39) S126F probably benign Het
Deup1 C A 9: 15,512,199 (GRCm39) Q181H probably null Het
Dgka C T 10: 128,567,034 (GRCm39) R275Q possibly damaging Het
Dgka C G 10: 128,556,337 (GRCm39) M716I probably benign Het
Dgkd G A 1: 87,844,608 (GRCm39) S258N probably damaging Het
Dgkg G T 16: 22,376,834 (GRCm39) H508Q probably benign Het
Dgki G T 6: 36,952,160 (GRCm39) L740M probably damaging Het
Dgkz C T 2: 91,772,679 (GRCm39) V370I probably damaging Het
Dhrs7l C A 12: 72,675,512 (GRCm39) G39V probably damaging Het
Dhtkd1 C G 2: 5,947,439 (GRCm39) R15P unknown Het
Dhx29 G A 13: 113,092,051 (GRCm39) R896Q probably null Het
Dhx37 C A 5: 125,502,536 (GRCm39) S449I probably benign Het
Dhx37 C T 5: 125,502,044 (GRCm39) R484Q possibly damaging Het
Dhx38 C T 8: 110,282,717 (GRCm39) V650I probably benign Het
Dhx8 C A 11: 101,648,486 (GRCm39) T928K probably damaging Het
Dhx9 C T 1: 153,332,321 (GRCm39) G1216R unknown Het
Diaph3 C A 14: 87,240,250 (GRCm39) G278V probably damaging Het
Dio2 C A 12: 90,696,686 (GRCm39) E101* probably null Het
Dip2a C A 10: 76,132,234 (GRCm39) V545L probably damaging Het
Dip2a C A 10: 76,102,156 (GRCm39) S1446I possibly damaging Het
Dipk2b C A X: 18,286,846 (GRCm39) M236I probably benign Het
Diras1 C A 10: 80,858,116 (GRCm39) R45L possibly damaging Het
Disp2 C A 2: 118,621,308 (GRCm39) P680H probably damaging Het
Disp2 G T 2: 118,620,183 (GRCm39) R305L probably damaging Het
Disp3 G T 4: 148,334,203 (GRCm39) P1030Q probably damaging Het
Disp3 C A 4: 148,355,024 (GRCm39) E331* probably null Het
Disp3 G C 4: 148,335,171 (GRCm39) P958A probably damaging Het
Disp3 G C 4: 148,334,304 (GRCm39) S996R probably benign Het
Dlec1 T A 9: 118,976,477 (GRCm39) S1677R probably damaging Het
Dlec1 C A 9: 118,963,541 (GRCm39) L952I probably benign Het
Dlgap1 G T 17: 70,969,738 (GRCm39) V515L probably benign Het
Dlgap2 G T 8: 14,777,659 (GRCm39) W301C probably damaging Het
Dlgap3 G T 4: 127,129,291 (GRCm39) K895N probably damaging Het
Dlgap3 C G 4: 127,088,777 (GRCm39) D124E probably damaging Het
Dlgap5 T A 14: 47,625,520 (GRCm39) R794* probably null Het
Dll3 G T 7: 28,000,808 (GRCm39) S82R probably damaging Het
Dlst C T 12: 85,157,667 (GRCm39) probably benign Het
Dlx1 G T 2: 71,360,359 (GRCm39) E8* probably null Het
Dlx3 C G 11: 95,011,218 (GRCm39) A24G probably benign Het
Dmac2l G A 12: 69,787,736 (GRCm39) probably benign Het
Dmbt1 A T 7: 130,684,215 (GRCm39) probably null Het
Dmd C A X: 82,670,877 (GRCm39) T220N probably damaging Het
Dmgdh G T 13: 93,845,796 (GRCm39) W483C probably damaging Het
Dmgdh G T 13: 93,813,691 (GRCm39) A79S probably damaging Het
Dmp1 C A 5: 104,359,518 (GRCm39) H65N probably benign Het
Dmrta1 G T 4: 89,576,645 (GRCm39) V34L probably damaging Het
Dmrta1 G A 4: 89,576,735 (GRCm39) A64T probably benign Het
Dmrta1 G A 4: 89,576,691 (GRCm39) G49D probably benign Het
Dmtf1l C A X: 125,722,156 (GRCm39) W316C probably damaging Het
Dmxl2 GC G 9: 54,289,318 (GRCm39) probably null Het
Dna2 G C 10: 62,798,203 (GRCm39) M635I probably benign Het
Dnaaf11 T A 15: 66,341,748 (GRCm39) K116M probably damaging Het
Dnaaf4 G T 9: 72,869,246 (GRCm39) R152L possibly damaging Het
Dnaaf5 G A 5: 139,171,297 (GRCm39) D820N probably benign Het
Dnaaf5 G C 5: 139,163,730 (GRCm39) W662C probably damaging Het
Dnaaf5 G T 5: 139,171,340 (GRCm39) R834L probably damaging Het
Dnaaf9 C T 2: 130,552,787 (GRCm39) R1091K probably benign Het
Dnah10 G C 5: 124,819,019 (GRCm39) R435P probably damaging Het
Dnah10 C T 5: 124,824,683 (GRCm39) A613V possibly damaging Het
Dnah10 G T 5: 124,895,052 (GRCm39) probably null Het
Dnah12 G T 14: 26,597,172 (GRCm39) W3510C probably damaging Het
Dnah14 G T 1: 181,593,869 (GRCm39) R3404L probably damaging Het
Dnah14 T C 1: 181,590,899 (GRCm39) L3264P probably damaging Het
Dnah14 G A 1: 181,517,885 (GRCm39) G2073E probably benign Het
Dnah17 C A 11: 117,977,786 (GRCm39) G1849C probably damaging Het
Dnah17 G T 11: 117,969,389 (GRCm39) P2257T possibly damaging Het
Dnah17 C A 11: 118,017,968 (GRCm39) E176* probably null Het
Dnah2 G T 11: 69,354,279 (GRCm39) R2290S possibly damaging Het
Dnah2 C T 11: 69,435,383 (GRCm39) probably null Het
Dnah3 C A 7: 119,607,085 (GRCm39) R1840L probably benign Het
Dnah3 G C 7: 119,567,124 (GRCm39) S2367R probably damaging Het
Dnah5 T G 15: 28,270,500 (GRCm39) L934R probably benign Het
Dnah5 T A 15: 28,387,909 (GRCm39) S3123T possibly damaging Het
Dnah5 C T 15: 28,295,457 (GRCm39) P1397S probably damaging Het
Dnah5 G T 15: 28,270,549 (GRCm39) E950D probably benign Het
Dnah6 G T 6: 73,018,121 (GRCm39) P3566H probably damaging Het
Dnah6 G T 6: 73,009,509 (GRCm39) Q3813K probably damaging Het
Dnah6 C A 6: 72,998,220 (GRCm39) L4067F probably benign Het
Dnah6 C A 6: 73,132,255 (GRCm39) R1149L possibly damaging Het
Dnah7a C A 1: 53,598,261 (GRCm39) A1425S probably benign Het
Dnah7a C G 1: 53,450,815 (GRCm39) V3872L probably benign Het
Dnah7a A C 1: 53,682,616 (GRCm39) W285G possibly damaging Het
Dnah7c C A 1: 46,693,263 (GRCm39) L1961I possibly damaging Het
Dnah8 C A 17: 30,913,007 (GRCm39) T1067N probably benign Het
Dnah8 A T 17: 30,932,069 (GRCm39) Q1479L probably null Het
Dnah9 C A 11: 66,017,476 (GRCm39) D379Y probably damaging Het
Dnai1 C T 4: 41,569,809 (GRCm39) probably benign Het
Dnaja2 C A 8: 86,266,700 (GRCm39) W342C probably benign Het
Dnajb11 G A 16: 22,684,246 (GRCm39) G90S probably damaging Het
Dnajb11 G A 16: 22,685,711 (GRCm39) R122H probably benign Het
Dnajc10 G C 2: 80,149,577 (GRCm39) R93P probably damaging Het
Dnajc12 A T 10: 63,233,039 (GRCm39) Q60L probably damaging Het
Dnajc6 G T 4: 101,496,625 (GRCm39) V931L possibly damaging Het
Dner C G 1: 84,423,151 (GRCm39) S484T probably damaging Het
Dner C T 1: 84,383,710 (GRCm39) C558Y probably damaging Het
Dner C A 1: 84,423,154 (GRCm39) R483L probably damaging Het
Dnhd1 C A 7: 105,332,048 (GRCm39) R102S possibly damaging Het
Dntt A T 19: 41,044,254 (GRCm39) D473V probably damaging Het
Doc2g C A 19: 4,054,105 (GRCm39) P112T probably damaging Het
Dock1 G T 7: 134,384,129 (GRCm39) E667* probably null Het
Dock10 C G 1: 80,536,917 (GRCm39) M989I probably benign Het
Dock2 T G 11: 34,262,553 (GRCm39) H934P possibly damaging Het
Dock4 G C 12: 40,867,640 (GRCm39) Q1405H possibly damaging Het
Dock5 C A 14: 68,051,382 (GRCm39) A696S possibly damaging Het
Dock8 G T 19: 25,109,487 (GRCm39) A890S probably benign Het
Dock8 C T 19: 25,133,336 (GRCm39) T1161I probably benign Het
Donson G A 16: 91,485,360 (GRCm39) R81W probably benign Het
Dop1b G T 16: 93,560,783 (GRCm39) V874L probably damaging Het
Dpp6 C A 5: 27,917,640 (GRCm39) F610L probably damaging Het
Dpp8 CTGTGTGT CTGTGT 9: 64,971,148 (GRCm39) probably null Het
Dpp8 G T 9: 64,973,767 (GRCm39) G664C probably damaging Het
Dpy19l2 C A 9: 24,557,655 (GRCm39) M373I probably benign Het
Dpys A T 15: 39,705,495 (GRCm39) M206K probably benign Het
Dpysl2 C A 14: 67,099,939 (GRCm39) G99V probably damaging Het
Drc1 A T 5: 30,502,851 (GRCm39) N125Y possibly damaging Het
Drc1 C A 5: 30,506,041 (GRCm39) S238Y probably benign Het
Drd1 G T 13: 54,206,876 (GRCm39) T446N possibly damaging Het
Drd5 C T 5: 38,477,729 (GRCm39) R241C possibly damaging Het
Drosha G T 15: 12,842,178 (GRCm39) G327V probably benign Het
Drp2 A G X: 133,337,791 (GRCm39) E359G probably damaging Het
Dsc3 C T 18: 20,099,372 (GRCm39) V715I probably benign Het
Dscam C G 16: 96,409,389 (GRCm39) E1845Q probably damaging Het
Dscaml1 C A 9: 45,584,089 (GRCm39) T518N probably damaging Het
Dsel C A 1: 111,789,446 (GRCm39) R363L probably damaging Het
Dsg1c C A 18: 20,398,006 (GRCm39) P69T probably damaging Het
Dsg2 G T 18: 20,735,306 (GRCm39) E1095* probably null Het
Dsp CAAA CAAAA 13: 38,376,830 (GRCm39) probably null Het
Dsp G C 13: 38,335,665 (GRCm39) G34A probably benign Het
Dst A C 1: 34,233,599 (GRCm39) K3436Q probably damaging Het
Dst G T 1: 34,220,313 (GRCm39) G2039V probably benign Het
Dtx1 C A 5: 120,819,416 (GRCm39) G594V probably damaging Het
Duox2 G T 2: 122,123,933 (GRCm39) P417Q probably damaging Het
Dusp1 CT C 17: 26,726,169 (GRCm39) probably null Het
Dusp10 G C 1: 183,801,189 (GRCm39) E319Q probably damaging Het
Dusp4 G T 8: 35,275,244 (GRCm39) S121I probably benign Het
Dvl1 G T 4: 155,932,094 (GRCm39) probably benign Het
Dvl3 G T 16: 20,335,838 (GRCm39) probably benign Het
Dynap C A 18: 70,374,101 (GRCm39) V142L unknown Het
Dync1h1 G T 12: 110,624,951 (GRCm39) E3793* probably null Het
Dync1h1 G A 12: 110,603,988 (GRCm39) D2304N probably damaging Het
Dync1h1 G GT 12: 110,607,611 (GRCm39) probably null Het
Dync1i1 G A 6: 5,767,057 (GRCm39) V46I probably benign Het
Dync2h1 C A 9: 7,102,427 (GRCm39) G2658C probably damaging Het
Dync2i1 C A 12: 116,209,719 (GRCm39) K364N probably benign Het
Dyrk1a G T 16: 94,492,439 (GRCm39) probably null Het
Dysf G A 6: 84,041,505 (GRCm39) M171I probably benign Het
Dysf G T 6: 84,064,799 (GRCm39) V478L probably benign Het
Dytn G A 1: 63,672,613 (GRCm39) R597* probably null Het
Dzip1 T A 14: 119,148,788 (GRCm39) K297I probably damaging Het
Dzip1l G T 9: 99,547,907 (GRCm39) Q720H probably null Het
E130308A19Rik T A 4: 59,720,223 (GRCm39) I585K probably benign Het
E2f8 A T 7: 48,525,294 (GRCm39) I226K probably benign Het
Eaf2 A T 16: 36,645,024 (GRCm39) I66K probably damaging Het
Ear6 C G 14: 52,091,712 (GRCm39) C86W probably damaging Het
Ear6 A AT 14: 52,091,860 (GRCm39) probably null Het
Ecd C T 14: 20,387,087 (GRCm39) G216S possibly damaging Het
Ecm1 T C 3: 95,642,188 (GRCm39) I466V probably benign Het
Ecpas C A 4: 58,861,614 (GRCm39) D322Y probably damaging Het
Ect2l C A 10: 18,048,420 (GRCm39) R267L probably null Het
Eddm3b G A 14: 51,354,179 (GRCm39) V56I probably damaging Het
Eddm3b C A 14: 51,354,446 (GRCm39) L145I probably benign Het
Edil3 G T 13: 88,970,131 (GRCm39) V11F probably benign Het
Edn1 C A 13: 42,457,107 (GRCm39) P47T possibly damaging Het
Eed C A 7: 89,629,723 (GRCm39) R4M probably benign Het
Eed C A 7: 89,629,722 (GRCm39) R4S probably benign Het
Eef1d C A 15: 75,774,727 (GRCm39) A311S possibly damaging Het
Eef2k G A 7: 120,457,676 (GRCm39) G12S probably damaging Het
Efcab14 G T 4: 115,595,899 (GRCm39) G15V probably damaging Het
Efcab3 C A 11: 104,814,845 (GRCm39) A3243D unknown Het
Efcab3 C A 11: 104,630,164 (GRCm39) S965* probably null Het
Efcab3 C A 11: 104,711,344 (GRCm39) T1860K probably benign Het
Efcab8 G T 2: 153,640,600 (GRCm39) D354Y probably null Het
Efemp1 A T 11: 28,817,909 (GRCm39) E129D probably benign Het
Efhb C A 17: 53,744,154 (GRCm39) R479L possibly damaging Het
Efhb G C 17: 53,744,211 (GRCm39) A460G probably benign Het
Efhd2 C A 4: 141,601,994 (GRCm39) R62L probably damaging Het
Efnb1 G T X: 98,191,110 (GRCm39) A339S probably damaging Het
Efnb2 C A 8: 8,673,147 (GRCm39) probably null Het
Egfem1 C A 3: 29,202,602 (GRCm39) P66T probably benign Het
Egfr A T 11: 16,812,954 (GRCm39) I145F probably benign Het
Egfr G T 11: 16,819,319 (GRCm39) G283V probably damaging Het
Egln2 C T 7: 26,864,415 (GRCm39) S170N probably benign Het
Egr1 G C 18: 34,996,283 (GRCm39) R355P probably damaging Het
Ehbp1l1 C A 19: 5,768,790 (GRCm39) G838W probably damaging Het
Ehbp1l1 C G 19: 5,769,462 (GRCm39) A614P probably benign Het
Ehbp1l1 C T 19: 5,769,130 (GRCm39) M724I probably benign Het
Ehbp1l1 C A 19: 5,769,129 (GRCm39) A725S probably benign Het
Ehd2 T A 7: 15,691,830 (GRCm39) probably null Het
Ehd3 G T 17: 74,137,100 (GRCm39) G423V probably benign Het
Ehhadh C A 16: 21,581,038 (GRCm39) W651C probably damaging Het
Eif1ad10 G C 12: 88,216,572 (GRCm39) A100G possibly damaging Het
Eif2a G T 3: 58,438,541 (GRCm39) G21V probably damaging Het
Eif2b2 G C 12: 85,266,338 (GRCm39) M1I probably null Het
Eif2b2 G C 12: 85,270,189 (GRCm39) G243A probably damaging Het
Eif3b G T 5: 140,415,883 (GRCm39) G401C probably damaging Het
Eif3h C A 15: 51,728,834 (GRCm39) G7V probably damaging Het
Eif3m C T 2: 104,831,619 (GRCm39) D314N probably damaging Het
Eif4g1 G A 16: 20,502,655 (GRCm39) D988N probably benign Het
Eif4g1 GT GTT 16: 20,505,116 (GRCm39) probably null Het
Elfn1 G T 5: 139,958,063 (GRCm39) V356L probably benign Het
Elmod2 T A 8: 84,044,406 (GRCm39) S186C possibly damaging Het
Elmod2 C A 8: 84,048,130 (GRCm39) D111Y probably damaging Het
Elmod3 T A 6: 72,543,672 (GRCm39) H373L probably benign Het
Eln C T 5: 134,746,880 (GRCm39) G420E unknown Het
Elovl2 C A 13: 41,343,454 (GRCm39) W158L probably damaging Het
Elovl6 G T 3: 129,398,761 (GRCm39) R54L probably damaging Het
Emilin3 T A 2: 160,749,721 (GRCm39) Q676L probably damaging Het
Eml1 G T 12: 108,500,915 (GRCm39) G637W probably damaging Het
Eml1 G T 12: 108,389,398 (GRCm39) probably benign Het
Eml3 A T 19: 8,914,925 (GRCm39) probably null Het
En1 G T 1: 120,531,182 (GRCm39) A141S probably benign Het
En1 G T 1: 120,534,734 (GRCm39) R341L unknown Het
En1 G T 1: 120,531,392 (GRCm39) A211S unknown Het
Engase G T 11: 118,376,583 (GRCm39) R473S possibly damaging Het
Enox1 C T 14: 77,906,187 (GRCm39) T522I probably benign Het
Enpep C A 3: 129,070,329 (GRCm39) W859C probably damaging Het
Enpp1 C A 10: 24,537,840 (GRCm39) V382F probably damaging Het
Entpd7 G T 19: 43,713,936 (GRCm39) G432C probably damaging Het
Ep300 ACCC ACCCC 15: 81,514,298 (GRCm39) probably null Het
Ep400 C A 5: 110,831,230 (GRCm39) K2181N unknown Het
Ep400 C A 5: 110,881,609 (GRCm39) R793S unknown Het
Epb41 G T 4: 131,733,394 (GRCm39) T172N probably benign Het
Epb41l1 G T 2: 156,350,747 (GRCm39) E347D probably benign Het
Epb41l2 G T 10: 25,355,639 (GRCm39) C481F probably damaging Het
Epb41l4b A T 4: 57,063,191 (GRCm39) F500I probably benign Het
Epb41l5 C A 1: 119,536,941 (GRCm39) V317L probably damaging Het
Epb42 T A 2: 120,858,206 (GRCm39) I251F probably damaging Het
Epha10 G T 4: 124,775,753 (GRCm39) R29L probably damaging Het
Epha2 A G 4: 141,046,309 (GRCm39) T503A probably benign Het
Ephb4 G T 5: 137,359,621 (GRCm39) R397L probably benign Het
Ephx1 C A 1: 180,827,334 (GRCm39) Q106H possibly damaging Het
Ephx2 G T 14: 66,322,774 (GRCm39) P500T probably damaging Het
Epn2 C G 11: 61,437,250 (GRCm39) K107N probably damaging Het
Epo C G 5: 137,483,994 (GRCm39) probably null Het
Eps15l1 T A 8: 73,126,922 (GRCm39) probably null Het
Eps15l1 G T 8: 73,135,281 (GRCm39) Q414K probably benign Het
Eps8 C A 6: 137,476,579 (GRCm39) probably null Het
Eps8l2 G C 7: 140,922,008 (GRCm39) A29P probably benign Het
Eps8l3 G T 3: 107,788,982 (GRCm39) probably null Het
Epx C G 11: 87,760,087 (GRCm39) R509P probably damaging Het
Epx C T 11: 87,763,593 (GRCm39) R209H probably benign Het
Epx C A 11: 87,760,720 (GRCm39) R404M possibly damaging Het
Eqtn C A 4: 94,795,788 (GRCm39) E304D probably benign Het
Erbb4 C A 1: 68,348,802 (GRCm39) R525L probably benign Het
Erbb4 C A 1: 68,329,635 (GRCm39) G627C probably damaging Het
Erbb4 CTGT CT 1: 68,298,342 (GRCm39) probably null Het
Ercc3 G T 18: 32,387,214 (GRCm39) D476Y probably damaging Het
Ergic1 G A 17: 26,873,861 (GRCm39) V94I Het
Ermap G T 4: 119,042,758 (GRCm39) T255K probably benign Het
Erp27 C A 6: 136,888,644 (GRCm39) probably null Het
Esco2 C G 14: 66,062,385 (GRCm39) probably null Het
Espnl T A 1: 91,251,277 (GRCm39) L124H probably damaging Het
Esrrg G C 1: 187,775,752 (GRCm39) G93A probably benign Het
Ess2 C G 16: 17,727,786 (GRCm39) G131A probably benign Het
Etfbkmt G C 6: 149,045,835 (GRCm39) R63P probably damaging Het
Evi5 C A 5: 107,896,245 (GRCm39) G733* probably null Het
Evx1 C A 6: 52,293,672 (GRCm39) P280H probably benign Het
Exoc3l2 G T 7: 19,213,953 (GRCm39) V460L unknown Het
Exoc8 C A 8: 125,623,925 (GRCm39) E147D possibly damaging Het
Exog G T 9: 119,277,564 (GRCm39) M165I probably damaging Het
Exog G T 9: 119,274,146 (GRCm39) G44W unknown Het
Exosc10 G T 4: 148,649,843 (GRCm39) W424C probably damaging Het
Exph5 G T 9: 53,288,719 (GRCm39) E1933D probably benign Het
Exph5 A T 9: 53,285,513 (GRCm39) S865C probably benign Het
Ext2 ACC AC 2: 93,533,620 (GRCm39) probably benign Het
Eya1 C A 1: 14,254,653 (GRCm39) G422V probably damaging Het
Eya1 G T 1: 14,323,314 (GRCm39) T185N possibly damaging Het
Eya2 C A 2: 165,527,513 (GRCm39) A61E probably damaging Het
F10 G A 8: 13,087,845 (GRCm39) S15N probably benign Het
Fabp1 G T 6: 71,178,720 (GRCm39) G66W probably damaging Het
Fam110d G T 4: 133,978,881 (GRCm39) T199K probably benign Het
Fam114a2 T G 11: 57,404,084 (GRCm39) E126D probably benign Het
Fam117a G T 11: 95,265,851 (GRCm39) R169L probably damaging Het
Fam124b C G 1: 80,177,805 (GRCm39) R398P probably benign Het
Fam131b C T 6: 42,295,854 (GRCm39) V181I possibly damaging Het
Fam135b C T 15: 71,493,925 (GRCm39) M1I probably null Het
Fam168b C A 1: 34,858,963 (GRCm39) E64* probably null Het
Fam171a1 G T 2: 3,225,971 (GRCm39) R368L possibly damaging Het
Fam174b G A 7: 73,390,329 (GRCm39) A27T unknown Het
Fam184a C A 10: 53,575,182 (GRCm39) M142I probably damaging Het
Fam221b G T 4: 43,666,039 (GRCm39) P191T probably benign Het
Fam234b A T 6: 135,175,006 (GRCm39) probably benign Het
Fam3b C T 16: 97,313,687 (GRCm39) R8Q probably benign Het
Fam53a C A 5: 33,765,161 (GRCm39) A182S probably benign Het
Fam53c G T 18: 34,903,903 (GRCm39) E392* probably null Het
Fam83d A T 2: 158,627,108 (GRCm39) S266C probably damaging Het
Fam83h G T 15: 75,878,390 (GRCm39) R3S probably damaging Het
Fam83h G A 15: 75,874,811 (GRCm39) P842L probably benign Het
Fam90a1b C A X: 93,400,648 (GRCm39) A61S possibly damaging Het
Fam91a1 C A 15: 58,304,397 (GRCm39) S371Y possibly damaging Het
Fanca C T 8: 124,039,368 (GRCm39) R181H probably benign Het
Fancb G T X: 163,765,551 (GRCm39) C11F probably damaging Het
Fancd2 A T 6: 113,521,986 (GRCm39) M194L probably benign Het
Fap G T 2: 62,332,790 (GRCm39) A726E probably damaging Het
Fars2 C A 13: 36,388,714 (GRCm39) Q68K probably benign Het
Fasn C A 11: 120,706,297 (GRCm39) probably null Het
Fastkd2 G T 1: 63,773,995 (GRCm39) probably null Het
Fastkd2 T C 1: 63,773,996 (GRCm39) probably null Het
Fat2 G T 11: 55,169,792 (GRCm39) S2989* probably null Het
Fat3 G T 9: 15,877,287 (GRCm39) T3442K possibly damaging Het
Fat3 C A 9: 15,881,131 (GRCm39) G3247V probably damaging Het
Fat3 C A 9: 15,834,322 (GRCm39) C4090F possibly damaging Het
Fat3 C A 9: 15,858,834 (GRCm39) C3794F probably damaging Het
Fat4 C A 3: 39,035,987 (GRCm39) T3213N probably damaging Het
Fat4 G T 3: 38,942,733 (GRCm39) R542L probably damaging Het
Fat4 G T 3: 38,944,496 (GRCm39) G1130W probably damaging Het
Fbl G A 7: 27,874,257 (GRCm39) G81R unknown Het
Fbn1 C A 2: 125,231,151 (GRCm39) G472C probably damaging Het
Fbn2 G C 18: 58,188,554 (GRCm39) T1620S probably benign Het
Fbn2 C A 18: 58,202,262 (GRCm39) G1297V probably damaging Het
Fbn2 G T 18: 58,143,451 (GRCm39) T2868N probably benign Het
Fbxl2 C G 9: 113,818,413 (GRCm39) G183R probably benign Het
Fbxo15 C A 18: 84,976,433 (GRCm39) Y57* probably null Het
Fbxo16 C A 14: 65,536,807 (GRCm39) T227N probably damaging Het
Fbxo2 G T 4: 148,249,519 (GRCm39) A190S possibly damaging Het
Fbxo21 G T 5: 118,127,236 (GRCm39) D263Y probably damaging Het
Fbxo24 G C 5: 137,619,561 (GRCm39) R222G probably damaging Het
Fbxo38 C T 18: 62,648,535 (GRCm39) E668K probably damaging Het
Fbxo40 C A 16: 36,790,624 (GRCm39) G162V possibly damaging Het
Fbxw11 G T 11: 32,688,480 (GRCm39) R447L probably null Het
Fbxw14 G T 9: 109,105,314 (GRCm39) P284T probably benign Het
Fbxw20 AC A 9: 109,054,955 (GRCm39) probably null Het
Fbxw21 T C 9: 108,974,605 (GRCm39) H305R probably benign Het
Fbxw27 C A 9: 109,601,246 (GRCm39) W291C probably damaging Het
Fcgbpl1 C T 7: 27,839,323 (GRCm39) P379S probably benign Het
Fcrl1 A T 3: 87,296,670 (GRCm39) Q284L probably damaging Het
Fer1l4 C G 2: 155,890,349 (GRCm39) Q228H probably null Het
Fer1l5 G T 1: 36,448,275 (GRCm39) W1046L probably benign Het
Fermt3 C A 19: 6,992,047 (GRCm39) R111L probably benign Het
Fes T A 7: 80,027,778 (GRCm39) R791W probably damaging Het
Fez1 G T 9: 36,779,055 (GRCm39) R244L probably benign Het
Fezf2 G C 14: 12,344,765 (GRCm38) L141V probably benign Het
Fgb G T 3: 82,952,363 (GRCm39) Q169K probably benign Het
Fgd2 C A 17: 29,597,300 (GRCm39) A540E probably benign Het
Fgfr1 G T 8: 26,060,784 (GRCm39) Q485H possibly damaging Het
Fgfr1 G T 8: 26,053,414 (GRCm39) A230S probably benign Het
Fgfr2 C T 7: 129,800,187 (GRCm39) G368E probably damaging Het
Fgfr4 A C 13: 55,313,742 (GRCm39) E517A probably damaging Het
Fgfr4 G T 13: 55,309,520 (GRCm39) D492Y probably damaging Het
Fhip2b G T 14: 70,823,644 (GRCm39) S575R not run Het
Fhit G C 14: 9,870,128 (GRCm38) H51D probably benign Het
Fhod3 C A 18: 25,153,763 (GRCm39) P415H probably damaging Het
Firrm T A 1: 163,792,086 (GRCm39) R611W probably damaging Het
Fitm1 G A 14: 55,814,106 (GRCm39) A201T probably benign Het
Fjx1 C A 2: 102,281,342 (GRCm39) A198S probably benign Het
Fkbp4 T A 6: 128,410,074 (GRCm39) N343Y probably damaging Het
Flg2 G T 3: 93,110,045 (GRCm39) G691V unknown Het
Flg2 G T 3: 93,109,727 (GRCm39) G585V unknown Het
Flnc G T 6: 29,457,129 (GRCm39) G2344C probably damaging Het
Flnc G C 6: 29,447,544 (GRCm39) G1116R probably damaging Het
Flt3 G T 5: 147,320,211 (GRCm39) P51Q probably benign Het
Fmo4 G T 1: 162,631,289 (GRCm39) P226H probably benign Het
Fn3k C G 11: 121,331,100 (GRCm39) Q197E unknown Het
Fnbp1 C A 2: 30,973,071 (GRCm39) R143L probably damaging Het
Folh1 A T 7: 86,393,655 (GRCm39) F385L probably damaging Het
Folh1 A T 7: 86,411,030 (GRCm39) F237L probably benign Het
Fosl2 G C 5: 32,310,277 (GRCm39) R242P probably damaging Het
Foxa1 G T 12: 57,589,203 (GRCm39) T339K probably benign Het
Foxc1 G T 13: 31,991,291 (GRCm39) G34V probably benign Het
Foxd2 C A 4: 114,765,084 (GRCm39) G312V unknown Het
Foxf1 G T 8: 121,811,174 (GRCm39) G13W probably damaging Het
Foxh1 G C 15: 76,553,221 (GRCm39) N164K probably benign Het
Foxi1 G T 11: 34,157,710 (GRCm39) P105H probably damaging Het
Foxi2 G A 7: 135,012,144 (GRCm39) A11T probably benign Het
Foxi2 C A 7: 135,013,687 (GRCm39) P306T probably benign Het
Foxj1 A T 11: 116,223,093 (GRCm39) W237R probably benign Het
Foxl3 G T 5: 138,807,250 (GRCm39) S176I probably damaging Het
Foxn3 T A 12: 99,354,856 (GRCm39) M103L probably benign Het
Foxp1 C A 6: 98,955,122 (GRCm39) V312F unknown Het
Fras1 G T 5: 96,839,316 (GRCm39) G1612C probably damaging Het
Fras1 T C 5: 96,906,001 (GRCm39) L3135P probably benign Het
Fras1 C A 5: 96,888,842 (GRCm39) A2796D possibly damaging Het
Fras1 C A 5: 96,888,670 (GRCm39) R2739S probably benign Het
Fras1 G T 5: 96,848,110 (GRCm39) E1773D possibly damaging Het
Frat2 C G 19: 41,835,726 (GRCm39) A209P probably damaging Het
Frem1 C T 4: 82,934,701 (GRCm39) D87N probably damaging Het
Frem1 C T 4: 82,858,552 (GRCm39) probably null Het
Frem1 C A 4: 82,918,506 (GRCm39) V479L probably benign Het
Frem2 C A 3: 53,563,028 (GRCm39) S493I probably benign Het
Frem2 T A 3: 53,442,587 (GRCm39) Q2650L probably null Het
Frem3 G T 8: 81,342,758 (GRCm39) G1684C possibly damaging Het
Frk T C 10: 34,460,001 (GRCm39) Y199H probably benign Het
Frmpd1 C A 4: 45,275,272 (GRCm39) S475Y probably damaging Het
Frmpd2 G T 14: 33,252,461 (GRCm39) Q674H probably damaging Het
Frmpd2 A T 14: 33,252,462 (GRCm39) K675* probably null Het
Frmpd2 A C 14: 33,264,983 (GRCm39) M921L probably benign Het
Frmpd2 G T 14: 33,252,408 (GRCm39) A657S possibly damaging Het
Frmpd3 C A X: 139,262,981 (GRCm39) D27E possibly damaging Het
Frrs1 G A 3: 116,675,467 (GRCm39) A132T probably damaging Het
Frs2 C A 10: 116,910,284 (GRCm39) W359C probably damaging Het
Fry C G 5: 150,233,902 (GRCm39) R30G possibly damaging Het
Fryl T C 5: 73,198,938 (GRCm39) probably null Het
Fscb G A 12: 64,519,402 (GRCm39) A688V unknown Het
Fsd1 A C 17: 56,303,083 (GRCm39) I351L probably benign Het
Fsd2 C T 7: 81,209,500 (GRCm39) R114Q probably damaging Het
Fsip2 G T 2: 82,814,868 (GRCm39) D3534Y probably damaging Het
Fsip2 C A 2: 82,817,547 (GRCm39) L4427I possibly damaging Het
Fsip2 G C 2: 82,777,304 (GRCm39) K110N probably damaging Het
Fstl3 G T 10: 79,615,942 (GRCm39) E143* probably null Het
Fut1 C A 7: 45,268,653 (GRCm39) S202R probably benign Het
Fyco1 C A 9: 123,657,388 (GRCm39) E929D probably benign Het
Fyttd1 G T 16: 32,698,154 (GRCm39) probably benign Het
Fzd4 CTT CT 7: 89,056,458 (GRCm39) probably null Het
Fzd6 G A 15: 38,894,736 (GRCm39) V301M probably damaging Het
Fzd6 G T 15: 38,870,956 (GRCm39) G59W possibly damaging Het
Gabarapl1 G T 6: 129,518,184 (GRCm39) R42L unknown Het
Gabbr1 G C 17: 37,359,316 (GRCm39) R97P possibly damaging Het
Gabra2 C T 5: 71,165,335 (GRCm39) G212S probably benign Het
Gad1 C A 2: 70,409,474 (GRCm39) N188K probably damaging Het
Gad2 T G 2: 22,525,026 (GRCm39) V270G probably benign Het
Gak AG A 5: 108,733,218 (GRCm39) probably null Het
Galns C A 8: 123,331,945 (GRCm39) D57Y probably damaging Het
Galns C T 8: 123,325,262 (GRCm39) E297K probably benign Het
Galnt10 G C 11: 57,627,826 (GRCm39) E142Q probably benign Het
Galnt15 G T 14: 31,774,322 (GRCm39) W486L probably damaging Het
Galnt16 G T 12: 80,648,584 (GRCm39) W552L probably damaging Het
Galnt16 G A 12: 80,619,121 (GRCm39) A76T probably benign Het
Galnt18 G T 7: 111,084,358 (GRCm39) P536T probably damaging Het
Galnt2 G A 8: 125,070,057 (GRCm39) E525K probably benign Het
Galr1 C A 18: 82,423,897 (GRCm39) A127S probably benign Het
Ganc G T 2: 120,264,275 (GRCm39) W409C probably damaging Het
Gapvd1 T A 2: 34,589,876 (GRCm39) K980I possibly damaging Het
Garin5b G T 7: 4,760,727 (GRCm39) L662I Het
Garre1 C G 7: 33,984,180 (GRCm39) A148P probably damaging Het
Gata4 A C 14: 63,478,714 (GRCm39) probably benign Het
Gata4 G T 14: 63,437,831 (GRCm39) T441N probably damaging Het
Gatb G T 3: 85,544,280 (GRCm39) R416M probably damaging Het
Gbf1 G T 19: 46,247,581 (GRCm39) K226N probably damaging Het
Gbgt1 C A 2: 28,395,200 (GRCm39) C279* probably null Het
Gbp2b C A 3: 142,310,077 (GRCm39) P289Q possibly damaging Het
Gbp4 T A 5: 105,267,315 (GRCm39) R535* probably null Het
Gbp4 C A 5: 105,273,001 (GRCm39) G215C probably null Het
Gchfr A T 2: 119,000,226 (GRCm39) K36* probably null Het
Gck G T 11: 5,860,958 (GRCm39) Q38K possibly damaging Het
Gclc G T 9: 77,694,021 (GRCm39) S325I probably benign Het
Gcn1 A T 5: 115,752,208 (GRCm39) H2108L probably damaging Het
Gcnt4 G A 13: 97,082,961 (GRCm39) G86S probably damaging Het
Gcnt7 G T 2: 172,296,806 (GRCm39) T6N possibly damaging Het
Gdf2 G T 14: 33,667,274 (GRCm39) R332M probably damaging Het
Gdf5 C T 2: 155,783,992 (GRCm39) G320D possibly damaging Het
Gdpd2 T A X: 99,777,588 (GRCm39) C214S probably damaging Het
Gfer TCCC TCC 17: 24,914,861 (GRCm39) probably null Het
Gfm2 C A 13: 97,299,500 (GRCm39) T407K possibly damaging Het
Gfm2 G T 13: 97,299,501 (GRCm39) probably null Het
Gfra2 A T 14: 71,215,932 (GRCm39) Q464L not run Het
Gfral G C 9: 76,112,671 (GRCm39) L87V probably benign Het
Gfy CGGG CGG 7: 44,825,888 (GRCm39) probably null Het
Ggcx G C 6: 72,403,502 (GRCm39) G350R probably benign Het
Ggt6 C A 11: 72,327,425 (GRCm39) R103S probably benign Het
Gimap5 G T 6: 48,729,819 (GRCm39) V130L possibly damaging Het
Gimap7 AG A 6: 48,701,255 (GRCm39) probably null Het
Gimd1 G T 3: 132,340,831 (GRCm39) V116L probably benign Het
Gipr G T 7: 18,891,490 (GRCm39) Q396K probably benign Het
Gja8 G C 3: 96,827,552 (GRCm39) L37V probably damaging Het
Gjb4 T A 4: 127,245,920 (GRCm39) Q7L possibly damaging Het
Gjc2 A T 11: 59,068,443 (GRCm39) L13Q probably damaging Het
Gjc3 C A 5: 137,955,823 (GRCm39) G154V probably damaging Het
Glb1 G C 9: 114,249,490 (GRCm39) E106D probably damaging Het
Glb1l3 A T 9: 26,729,541 (GRCm39) L642Q probably damaging Het
Gldc C A 19: 30,088,178 (GRCm39) G827C probably damaging Het
Gldc A T 19: 30,123,148 (GRCm39) V249D possibly damaging Het
Gldc C A 19: 30,088,179 (GRCm39) M826I probably damaging Het
Gldn C G 9: 54,193,944 (GRCm39) A46G probably benign Het
Gli1 G C 10: 127,171,867 (GRCm39) R296G probably damaging Het
Gli1 T A 10: 127,170,126 (GRCm39) K343M probably damaging Het
Gli1 G T 10: 127,172,560 (GRCm39) P194Q probably benign Het
Glipr1l1 C A 10: 111,914,295 (GRCm39) H219N probably benign Het
Glra4 C A X: 135,658,566 (GRCm39) R417L possibly damaging Het
Glrp1 C T 1: 88,437,524 (GRCm39) G29R not run Het
Glud1 C T 14: 34,032,826 (GRCm39) probably benign Het
Glyr1 C A 16: 4,849,837 (GRCm39) D179Y probably null Het
Gm10378 G T 14: 42,479,081 (GRCm39) M76I Het
Gm10382 C A 5: 125,466,488 (GRCm39) P35T unknown Het
Gm11559 CTGTGTGT CTGTGT 11: 99,755,589 (GRCm39) probably null Het
Gm12185 C T 11: 48,807,129 (GRCm39) V21M probably benign Het
Gm12695 C A 4: 96,637,460 (GRCm39) K352N probably damaging Het
Gm12886 A T 4: 121,273,916 (GRCm39) L100* probably null Het
Gm13102 G C 4: 143,835,872 (GRCm39) M513I unknown Het
Gm13889 C G 2: 93,787,170 (GRCm39) E101D unknown Het
Gm13941 T A 2: 110,925,123 (GRCm39) D160V unknown Het
Gm14569 G T X: 35,697,524 (GRCm39) P395Q probably benign Het
Gm15557 G T 2: 155,784,388 (GRCm39) A226S probably benign Het
Gm15737 G T 6: 92,856,872 (GRCm39) W100C unknown Het
Gm17019 A C 5: 15,082,945 (GRCm39) L3W probably damaging Het
Gm17067 A C 7: 42,357,722 (GRCm39) V260G probably benign Het
Gm17455 G T 10: 60,238,794 (GRCm39) A20S probably benign Het
Gm18596 C T 10: 77,578,455 (GRCm39) M6I unknown Het
Gm19410 A T 8: 36,276,119 (GRCm39) Q1592L possibly damaging Het
Gm20379 C G 13: 92,442,667 (GRCm39) P60R unknown Het
Gm21083 T G 5: 15,782,456 (GRCm39) V41G probably benign Het
Gm21149 G C 5: 15,681,410 (GRCm39) R18G not run Het
Gm21149 G T 5: 15,677,146 (GRCm39) A236D probably damaging Het
Gm21190 A C 5: 15,729,972 (GRCm39) D215E not run Het
Gm21190 G T 5: 15,730,805 (GRCm39) Q184K probably benign Het
Gm21190 G A 5: 15,729,892 (GRCm39) P242L probably benign Het
Gm21680 A T 5: 26,177,493 (GRCm39) S32T probably benign Het
Gm28729 C A 9: 96,379,060 (GRCm39) probably null Het
Gm32742 C T 9: 51,069,576 (GRCm39) probably null Het
Gm32742 T A 9: 51,060,606 (GRCm39) H899L probably benign Het
Gm3327 G T 14: 44,362,257 (GRCm39) G52V Het
Gm3404 C A 5: 146,463,026 (GRCm39) Y69* probably null Het
Gm40460 C T 7: 141,794,643 (GRCm39) S58N unknown Het
Gm40460 A T 7: 141,794,509 (GRCm39) C103S unknown Het
Gm4131 T A 14: 62,718,471 (GRCm39) H45L possibly damaging Het
Gm42669 C A 5: 107,726,456 (GRCm39) Q558K unknown Het
Gm43302 T A 5: 105,424,662 (GRCm39) Q326L probably damaging Het
Gm44511 T A 6: 128,797,301 (GRCm39) probably null Het
Gm4559 C A 7: 141,827,771 (GRCm39) Q110H unknown Het
Gm45837 G A 7: 101,100,672 (GRCm39) A51T probably benign Het
Gm45861 G C 8: 28,025,397 (GRCm39) E772Q unknown Het
Gm45861 G T 8: 28,059,979 (GRCm39) G1147C unknown Het
Gm4847 G C 1: 166,462,342 (GRCm39) L383V probably damaging Het
Gm4884 G T 7: 40,682,161 (GRCm39) probably benign Het
Gm4894 C T 9: 49,190,079 (GRCm39) A118V unknown Het
Gm49358 G T 10: 86,647,446 (GRCm39) G88V Het
Gm49368 G T 7: 127,712,239 (GRCm39) G825V probably damaging Het
Gm5114 G T 7: 39,058,750 (GRCm39) Q290K probably benign Het
Gm5145 G T 17: 20,791,314 (GRCm39) G231C probably damaging Het
Gm5148 G A 3: 37,769,154 (GRCm39) A22V probably benign Het
Gm5157 C T 7: 20,919,241 (GRCm39) E101K probably benign Het
Gm5460 C G 14: 33,767,791 (GRCm39) C191W probably benign Het
Gm5797 G A 14: 7,329,383 (GRCm38) Q202* probably null Het
Gm6358 T A 16: 88,937,975 (GRCm39) C71* probably null Het
Gm7168 G C 17: 14,169,344 (GRCm39) G237A probably damaging Het
Gm7168 A T 17: 14,170,019 (GRCm39) K462M probably benign Het
Gm7168 G A 17: 14,169,932 (GRCm39) C433Y probably damaging Het
Gm7361 C G 5: 26,466,186 (GRCm39) H183D probably benign Het
Gm8297 G T 14: 16,167,810 (GRCm39) R150L probably benign Het
Gm8947 C A 1: 151,068,335 (GRCm39) S56Y possibly damaging Het
Gm9195 C A 14: 72,680,442 (GRCm39) L2207F possibly damaging Het
Gm9195 AGGGGG AGGGGGGG 14: 72,690,874 (GRCm39) probably null Het
Gm973 C T 1: 59,580,489 (GRCm39) A124V probably damaging Het
Gm9758 C T 5: 14,960,599 (GRCm39) A212T Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gm9758 T A 5: 14,961,472 (GRCm39) Q169L possibly damaging Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9958 G T 5: 90,515,857 (GRCm39) R52M unknown Het
Gna13 G T 11: 109,287,028 (GRCm39) V284F probably damaging Het
Gnai1 C A 5: 18,513,550 (GRCm39) probably null Het
Gnas G T 2: 174,126,680 (GRCm39) A72S unknown Het
Gnat2 T A 3: 108,007,360 (GRCm39) F259L Het
Gnat3 C A 5: 18,220,311 (GRCm39) C224* probably null Het
Gnaz G T 10: 74,850,792 (GRCm39) K272N Het
Gnpat G A 8: 125,590,035 (GRCm39) S20N probably benign Het
Gnptab G T 10: 88,276,132 (GRCm39) A1140S probably damaging Het
Golga5 A T 12: 102,438,264 (GRCm39) probably benign Het
Gon4l C T 3: 88,766,343 (GRCm39) P461S probably damaging Het
Gopc C T 10: 52,226,759 (GRCm39) G277S probably damaging Het
Gp1ba C G 11: 70,530,233 (GRCm39) probably benign Het
Gpatch2 G T 1: 186,957,888 (GRCm39) W81L probably damaging Het
Gpc1 G T 1: 92,785,208 (GRCm39) K382N probably damaging Het
Gpha2 C G 19: 6,277,053 (GRCm39) H51Q probably damaging Het
Gpi1 C A 7: 33,905,070 (GRCm39) probably null Het
Gpkow C T X: 7,563,531 (GRCm39) R23C probably damaging Het
Gpr108 C A 17: 57,544,316 (GRCm39) G365C probably damaging Het
Gpr139 C A 7: 118,743,736 (GRCm39) R283L possibly damaging Het
Gpr141 C A 13: 19,936,614 (GRCm39) A54S possibly damaging Het
Gpr149 CA C 3: 62,511,380 (GRCm39) probably null Het
Gpr150 G T 13: 76,204,269 (GRCm39) Y225* probably null Het
Gpr156 G T 16: 37,825,225 (GRCm39) A481S probably benign Het
Gpr158 A T 2: 21,832,083 (GRCm39) D1061V possibly damaging Het
Gpr17 C A 18: 32,080,717 (GRCm39) M115I possibly damaging Het
Gpr174 T A X: 106,336,799 (GRCm39) C204S possibly damaging Het
Gpr179 G T 11: 97,242,065 (GRCm39) L260I probably damaging Het
Gpr180 G T 14: 118,385,613 (GRCm39) G142W probably damaging Het
Gpr35 G T 1: 92,910,738 (GRCm39) W150L probably benign Het
Gpr62 A T 9: 106,342,688 (GRCm39) V80E possibly damaging Het
Gpr87 C A 3: 59,087,491 (GRCm39) V6L probably benign Het
Gprc6a C A 10: 51,491,305 (GRCm39) V815L probably damaging Het
Gprin2 G A 14: 33,917,080 (GRCm39) P230L probably damaging Het
Greb1 C A 12: 16,752,492 (GRCm39) G950V probably damaging Het
Grem1 C G 2: 113,579,994 (GRCm39) R169T possibly damaging Het
Grhl2 G T 15: 37,333,531 (GRCm39) G429W unknown Het
Grhl3 G C 4: 135,279,997 (GRCm39) I352M possibly damaging Het
Grid2 G T 6: 64,322,841 (GRCm39) G614W probably damaging Het
Grid2 T A 6: 64,322,840 (GRCm39) Y613* probably null Het
Grik1 C T 16: 87,743,572 (GRCm39) G537S Het
Grik3 C A 4: 125,544,299 (GRCm39) A340E possibly damaging Het
Grik5 T A 7: 24,715,250 (GRCm39) T674S probably damaging Het
Grin2a C A 16: 9,481,441 (GRCm39) K453N possibly damaging Het
Grin2d C A 7: 45,482,601 (GRCm39) G1192V unknown Het
Grip1 G T 10: 119,822,349 (GRCm39) M437I probably benign Het
Grm2 C A 9: 106,522,264 (GRCm39) V580F possibly damaging Het
Grm4 C A 17: 27,669,168 (GRCm39) E367* probably null Het
Grm4 G T 17: 27,669,195 (GRCm39) R358S probably benign Het
Grm6 C T 11: 50,742,327 (GRCm39) A120V probably benign Het
Grm6 G C 11: 50,742,089 (GRCm39) V41L probably benign Het
Grm6 A T 11: 50,750,694 (GRCm39) Y619F probably damaging Het
Grpel2 C T 18: 61,852,843 (GRCm39) G53E possibly damaging Het
Gsap G T 5: 21,456,030 (GRCm39) R409I probably damaging Het
Gse1 A C 8: 120,956,591 (GRCm39) T361P unknown Het
Gsg1l C A 7: 125,681,414 (GRCm39) probably benign Het
Gsk3a C A 7: 24,936,953 (GRCm39) G45C unknown Het
Gsta1 G T 9: 78,139,524 (GRCm39) M1I probably null Het
Gstp2 C T 19: 4,091,583 (GRCm39) probably null Het
Gstp3 C G 19: 4,108,154 (GRCm39) V90L probably benign Het
Gtf3c1 C T 7: 125,266,294 (GRCm39) S1014N probably benign Het
Gtf3c4 T A 2: 28,725,085 (GRCm39) S216C probably damaging Het
Gtpbp3 A T 8: 71,941,713 (GRCm39) probably null Het
Gtse1 G T 15: 85,759,938 (GRCm39) A710S probably damaging Het
Guca1a T C 17: 47,711,335 (GRCm39) I4V probably benign Het
Gucy1a2 C T 9: 3,797,245 (GRCm39) T565I probably damaging Het
Gucy1b1 G T 3: 81,968,419 (GRCm39) A29E probably damaging Het
Gucy1b2 C A 14: 62,690,902 (GRCm39) G42C unknown Het
Gucy2c C A 6: 136,696,685 (GRCm39) R704L probably damaging Het
Gucy2c G T 6: 136,744,194 (GRCm39) T135K probably benign Het
Gucy2g C T 19: 55,198,809 (GRCm39) R778H probably benign Het
Gusb C T 5: 130,031,577 (GRCm39) M27I probably benign Het
Gykl1 G T 18: 52,828,204 (GRCm39) V471L possibly damaging Het
Gypa C A 8: 81,227,627 (GRCm39) H92N unknown Het
Gzmm TGG T 10: 79,530,840 (GRCm39) probably null Het
H1f11-ps G A 19: 47,159,570 (GRCm39) P2S probably benign Het
H1f2 G T 13: 23,923,202 (GRCm39) G124V unknown Het
H1f7 G T 15: 98,155,128 (GRCm39) P7H probably damaging Het
H2ac11 C A 13: 22,226,974 (GRCm39) E42* probably null Het
H2ac12 C G 13: 22,219,520 (GRCm39) G68A probably damaging Het
H2-M10.3 G T 17: 36,677,471 (GRCm39) A269D probably damaging Het
H2-M10.3 C A 17: 36,678,436 (GRCm39) G130W probably damaging Het
H2-Q2 C G 17: 35,561,318 (GRCm39) R4G unknown Het
H2-Q5 G T 17: 35,613,480 (GRCm39) R71L Het
H2-Q7 G T 17: 35,658,138 (GRCm39) probably benign Het
H2-Q7 G T 17: 35,661,476 (GRCm39) V282L probably damaging Het
H2-T5 C A 17: 36,476,604 (GRCm39) G262V probably damaging Het
H3c1 C T 13: 23,946,005 (GRCm39) C111Y probably damaging Het
H3c1 C A 13: 23,946,233 (GRCm39) G35V possibly damaging Het
H3c11 C T 13: 21,967,273 (GRCm39) V90I probably benign Het
H3c15 G T 3: 96,145,864 (GRCm39) R132S probably damaging Het
H3c7 G T 13: 23,728,726 (GRCm39) K24N probably damaging Het
H3f3b C G 11: 115,914,733 (GRCm39) G35R probably benign Het
Habp2 G GT 19: 56,307,985 (GRCm39) probably null Het
Habp4 G C 13: 64,321,884 (GRCm39) D174H probably damaging Het
Habp4 T G 13: 64,321,882 (GRCm39) V173G probably benign Het
Hal G T 10: 93,325,197 (GRCm39) E69* probably null Het
Hand2 G A 8: 57,775,048 (GRCm39) S36N probably benign Het
Hao2 C A 3: 98,789,258 (GRCm39) Q143H probably benign Het
Hao2 G T 3: 98,789,357 (GRCm39) S110R probably damaging Het
Hars2 A T 18: 36,922,628 (GRCm39) E387V probably damaging Het
Hars2 G T 18: 36,923,651 (GRCm39) V481L possibly damaging Het
Has2 C A 15: 56,544,979 (GRCm39) V208L probably benign Het
Has3 C G 8: 107,600,650 (GRCm39) H37Q probably benign Het
Haus4 C A 14: 54,787,417 (GRCm39) L44F probably damaging Het
Havcr1 C T 11: 46,666,325 (GRCm39) L263F probably benign Het
Hbb-bt G C 7: 103,462,796 (GRCm39) I55M possibly damaging Het
Hc T A 2: 34,903,622 (GRCm39) S1011C probably damaging Het
Hcar2 G T 5: 124,003,269 (GRCm39) P78Q probably damaging Het
Hcrtr1 C A 4: 130,027,666 (GRCm39) E263* probably null Het
Hdac11 G T 6: 91,144,816 (GRCm39) R148L possibly damaging Het
Hdac3 C A 18: 38,078,804 (GRCm39) E102D probably benign Het
Hdac4 A T 1: 91,915,333 (GRCm39) N303K probably damaging Het
Hdac4 C A 1: 91,883,769 (GRCm39) D870Y probably damaging Het
Hdac6 C A X: 7,804,224 (GRCm39) E450* probably null Het
Hdgfl2 G T 17: 56,406,343 (GRCm39) G576V unknown Het
Heatr4 C G 12: 84,027,252 (GRCm39) A2P probably benign Het
Heatr6 G T 11: 83,672,208 (GRCm39) R1072L probably damaging Het
Heatr6 G T 11: 83,656,907 (GRCm39) A390S probably benign Het
Hectd3 G T 4: 116,855,957 (GRCm39) D419Y probably damaging Het
Hectd4 T A 5: 121,496,383 (GRCm39) M3925K probably benign Het
Hecw2 T A 1: 53,963,102 (GRCm39) Q803L possibly damaging Het
Heg1 G T 16: 33,541,057 (GRCm39) G405C probably damaging Het
Helb T G 10: 119,928,595 (GRCm39) probably null Het
Helz2 C A 2: 180,877,754 (GRCm39) G1015C probably damaging Het
Hemgn G A 4: 46,400,693 (GRCm39) L56F possibly damaging Het
Hepacam2 G T 6: 3,483,352 (GRCm39) T219N probably benign Het
Hephl1 A C 9: 15,001,350 (GRCm39) D258E probably damaging Het
Herc1 G A 9: 66,365,707 (GRCm39) S354N probably null Het
Herc1 G A 9: 66,379,193 (GRCm39) S3493N probably damaging Het
Herc2 G T 7: 55,771,337 (GRCm39) R1033L possibly damaging Het
Herc2 G A 7: 55,781,040 (GRCm39) G1235D probably benign Het
Herpud2 C G 9: 25,041,918 (GRCm39) V85L not run Het
Hes5 G T 4: 155,045,899 (GRCm39) G91C probably damaging Het
Hfe C A 13: 23,890,020 (GRCm39) W251L probably damaging Het
Hfm1 C G 5: 107,019,686 (GRCm39) D1116H probably benign Het
Hgd T G 16: 37,410,081 (GRCm39) L39R probably damaging Het
Hgs A T 11: 120,369,391 (GRCm39) Q360L probably benign Het
Hhat C A 1: 192,343,800 (GRCm39) probably null Het
Hhip GCCCC GCCCCC 8: 80,783,880 (GRCm39) probably null Het
Hhla1 G A 15: 65,813,624 (GRCm39) T236I probably damaging Het
Hibadh C A 6: 52,596,980 (GRCm39) D155Y probably damaging Het
Hid1 G T 11: 115,243,551 (GRCm39) S499Y probably damaging Het
Hip1 C A 5: 135,457,460 (GRCm39) R722I probably benign Het
Hira G T 16: 18,730,899 (GRCm39) K199N probably damaging Het
Hivep1 G T 13: 42,313,457 (GRCm39) R1899M possibly damaging Het
Hivep2 G A 10: 14,007,530 (GRCm39) G1376E probably damaging Het
Hivep2 G T 10: 14,019,051 (GRCm39) V1941F probably damaging Het
Hivep3 G T 4: 119,953,143 (GRCm39) R486S possibly damaging Het
Hivep3 G T 4: 119,988,975 (GRCm39) E1809* probably null Het
Hjv G T 3: 96,435,403 (GRCm39) M220I probably benign Het
Hjv G A 3: 96,434,513 (GRCm39) R84Q possibly damaging Het
Hk3 C A 13: 55,158,521 (GRCm39) G615C probably damaging Het
Hk3 A G 13: 55,158,523 (GRCm39) L614P probably damaging Het
Hmces G T 6: 87,913,112 (GRCm39) W289L possibly damaging Het
Hmcn2 G T 2: 31,234,518 (GRCm39) G311V probably damaging Het
Hmcn2 C A 2: 31,316,836 (GRCm39) S3805Y probably damaging Het
Hmox2 G T 16: 4,574,992 (GRCm39) probably benign Het
Hmx2 GC G 7: 131,157,263 (GRCm39) probably null Het
Hmx3 G T 7: 131,144,849 (GRCm39) R53L probably benign Het
Hnrnpa2b1 C A 6: 51,441,509 (GRCm39) S247I unknown Het
Hnrnpc C A 14: 52,314,886 (GRCm39) R180M possibly damaging Het
Hnrnpll C A 17: 80,356,039 (GRCm39) R316L probably benign Het
Hnrnpm C A 17: 33,865,719 (GRCm39) G637V probably damaging Het
Hnrnpm C A 17: 33,877,375 (GRCm39) M368I probably benign Het
Hoxa11 C A 6: 52,222,090 (GRCm39) E204* probably null Het
Hoxa4 G A 6: 52,168,616 (GRCm39) P18L unknown Het
Hoxb2 C A 11: 96,242,815 (GRCm39) A60D probably damaging Het
Hoxd11 G T 2: 74,512,759 (GRCm39) G8V probably damaging Het
Hoxd9 C A 2: 74,528,869 (GRCm39) P157Q probably benign Het
Hp1bp3 C T 4: 137,948,984 (GRCm39) L16F not run Het
Hpf1 A G 8: 61,348,669 (GRCm39) H128R probably damaging Het
Hps1 T G 19: 42,754,657 (GRCm39) probably null Het
Hps1 C A 19: 42,744,135 (GRCm39) V693L probably benign Het
Hps1 C A 19: 42,748,270 (GRCm39) G552C probably damaging Het
Hps3 C A 3: 20,063,065 (GRCm39) G833C probably damaging Het
Hps4 G T 5: 112,518,243 (GRCm39) G412V probably damaging Het
Hrc C T 7: 44,986,394 (GRCm39) P515L probably benign Het
Hrg G T 16: 22,772,462 (GRCm39) W90C probably damaging Het
Hsd17b1 G T 11: 100,970,571 (GRCm39) D209Y probably damaging Het
Hsd17b4 G A 18: 50,315,047 (GRCm39) V605M probably benign Het
Hsf5 G T 11: 87,528,959 (GRCm39) G565* probably null Het
Hsp90aa1 G A 12: 110,659,900 (GRCm39) P396L probably damaging Het
Hspa1l C T 17: 35,196,992 (GRCm39) R344C probably benign Het
Hspa8 A C 9: 40,714,098 (GRCm39) K159Q probably damaging Het
Hspa8 G A 9: 40,714,101 (GRCm39) D160N probably damaging Het
Hspa9 C A 18: 35,076,198 (GRCm39) Q371H possibly damaging Het
Hspd1 T G 1: 55,119,425 (GRCm39) T351P probably damaging Het
Hspg2 G T 4: 137,277,778 (GRCm39) G2959V probably damaging Het
Hspg2 G T 4: 137,295,684 (GRCm39) Q4239H possibly damaging Het
Hspg2 C A 4: 137,291,829 (GRCm39) L3975I probably damaging Het
Htatsf1 A G X: 56,111,073 (GRCm39) E378G probably damaging Het
Htr1a T G 13: 105,581,384 (GRCm39) L208R probably damaging Het
Htr4 C G 18: 62,570,679 (GRCm39) Q245E probably benign Het
Htr5b C T 1: 121,455,468 (GRCm39) D151N probably damaging Het
Htra2 C T 6: 83,030,737 (GRCm39) D190N probably damaging Het
Htt G T 5: 35,009,575 (GRCm39) A1519S probably null Het
Hunk G T 16: 90,278,209 (GRCm39) K415N possibly damaging Het
Hus1b C A 13: 31,130,975 (GRCm39) R228L probably benign Het
Hydin C A 8: 111,107,242 (GRCm39) P473Q probably damaging Het
Hydin T A 8: 111,336,621 (GRCm39) C5133S probably benign Het
Hydin CG C 8: 111,313,774 (GRCm39) probably null Het
Hydin C A 8: 111,176,864 (GRCm39) H973Q possibly damaging Het
Hykk G T 9: 54,853,713 (GRCm39) W345L possibly damaging Het
Iars2 T A 1: 185,048,092 (GRCm39) R547* probably null Het
Icam5 G T 9: 20,946,844 (GRCm39) L457F possibly damaging Het
Idh3a G T 9: 54,503,433 (GRCm39) R164L probably damaging Het
Idi1 G T 13: 8,938,055 (GRCm39) R167L probably damaging Het
Idua AGG AG 5: 108,828,489 (GRCm39) probably null Het
Idua G C 5: 108,827,450 (GRCm39) G128R probably null Het
Ifi207 C A 1: 173,557,145 (GRCm39) G531V probably damaging Het
Ifi27l2b C A 12: 103,422,119 (GRCm39) V82F probably damaging Het
Ifi44 G T 3: 151,455,075 (GRCm39) T50N probably damaging Het
Ifi47 G T 11: 48,987,102 (GRCm39) E290* probably null Het
Ifna13 C A 4: 88,562,615 (GRCm39) R3M probably benign Het
Igf2bp3 G T 6: 49,191,362 (GRCm39) P15H possibly damaging Het
Igf2r G T 17: 12,916,286 (GRCm39) L1691M probably damaging Het
Igfn1 C A 1: 135,897,305 (GRCm39) W1087L probably benign Het
Igfn1 C T 1: 135,910,164 (GRCm39) C140Y possibly damaging Het
Igfn1 C A 1: 135,883,547 (GRCm39) G2653V probably damaging Het
Ighg2c C A 12: 113,251,300 (GRCm39) L238F Het
Ighmbp2 C A 19: 3,321,665 (GRCm39) E365* probably null Het
Ighmbp2 C A 19: 3,315,635 (GRCm39) R595L probably damaging Het
Ighmbp2 C A 19: 3,317,242 (GRCm39) Q543H probably null Het
Ighv1-23 A C 12: 114,728,305 (GRCm39) L39R probably damaging Het
Ighv1-4 G T 12: 114,451,024 (GRCm39) A28D possibly damaging Het
Ighv1-58 C T 12: 115,275,944 (GRCm39) E65K possibly damaging Het
Ighv16-1 T C 12: 114,032,745 (GRCm39) E19G possibly damaging Het
Ighv1-64 G A 12: 115,471,286 (GRCm39) T77I probably benign Het
Ighv1-69 A C 12: 115,586,873 (GRCm39) S87A probably benign Het
Ighv1-72 C T 12: 115,721,821 (GRCm39) G45D probably damaging Het
Ighv1-9 C A 12: 114,547,319 (GRCm39) S74I probably benign Het
Ighv2-3 G C 12: 113,575,211 (GRCm39) C9W possibly damaging Het
Ighv7-3 C G 12: 114,116,908 (GRCm39) V85L probably benign Het
Igkv1-117 C A 6: 68,098,578 (GRCm39) C42* probably null Het
Igkv13-84 AGG AG 6: 68,916,844 (GRCm39) probably null Het
Igkv3-2 G T 6: 70,675,999 (GRCm39) E103* probably null Het
Igkv3-2 A T 6: 70,676,030 (GRCm39) Q113L probably benign Het
Igkv3-5 C A 6: 70,640,654 (GRCm39) A45D probably damaging Het
Igkv4-79 C T 6: 69,020,043 (GRCm39) G91R probably damaging Het
Igkv8-19 T A 6: 70,317,905 (GRCm39) E107V probably damaging Het
Igkv8-19 C T 6: 70,317,906 (GRCm39) E107K possibly damaging Het
Iglv3 G A 16: 19,060,202 (GRCm39) T42I probably damaging Het
Igsf10 C A 3: 59,237,026 (GRCm39) E1052* probably null Het
Igsf5 C A 16: 96,179,533 (GRCm39) Q209K probably benign Het
Igsf9 C A 1: 172,322,439 (GRCm39) P545T probably damaging Het
Igsf9b C A 9: 27,245,588 (GRCm39) P1185H probably damaging Het
Iigp1c C G 18: 60,379,368 (GRCm39) T301S probably benign Het
Ikzf4 C A 10: 128,478,509 (GRCm39) R92L possibly damaging Het
Il10 G C 1: 130,949,132 (GRCm39) A98P probably damaging Het
Il17rd A C 14: 26,822,218 (GRCm39) H648P probably damaging Het
Il17re G T 6: 113,441,753 (GRCm39) R216L possibly damaging Het
Il1b C A 2: 129,211,665 (GRCm39) E18D probably benign Het
Il1rapl1 C A X: 85,792,070 (GRCm39) D417Y probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Il20 C T 1: 130,839,124 (GRCm39) probably benign Het
Il22ra1 C A 4: 135,464,717 (GRCm39) P141H probably damaging Het
Il25 G T 14: 55,172,664 (GRCm39) G120C probably damaging Het
Il27ra TCCC TCC 8: 84,767,604 (GRCm39) probably null Het
Il31 C A 5: 123,618,642 (GRCm39) W111L probably benign Het
Il31 G T 5: 123,618,768 (GRCm39) S69* probably null Het
Il5ra C A 6: 106,718,095 (GRCm39) G120* probably null Het
Il7r C T 15: 9,508,143 (GRCm39) G393D probably benign Het
Il7r G T 15: 9,510,315 (GRCm39) T246N probably benign Het
Ildr2 G T 1: 166,136,618 (GRCm39) G486C probably damaging Het
Ilvbl A T 10: 78,416,958 (GRCm39) N374Y probably damaging Het
Impa1 C A 3: 10,381,134 (GRCm39) Q249H probably benign Het
Impa2 G T 18: 67,442,122 (GRCm39) R114S probably benign Het
Impact G T 18: 13,121,423 (GRCm39) R246L probably damaging Het
Ina G T 19: 47,003,350 (GRCm39) A53S Het
Inafm1 C G 7: 16,007,142 (GRCm39) G25A unknown Het
Incenp C A 19: 9,876,728 (GRCm39) probably benign Het
Inpp5a T G 7: 139,105,691 (GRCm39) L214R probably damaging Het
Inpp5j G T 11: 3,452,191 (GRCm39) P353Q probably damaging Het
Insm2 C T 12: 55,647,141 (GRCm39) P295L probably benign Het
Insrr C G 3: 87,708,134 (GRCm39) S192W possibly damaging Het
Insyn2b G A 11: 34,353,188 (GRCm39) C410Y probably damaging Het
Insyn2b C A 11: 34,352,725 (GRCm39) P256T probably benign Het
Ints1 C A 5: 139,757,393 (GRCm39) V375L possibly damaging Het
Ints3 C T 3: 90,313,663 (GRCm39) G322S probably damaging Het
Ints5 G T 19: 8,872,299 (GRCm39) R86L probably benign Het
Ints5 G T 19: 8,872,337 (GRCm39) G99C probably damaging Het
Ints7 G T 1: 191,342,570 (GRCm39) S522I probably benign Het
Intu A T 3: 40,651,946 (GRCm39) H801L possibly damaging Het
Ipo8 T G 6: 148,698,210 (GRCm39) K604Q probably damaging Het
Iqca1l G T 5: 24,755,793 (GRCm39) P243H probably benign Het
Iqcf1 AC A 9: 106,379,313 (GRCm39) probably null Het
Iqcg G A 16: 32,849,390 (GRCm39) Q299* probably null Het
Iqcn C G 8: 71,169,752 (GRCm39) R1281G possibly damaging Het
Iqgap3 G T 3: 87,996,278 (GRCm39) probably null Het
Irag2 C A 6: 145,093,800 (GRCm39) Q121K probably benign Het
Irf4 T G 13: 30,934,644 (GRCm39) L28V probably damaging Het
Irf4 G C 13: 30,934,646 (GRCm39) L28F probably damaging Het
Irgc C A 7: 24,132,380 (GRCm39) V146L probably benign Het
Irs1 C A 1: 82,268,115 (GRCm39) A34S probably benign Het
Irs1 C G 1: 82,266,717 (GRCm39) A500P possibly damaging Het
Irx2 C T 13: 72,777,208 (GRCm39) Q10* probably null Het
Ism2 A T 12: 87,326,809 (GRCm39) W377R probably damaging Het
Isx GCCCC GCCC 8: 75,618,487 (GRCm39) probably null Het
Itch A T 2: 155,050,979 (GRCm39) R555S probably damaging Het
Itga1 C T 13: 115,121,607 (GRCm39) probably null Het
Itga2 C G 13: 114,990,237 (GRCm39) probably null Het
Itga2b C A 11: 102,357,902 (GRCm39) G200V probably damaging Het
Itga3 C T 11: 94,947,600 (GRCm39) G668E probably damaging Het
Itga7 G T 10: 128,779,083 (GRCm39) W369C probably damaging Het
Itga8 C A 2: 12,305,744 (GRCm39) S82I possibly damaging Het
Itgad C T 7: 127,788,673 (GRCm39) P467S probably damaging Het
Itgax G T 7: 127,747,234 (GRCm39) W982C probably benign Het
Itgb2l G T 16: 96,238,556 (GRCm39) P81H probably damaging Het
Itgb4 T A 11: 115,877,637 (GRCm39) L552Q probably damaging Het
Itgb4 C G 11: 115,888,884 (GRCm39) R1076G probably benign Het
Itih1 C G 14: 30,651,529 (GRCm39) D892H possibly damaging Het
Itm2a C A X: 106,442,734 (GRCm39) D137Y probably damaging Het
Itpka C T 2: 119,581,256 (GRCm39) R430W probably damaging Het
Itpka C A 2: 119,579,902 (GRCm39) H214N probably benign Het
Itpkc TC T 7: 26,927,206 (GRCm39) probably null Het
Itpr3 G C 17: 27,333,903 (GRCm39) R2020P probably damaging Het
Itpr3 G A 17: 27,338,961 (GRCm39) D2581N probably damaging Het
Itprid1 G T 6: 55,945,219 (GRCm39) G647C probably damaging Het
Jade2 C T 11: 51,707,817 (GRCm39) D799N probably damaging Het
Jade2 C A 11: 51,739,821 (GRCm39) G20C probably null Het
Jag1 C A 2: 136,926,939 (GRCm39) S940I probably benign Het
Jakmip1 C T 5: 37,248,927 (GRCm39) R196C probably damaging Het
Jakmip1 AG A 5: 37,332,651 (GRCm39) probably null Het
Jmjd1c T C 10: 67,073,953 (GRCm39) L1896P probably benign Het
Jmjd1c A G 10: 67,081,904 (GRCm39) I2161M probably damaging Het
Jmjd4 G T 11: 59,341,100 (GRCm39) E10D probably benign Het
Jph2 T A 2: 163,218,297 (GRCm39) probably null Het
Jph4 C A 14: 55,352,383 (GRCm39) G117C probably damaging Het
Kalrn C A 16: 33,855,876 (GRCm39) G1920V probably damaging Het
Kank2 T A 9: 21,706,545 (GRCm39) T158S probably damaging Het
Kat6a G T 8: 23,430,182 (GRCm39) G1846W unknown Het
Kazn G T 4: 141,881,815 (GRCm39) H142N Het
Kbtbd11 G C 8: 15,077,694 (GRCm39) E98Q probably benign Het
Kbtbd12 C A 6: 88,595,650 (GRCm39) C60F probably damaging Het
Kcna5 G T 6: 126,510,953 (GRCm39) R392S probably damaging Het
Kcna7 G C 7: 45,058,607 (GRCm39) R298P probably damaging Het
Kcnab1 C A 3: 65,173,931 (GRCm39) L81I probably damaging Het
Kcnab1 C A 3: 65,264,554 (GRCm39) H268N probably benign Het
Kcnb2 G T 1: 15,781,182 (GRCm39) G685C possibly damaging Het
Kcnc1 C G 7: 46,047,276 (GRCm39) R59G probably damaging Het
Kcnc2 G T 10: 112,108,211 (GRCm39) G201W probably damaging Het
Kcnc3 G T 7: 44,245,530 (GRCm39) G607W probably damaging Het
Kcnd2 G T 6: 21,216,415 (GRCm39) D40Y probably damaging Het
Kcnd3 ACC A 3: 105,366,886 (GRCm39) probably null Het
Kcnh5 G T 12: 75,054,571 (GRCm39) L458I possibly damaging Het
Kcnh5 G C 12: 75,161,296 (GRCm39) P204R probably damaging Het
Kcnh8 C G 17: 53,285,121 (GRCm39) C1030W possibly damaging Het
Kcnh8 G C 17: 53,110,499 (GRCm39) V237L probably damaging Het
Kcnip3 C A 2: 127,352,801 (GRCm39) A73S probably benign Het
Kcnj1 C T 9: 32,308,655 (GRCm39) L360F probably damaging Het
Kcnj10 C A 1: 172,196,702 (GRCm39) S72Y possibly damaging Het
Kcnj10 C A 1: 172,196,788 (GRCm39) P101T probably benign Het
Kcnj14 G T 7: 45,469,333 (GRCm39) C57* probably null Het
Kcnj16 G A 11: 110,916,596 (GRCm39) M419I probably benign Het
Kcnj16 G T 11: 110,915,379 (GRCm39) D14Y possibly damaging Het
Kcnj4 C G 15: 79,369,370 (GRCm39) W203C probably damaging Het
Kcnj5 G T 9: 32,228,994 (GRCm39) P381H possibly damaging Het
Kcnj9 G T 1: 172,150,750 (GRCm39) Q288K possibly damaging Het
Kcnk1 A C 8: 126,756,392 (GRCm39) T305P probably benign Het
Kcnk12 G A 17: 88,053,471 (GRCm39) P397L probably benign Het
Kcnk13 A T 12: 100,027,788 (GRCm39) N288Y possibly damaging Het
Kcnk18 C CA 19: 59,213,911 (GRCm39) probably null Het
Kcnk3 G T 5: 30,780,048 (GRCm39) G366V possibly damaging Het
Kcnk3 G T 5: 30,745,618 (GRCm39) probably benign Het
Kcnk3 G C 5: 30,779,837 (GRCm39) A296P probably benign Het
Kcnk5 C A 14: 20,231,442 (GRCm39) E27* probably null Het
Kcnk5 G C 14: 20,195,118 (GRCm39) P124R probably damaging Het
Kcnn3 G T 3: 89,568,443 (GRCm39) A574S possibly damaging Het
Kcnn3 G A 3: 89,428,230 (GRCm39) G152E probably damaging Het
Kcnq1 G T 7: 142,662,201 (GRCm39) probably benign Het
Kcnq3 G C 15: 65,867,301 (GRCm39) R781G possibly damaging Het
Kcnt1 G T 2: 25,791,240 (GRCm39) E528* probably null Het
Kcnt1 C T 2: 25,799,277 (GRCm39) R949* probably null Het
Kcnt2 C A 1: 140,537,386 (GRCm39) P1115H possibly damaging Het
Kcnu1 G T 8: 26,339,792 (GRCm39) G37W probably damaging Het
Kcnv1 C A 15: 44,977,831 (GRCm39) G69V probably damaging Het
Kcnv2 C A 19: 27,300,641 (GRCm39) A164E probably benign Het
Kcp C A 6: 29,485,524 (GRCm39) V1157L probably benign Het
Kctd12 C G 14: 103,219,354 (GRCm39) G175R not run Het
Kctd19 G T 8: 106,115,149 (GRCm39) H471N probably damaging Het
Kdelr1 G T 7: 45,522,372 (GRCm39) probably benign Het
Kdm2b C A 5: 123,018,860 (GRCm39) R860L probably damaging Het
Kdm4a C T 4: 118,004,366 (GRCm39) D691N probably benign Het
Kdm5b AGG AG 1: 134,523,536 (GRCm39) probably null Het
Kdm6b T A 11: 69,294,692 (GRCm39) Q1162L unknown Het
Kdr C A 5: 76,129,135 (GRCm39) K170N probably benign Het
Kel T A 6: 41,666,493 (GRCm39) Q446L probably benign Het
Khdrbs2 C G 1: 32,283,048 (GRCm39) I53M probably benign Het
Khdrbs3 G T 15: 68,800,680 (GRCm39) R29L probably benign Het
Kif11 G T 19: 37,401,735 (GRCm39) G904V possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif14 G T 1: 136,406,103 (GRCm39) A556S probably benign Het
Kif15 G T 9: 122,780,116 (GRCm39) probably benign Het
Kif16b C G 2: 142,553,744 (GRCm39) R1018P probably damaging Het
Kif17 G T 4: 138,015,241 (GRCm39) E463D probably benign Het
Kif18a G T 2: 109,125,302 (GRCm39) D240Y probably damaging Het
Kif19a C G 11: 114,675,730 (GRCm39) R401G probably benign Het
Kif19a C A 11: 114,672,141 (GRCm39) Q243K probably benign Het
Kif19b G C 5: 140,464,740 (GRCm39) R619P probably damaging Het
Kif19b A T 5: 140,446,615 (GRCm39) probably null Het
Kif19b G C 5: 140,432,177 (GRCm39) Q39H probably damaging Het
Kif1c G T 11: 70,593,719 (GRCm39) G32C probably damaging Het
Kif20b G T 19: 34,927,866 (GRCm39) E1043* probably null Het
Kif21b C G 1: 136,076,050 (GRCm39) R280G probably damaging Het
Kif23 C G 9: 61,831,445 (GRCm39) Q708H possibly damaging Het
Kif26a G T 12: 112,144,045 (GRCm39) R1433L probably damaging Het
Kif26b C A 1: 178,742,970 (GRCm39) S1022* probably null Het
Kif26b G T 1: 178,649,115 (GRCm39) E412* probably null Het
Kif26b C G 1: 178,649,113 (GRCm39) A411G probably benign Het
Kif28 C T 1: 179,555,784 (GRCm39) R333Q not run Het
Kif3c G T 12: 3,417,245 (GRCm39) G422V probably damaging Het
Kif5a T A 10: 127,072,836 (GRCm39) K685* probably null Het
Kif5a G T 10: 127,065,692 (GRCm39) D1013E probably benign Het
Kif6 G A 17: 50,022,128 (GRCm39) A343T probably damaging Het
Kifap3 G T 1: 163,689,631 (GRCm39) W538C probably damaging Het
Kifc2 G T 15: 76,545,488 (GRCm39) E78D possibly damaging Het
Kirrel1 C A 3: 86,991,182 (GRCm39) E629* probably null Het
Kirrel2 C A 7: 30,152,171 (GRCm39) G479V probably benign Het
Kiz C A 2: 146,777,747 (GRCm39) H468Q possibly damaging Het
Klb G T 5: 65,506,084 (GRCm39) W110C probably damaging Het
Klc4 C T 17: 46,946,335 (GRCm39) probably null Het
Klf6 G T 13: 5,914,881 (GRCm39) E107* probably null Het
Klhdc3 C A 17: 46,987,677 (GRCm39) R292L probably damaging Het
Klhdc7a G C 4: 139,694,311 (GRCm39) T212R probably benign Het
Klhdc7a G T 4: 139,692,973 (GRCm39) T658N probably benign Het
Klhl11 T A 11: 100,354,792 (GRCm39) Q343L probably benign Het
Klhl14 G C 18: 21,785,161 (GRCm39) Q89E probably benign Het
Klhl15 A T X: 93,296,478 (GRCm39) R151W probably damaging Het
Klhl25 G C 7: 75,515,870 (GRCm39) D259H possibly damaging Het
Klhl29 C A 12: 5,131,152 (GRCm39) *876L probably null Het
Klhl3 C A 13: 58,157,223 (GRCm39) V588L probably benign Het
Klhl38 T A 15: 58,178,332 (GRCm39) Y546F possibly damaging Het
Klhl4 C A X: 113,461,299 (GRCm39) S560R probably damaging Het
Klhl40 G T 9: 121,609,759 (GRCm39) A515S probably benign Het
Klhl6 C A 16: 19,801,711 (GRCm39) E15* probably null Het
Klhl8 C A 5: 104,033,905 (GRCm39) R37S probably benign Het
Klk1b11 C A 7: 43,427,759 (GRCm39) L183M possibly damaging Het
Klkb1 G A 8: 45,728,509 (GRCm39) H417Y probably damaging Het
Klra3 C A 6: 130,307,084 (GRCm39) probably null Het
Klrb1c G T 6: 128,765,410 (GRCm39) P60Q probably damaging Het
Klrb1f G C 6: 129,029,466 (GRCm39) G44R possibly damaging Het
Klrc2 A T 6: 129,637,380 (GRCm39) L47Q probably benign Het
Klrg2 G A 6: 38,613,851 (GRCm39) R51C probably damaging Het
Kmo C A 1: 175,476,752 (GRCm39) L162I probably damaging Het
Kmt2a G T 9: 44,730,418 (GRCm39) P3300T unknown Het
Kmt2b C A 7: 30,274,449 (GRCm39) G2085V probably benign Het
Kmt2b C A 7: 30,285,841 (GRCm39) R350S unknown Het
Kmt2b G A 7: 30,283,588 (GRCm39) P924L probably damaging Het
Kmt2c C G 5: 25,500,395 (GRCm39) probably null Het
Kmt2c C A 5: 25,571,195 (GRCm39) probably null Het
Kmt2c C A 5: 25,505,001 (GRCm39) A3436S probably benign Het
Kmt2e G T 5: 23,686,206 (GRCm39) probably null Het
Kmt5c G T 7: 4,749,699 (GRCm39) V406L probably damaging Het
Kndc1 G T 7: 139,501,828 (GRCm39) S955I possibly damaging Het
Kng1 T G 16: 22,892,139 (GRCm39) M234R probably benign Het
Kras C A 6: 145,192,498 (GRCm39) G12C probably damaging Het
Krba1 G T 6: 48,390,190 (GRCm39) W686C probably damaging Het
Krba1 G T 6: 48,392,828 (GRCm39) R914L probably damaging Het
Krt1 C A 15: 101,754,451 (GRCm39) G600C unknown Het
Krt1 T A 15: 101,758,970 (GRCm39) S65C unknown Het
Krt10 G T 11: 99,277,058 (GRCm39) H460N unknown Het
Krt12 C A 11: 99,312,930 (GRCm39) G38V unknown Het
Krt17 C T 11: 100,150,537 (GRCm39) D167N possibly damaging Het
Krt17 A G 11: 100,150,022 (GRCm39) Y217H probably damaging Het
Krt1c C A 15: 101,719,985 (GRCm39) G562* probably null Het
Krt32 G T 11: 99,974,895 (GRCm39) R351S possibly damaging Het
Krt35 G T 11: 99,986,883 (GRCm39) R44S probably benign Het
Krt42 C A 11: 100,157,894 (GRCm39) R190L probably damaging Het
Krt6b C G 15: 101,586,767 (GRCm39) E283Q probably damaging Het
Krt7 G T 15: 101,321,348 (GRCm39) K388N probably damaging Het
Krt72 A T 15: 101,686,743 (GRCm39) L401Q probably damaging Het
Krt73 C A 15: 101,702,246 (GRCm39) R539I probably damaging Het
Krt75 G T 15: 101,479,489 (GRCm39) D280E probably benign Het
Krt78 C T 15: 101,856,095 (GRCm39) G572E probably benign Het
Krt8 T A 15: 101,907,870 (GRCm39) E235V probably damaging Het
Krt84 TG T 15: 101,434,417 (GRCm39) probably null Het
Krt86 G C 15: 101,374,778 (GRCm39) R316P probably damaging Het
Krtap1-5 G C 11: 99,471,683 (GRCm39) P37A unknown Het
Krtap28-10 C A 1: 83,019,880 (GRCm39) G87C unknown Het
Krtap5-1 C G 7: 141,850,697 (GRCm39) G37A unknown Het
Krtap5-2 C A 7: 141,729,518 (GRCm39) G54V unknown Het
Krtap5-3 G T 7: 141,755,790 (GRCm39) C209F unknown Het
Ksr2 C A 5: 117,885,473 (GRCm39) Q766K probably damaging Het
Ksr2 G C 5: 117,846,265 (GRCm39) E711Q probably damaging Het
Ktn1 G T 14: 47,929,895 (GRCm39) probably null Het
L3mbtl3 C A 10: 26,178,561 (GRCm39) G551C unknown Het
L3mbtl3 C A 10: 26,156,300 (GRCm39) E636* probably null Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Lama3 A T 18: 12,562,936 (GRCm39) probably null Het
Lama4 G T 10: 38,881,421 (GRCm39) G70V probably damaging Het
Lama4 G T 10: 38,881,420 (GRCm39) G70* probably null Het
Lama5 C A 2: 179,831,212 (GRCm39) V1816L probably damaging Het
Lama5 C A 2: 179,832,507 (GRCm39) A1681S possibly damaging Het
Lama5 C T 2: 179,840,603 (GRCm39) G599R probably damaging Het
Lama5 G C 2: 179,825,423 (GRCm39) D2450E probably benign Het
Lao1 C A 4: 118,825,568 (GRCm39) P463T probably damaging Het
Larp1 G T 11: 57,940,613 (GRCm39) E580* probably null Het
Larp7-ps A T 4: 92,079,940 (GRCm39) F16Y probably damaging Het
Larp7-ps C A 4: 92,079,473 (GRCm39) S116I possibly damaging Het
Lars2 G T 9: 123,283,847 (GRCm39) R705M probably damaging Het
Lbp C T 2: 158,162,226 (GRCm39) P263S probably benign Het
Lce1b A T 3: 92,563,342 (GRCm39) C64S unknown Het
Lce1f C T 3: 92,626,505 (GRCm39) G51S unknown Het
Lcn12 C A 2: 25,382,253 (GRCm39) G151C probably benign Het
Ldb3 G A 14: 34,266,060 (GRCm39) R512W probably damaging Het
Ldlr G A 9: 21,651,126 (GRCm39) A515T probably benign Het
Ldlrad2 G T 4: 137,301,844 (GRCm39) R13S probably benign Het
Lef1 C A 3: 130,986,830 (GRCm39) P257T probably damaging Het
Lefty2 C A 1: 180,722,343 (GRCm39) P227Q possibly damaging Het
Lep A C 6: 29,071,096 (GRCm39) Y140S probably damaging Het
Lep T A 6: 29,071,095 (GRCm39) Y140N probably damaging Het
Lepr G T 4: 101,592,792 (GRCm39) D136Y probably damaging Het
Lgals12 T A 19: 7,575,445 (GRCm39) Q297L probably benign Het
Lgals4 G C 7: 28,540,922 (GRCm39) R282P probably damaging Het
Lgr5 C G 10: 115,292,574 (GRCm39) A511P probably benign Het
Lhcgr C A 17: 89,061,333 (GRCm39) Q239H probably benign Het
Lhcgr C A 17: 89,072,409 (GRCm39) probably null Het
Lhfpl1 T G X: 144,074,161 (GRCm39) D215A probably benign Het
Lhx9 G T 1: 138,759,236 (GRCm39) P355T probably damaging Het
Lilra6 G T 7: 3,915,580 (GRCm39) T385K possibly damaging Het
Lilrb4b G T 10: 51,357,445 (GRCm39) G94C probably damaging Het
Limch1 G T 5: 67,186,142 (GRCm39) W647C probably damaging Het
Limd1 G C 9: 123,309,086 (GRCm39) A262P probably damaging Het
Lims1 T A 10: 58,245,478 (GRCm39) I169K probably benign Het
Lin28b C A 10: 45,296,702 (GRCm39) G99C probably damaging Het
Lin9 G C 1: 180,478,367 (GRCm39) W58S probably benign Het
Lingo1 C T 9: 56,528,226 (GRCm39) R127H possibly damaging Het
Lingo2 C A 4: 35,709,656 (GRCm39) R108L probably benign Het
Lingo4 C A 3: 94,310,301 (GRCm39) P413H probably damaging Het
Lipg T A 18: 75,074,411 (GRCm39) probably null Het
Lipi G T 16: 75,347,175 (GRCm39) R415S probably benign Het
Lmcd1 G C 6: 112,287,637 (GRCm39) G108R probably benign Het
Lmcd1 C A 6: 112,287,635 (GRCm39) T107N possibly damaging Het
Lmna G C 3: 88,393,543 (GRCm39) L302V probably benign Het
Lmo3 C A 6: 138,393,498 (GRCm39) A41S probably benign Het
Lmo3 C A 6: 138,393,494 (GRCm39) C42F probably damaging Het
Lmo7 G A 14: 102,135,993 (GRCm39) D689N probably damaging Het
Lmo7 G T 14: 102,133,954 (GRCm39) Q666H possibly damaging Het
Lnpk C T 2: 74,403,906 (GRCm39) M1I probably null Het
Lnx1 G T 5: 74,788,102 (GRCm39) L73I possibly damaging Het
Loxl3 G T 6: 83,015,559 (GRCm39) G222* probably null Het
Loxl3 A T 6: 83,025,141 (GRCm39) T290S probably benign Het
Lpar5 T G 6: 125,058,981 (GRCm39) L234R probably damaging Het
Lpin1 C A 12: 16,629,948 (GRCm39) D75Y Het
Lpp G T 16: 24,480,462 (GRCm39) D77Y probably damaging Het
Lrat G T 3: 82,810,797 (GRCm39) P75T probably damaging Het
Lrba G C 3: 86,447,356 (GRCm39) G2067R probably null Het
Lrfn2 G C 17: 49,377,123 (GRCm39) G68A probably benign Het
Lrfn2 C A 17: 49,403,743 (GRCm39) S622Y probably damaging Het
Lrfn2 CAA CAAA 17: 49,377,040 (GRCm39) probably null Het
Lrfn3 C A 7: 30,060,084 (GRCm39) G47V possibly damaging Het
Lrfn5 G T 12: 61,886,603 (GRCm39) L130F probably damaging Het
Lrp10 A T 14: 54,705,018 (GRCm39) Q107L possibly damaging Het
Lrp1b C T 2: 41,078,860 (GRCm39) G1864E Het
Lrp1b C G 2: 40,527,761 (GRCm39) G4367R Het
Lrp2 G T 2: 69,302,797 (GRCm39) D2977E probably benign Het
Lrp2 C A 2: 69,326,812 (GRCm39) R1753I probably damaging Het
Lrp2 C A 2: 69,331,985 (GRCm39) R1590L probably damaging Het
Lrp2 G C 2: 69,339,633 (GRCm39) L1093V probably benign Het
Lrp2 C T 2: 69,281,624 (GRCm39) D3916N probably damaging Het
Lrp3 C A 7: 34,902,437 (GRCm39) E568* probably null Het
Lrp5 C T 19: 3,678,345 (GRCm39) W503* probably null Het
Lrp6 C A 6: 134,439,504 (GRCm39) C1243F probably damaging Het
Lrp8 G C 4: 107,700,529 (GRCm39) G156R probably benign Het
Lrrc18 T A 14: 32,730,845 (GRCm39) L128Q probably damaging Het
Lrrc37a A T 11: 103,390,793 (GRCm39) L1544Q possibly damaging Het
Lrrc37a G T 11: 103,393,853 (GRCm39) P524H probably benign Het
Lrrc37a G T 11: 103,391,424 (GRCm39) P1334T probably benign Het
Lrrc37a A T 11: 103,391,346 (GRCm39) S1360T probably benign Het
Lrrc3c T G 11: 98,490,140 (GRCm39) C166G probably damaging Het
Lrrc45 A C 11: 120,609,491 (GRCm39) E418A possibly damaging Het
Lrrc45 G T 11: 120,609,479 (GRCm39) R414L probably benign Het
Lrrc49 C T 9: 60,505,376 (GRCm39) D632N possibly damaging Het
Lrrc4b G T 7: 44,094,403 (GRCm39) G24W unknown Het
Lrrc4b G T 7: 44,112,041 (GRCm39) G638* probably null Het
Lrrc4b C A 7: 44,111,335 (GRCm39) N402K probably damaging Het
Lrrc4b G T 7: 44,094,404 (GRCm39) G24V unknown Het
Lrrc4c G T 2: 97,460,828 (GRCm39) E485* probably null Het
Lrrc71 G T 3: 87,650,128 (GRCm39) H291N probably benign Het
Lrrc72 T A 12: 36,297,692 (GRCm39) probably null Het
Lrrc74b C A 16: 17,376,032 (GRCm39) probably null Het
Lrrc74b C T 16: 17,376,036 (GRCm39) A205T probably damaging Het
Lrrc8a G T 2: 30,146,325 (GRCm39) D380Y probably damaging Het
Lrrfip1 G T 1: 91,050,216 (GRCm39) G516C possibly damaging Het
Lrriq4 C G 3: 30,704,145 (GRCm39) Q58E probably benign Het
Lrrn2 T A 1: 132,866,716 (GRCm39) W594R probably benign Het
Lrrn2 G T 1: 132,865,636 (GRCm39) E234* probably null Het
Lrrtm4 C G 6: 79,999,700 (GRCm39) R371G probably benign Het
Lrwd1 T A 5: 136,160,395 (GRCm39) Q313L possibly damaging Het
Lsg1 C A 16: 30,392,107 (GRCm39) Q221H probably damaging Het
Ltbp2 C T 12: 84,876,090 (GRCm39) V506M possibly damaging Het
Ltbp3 A G 19: 5,797,758 (GRCm39) T466A probably damaging Het
Ltf C G 9: 110,853,461 (GRCm39) P237R probably damaging Het
Ltf G T 9: 110,850,073 (GRCm39) V68L probably benign Het
Ltn1 C T 16: 87,198,925 (GRCm39) C1158Y probably benign Het
Luc7l G T 17: 26,500,635 (GRCm39) W337C unknown Het
Luc7l3 GC G 11: 94,212,601 (GRCm39) probably null Het
Ly6g6f C T 17: 35,302,008 (GRCm39) V149M possibly damaging Het
Ly75 C A 2: 60,180,348 (GRCm39) E610* probably null Het
Ly75 C A 2: 60,182,477 (GRCm39) R566L possibly damaging Het
Lypd5 A C 7: 24,052,038 (GRCm39) N118H probably damaging Het
Lypd6 TC T 2: 50,080,819 (GRCm39) probably null Het
Lypd6b C A 2: 49,832,608 (GRCm39) P58T probably damaging Het
Lypd9 G T 11: 58,337,100 (GRCm39) N124K probably benign Het
Lyst G T 13: 13,854,719 (GRCm39) R2363L possibly damaging Het
Lyz3 C A 10: 117,071,546 (GRCm39) W111L probably benign Het
Macf1 C A 4: 123,365,268 (GRCm39) E3164D probably benign Het
Macroh2a2 T G 10: 61,575,129 (GRCm39) S356R probably damaging Het
Mad1l1 C A 5: 140,091,337 (GRCm39) G510V probably benign Het
Mad2l1bp C T 17: 46,458,867 (GRCm39) R221H probably damaging Het
Madd C G 2: 90,973,176 (GRCm39) Q1526H probably damaging Het
Mafb T A 2: 160,208,425 (GRCm39) T58S possibly damaging Het
Magel2 G T 7: 62,029,355 (GRCm39) R753L unknown Het
Magi2 G T 5: 20,907,410 (GRCm39) G1342V probably benign Het
Magix G C X: 7,542,089 (GRCm39) R226G probably benign Het
Malt1 G T 18: 65,564,444 (GRCm39) G68C probably damaging Het
Malt1 G T 18: 65,581,355 (GRCm39) G261V probably damaging Het
Maml2 G T 9: 13,617,886 (GRCm39) G411* probably null Het
Man2a1 G C 17: 65,042,049 (GRCm39) S989T probably benign Het
Man2a1 A C 17: 64,966,015 (GRCm39) K318Q probably damaging Het
Man2b2 C G 5: 36,971,141 (GRCm39) D742H probably damaging Het
Mansc4 G A 6: 146,988,459 (GRCm39) R2W unknown Het
Map10 G T 8: 126,396,809 (GRCm39) K67N probably damaging Het
Map1a G T 2: 121,135,760 (GRCm39) C2192F probably damaging Het
Map1s G T 8: 71,367,161 (GRCm39) D689Y probably damaging Het
Map2 G T 1: 66,477,520 (GRCm39) V1756L probably damaging Het
Map2 G A 1: 66,419,839 (GRCm39) A57T probably benign Het
Map3k1 C A 13: 111,892,480 (GRCm39) G925V probably benign Het
Map3k19 G T 1: 127,749,771 (GRCm39) S1193R probably benign Het
Map3k20 C T 2: 72,128,659 (GRCm39) R32* probably null Het
Map3k4 C A 17: 12,490,584 (GRCm39) Q282H probably damaging Het
Map3k9 G C 12: 81,769,053 (GRCm39) S998R probably damaging Het
Map3k9 C A 12: 81,827,620 (GRCm39) C10F unknown Het
Map4 G C 9: 109,897,591 (GRCm39) probably null Het
Map4k1 G C 7: 28,699,433 (GRCm39) R614P probably damaging Het
Map7d1 C A 4: 126,128,170 (GRCm39) R617L unknown Het
Mapk15 C A 15: 75,870,310 (GRCm39) S441* probably null Het
Mapk7 C A 11: 61,382,188 (GRCm39) Q241H probably damaging Het
Marchf4 C A 1: 72,468,116 (GRCm39) Q305H probably damaging Het
Marchf8 G T 6: 116,315,233 (GRCm39) probably benign Het
Mast1 C A 8: 85,647,075 (GRCm39) R650L probably benign Het
Mast3 T A 8: 71,241,682 (GRCm39) probably null Het
Maz C A 7: 126,625,068 (GRCm39) A151S unknown Het
Mbd1 G T 18: 74,410,010 (GRCm39) K501N probably null Het
Mbl2 C A 19: 30,211,397 (GRCm39) S6Y probably damaging Het
Mblac2 C G 13: 81,898,286 (GRCm39) R221G probably benign Het
Mboat1 C T 13: 30,410,361 (GRCm39) H273Y probably benign Het
Mbp C A 18: 82,531,135 (GRCm39) P27T unknown Het
Mbp A T 18: 82,579,970 (GRCm39) H80L probably benign Het
Mbtd1 G C 11: 93,803,285 (GRCm39) probably null Het
Mc2r T A 18: 68,540,783 (GRCm39) H170L possibly damaging Het
Mc3r C A 2: 172,091,736 (GRCm39) S319R probably benign Het
Mcam G T 9: 44,045,887 (GRCm39) probably benign Het
Mcc C A 18: 44,624,313 (GRCm39) A411S probably benign Het
Mcf2l G T 8: 13,059,654 (GRCm39) E720* probably null Het
Mcm4 A C 16: 15,450,080 (GRCm39) D317E possibly damaging Het
Mcm4 C A 16: 15,447,318 (GRCm39) D549Y probably damaging Het
Mcm5 G T 8: 75,848,300 (GRCm39) M516I possibly damaging Het
Mcoln2 A T 3: 145,881,459 (GRCm39) Q233L probably damaging Het
Mcpt8 C G 14: 56,319,793 (GRCm39) C219S probably benign Het
Mcu C A 10: 59,292,593 (GRCm39) V29L probably benign Het
Mcub C A 3: 129,710,591 (GRCm39) A227S unknown Het
Mcub C T 3: 129,710,592 (GRCm39) R280Q probably damaging Het
Mdfic2 G C 6: 98,215,201 (GRCm39) H141D probably benign Het
Mdm1 G T 10: 117,994,401 (GRCm39) R470M possibly damaging Het
Mecr A T 4: 131,581,894 (GRCm39) probably null Het
Med10 A G 13: 69,958,089 (GRCm39) K14E probably benign Het
Med12l G T 3: 59,155,296 (GRCm39) G1159W probably damaging Het
Med15 T A 16: 17,471,096 (GRCm39) H698L possibly damaging Het
Mef2c C A 13: 83,773,385 (GRCm39) T87K probably benign Het
Mef2d G A 3: 88,065,435 (GRCm39) R118Q possibly damaging Het
Megf11 T G 9: 64,587,608 (GRCm39) C469G probably damaging Het
Megf6 C A 4: 154,322,283 (GRCm39) P37T probably benign Het
Megf6 C A 4: 154,354,198 (GRCm39) C1367* probably null Het
Megf6 C A 4: 154,352,204 (GRCm39) C1236* probably null Het
Megf6 G T 4: 154,352,139 (GRCm39) D1215Y probably damaging Het
Megf6 G T 4: 154,352,138 (GRCm39) K1214N possibly damaging Het
Megf6 G C 4: 154,335,306 (GRCm39) G255A probably damaging Het
Megf8 G T 7: 25,045,587 (GRCm39) G1403C probably damaging Het
Megf8 G T 7: 25,046,794 (GRCm39) G1559V probably damaging Het
Meioc TCC TC 11: 102,557,190 (GRCm39) probably null Het
Meltf G T 16: 31,699,052 (GRCm39) C54F probably damaging Het
Mep1a T A 17: 43,797,188 (GRCm39) Q293L probably damaging Het
Mep1a C G 17: 43,797,197 (GRCm39) G290A probably damaging Het
Mest C A 6: 30,723,574 (GRCm39) probably benign Het
Mettl21e G T 1: 44,245,710 (GRCm39) L179M probably damaging Het
Mettl8 C G 2: 70,803,682 (GRCm39) D202H probably damaging Het
Mettl9 G T 7: 120,656,553 (GRCm39) V228F probably damaging Het
Mex3d C G 10: 80,217,184 (GRCm39) A678P unknown Het
Mfge8 G T 7: 78,795,485 (GRCm39) F27L probably benign Het
Mfhas1 G T 8: 36,057,539 (GRCm39) Q671H possibly damaging Het
Mfn1 G T 3: 32,618,440 (GRCm39) E550* probably null Het
Mfrp G C 9: 44,013,816 (GRCm39) G109R probably damaging Het
Mfsd2b G A 12: 4,915,794 (GRCm39) S406L probably damaging Het
Mfsd5 G A 15: 102,189,690 (GRCm39) C354Y possibly damaging Het
Mfsd6 C G 1: 52,697,660 (GRCm39) Q742H probably benign Het
Mfsd6l G T 11: 68,447,808 (GRCm39) V220F possibly damaging Het
Mfsd6l A T 11: 68,448,540 (GRCm39) S464C probably damaging Het
Mfsd8 C A 3: 40,801,296 (GRCm39) probably benign Het
Mgam G T 6: 40,717,005 (GRCm39) L229F probably damaging Het
Mgat4a G T 1: 37,529,453 (GRCm39) P142H probably damaging Het
Mgat4c C A 10: 102,224,311 (GRCm39) P175H probably damaging Het
Mgat4c G T 10: 102,224,463 (GRCm39) D226Y probably damaging Het
Mgat4f G A 1: 134,317,896 (GRCm39) V223M probably damaging Het
Mgat5 G C 1: 127,410,429 (GRCm39) K730N probably damaging Het
Mgme1 G T 2: 144,118,396 (GRCm39) V223F probably damaging Het
Mgrn1 A T 16: 4,740,588 (GRCm39) Q309L probably benign Het
Mgst2 C G 3: 51,568,691 (GRCm39) L8V probably damaging Het
Mib1 G T 18: 10,763,309 (GRCm39) R453I probably damaging Het
Mib2 C G 4: 155,739,978 (GRCm39) probably null Het
Mical1 G T 10: 41,357,701 (GRCm39) R436L probably null Het
Mical3 C G 6: 120,936,689 (GRCm39) R1279P possibly damaging Het
Micall2 C T 5: 139,696,057 (GRCm39) E844K unknown Het
Micu1 G T 10: 59,563,863 (GRCm39) Q28H probably benign Het
Micu3 G T 8: 40,761,265 (GRCm39) W58C probably damaging Het
Mideas C A 12: 84,209,132 (GRCm39) E657* probably null Het
Mideas G C 12: 84,199,765 (GRCm39) A985G probably benign Het
Midn G A 10: 79,986,074 (GRCm39) E55K probably damaging Het
Mier2 C A 10: 79,376,295 (GRCm39) G210V unknown Het
Minar1 G T 9: 89,485,215 (GRCm39) P61T probably damaging Het
Mindy4 G A 6: 55,201,326 (GRCm39) R337H probably benign Het
Miox G T 15: 89,219,847 (GRCm39) D112Y probably damaging Het
Mitf A T 6: 97,983,082 (GRCm39) probably null Het
Mkrn1 T A 6: 39,377,390 (GRCm39) N282Y probably null Het
Mks1 GCCC GCC 11: 87,751,549 (GRCm39) probably null Het
Mkx G T 18: 6,937,195 (GRCm39) P283Q probably benign Het
Mlf2 G T 6: 124,911,269 (GRCm39) G95W probably damaging Het
Mllt10 G C 2: 18,175,887 (GRCm39) probably null Het
Mllt6 G T 11: 97,567,251 (GRCm39) G676C possibly damaging Het
Mmd G T 11: 90,150,714 (GRCm39) W57L probably damaging Het
Mmel1 G T 4: 154,978,531 (GRCm39) probably null Het
Mmgt2 A C 11: 62,555,900 (GRCm39) T83P probably damaging Het
Mmp13 C T 9: 7,277,953 (GRCm39) P282L probably damaging Het
Mmp13 C A 9: 7,280,200 (GRCm39) P377T possibly damaging Het
Mmp17 G A 5: 129,672,725 (GRCm39) D226N possibly damaging Het
Mmp1a G T 9: 7,464,230 (GRCm39) A12S probably benign Het
Mmp1a C T 9: 7,467,034 (GRCm39) T237M possibly damaging Het
Mmp1b C A 9: 7,369,322 (GRCm39) probably null Het
Mmp20 G T 9: 7,644,063 (GRCm39) Q250H probably benign Het
Mmp21 G T 7: 133,276,662 (GRCm39) P447H probably damaging Het
Mmp25 G C 17: 23,863,111 (GRCm39) A100G possibly damaging Het
Mmp7 C A 9: 7,695,179 (GRCm39) P47H probably benign Het
Mmrn1 G T 6: 60,964,082 (GRCm39) S1028I possibly damaging Het
Mms19 C A 19: 41,945,579 (GRCm39) probably null Het
Mn1 G T 5: 111,567,934 (GRCm39) G635C probably damaging Het
Mndal A T 1: 173,701,970 (GRCm39) S111T unknown Het
Mogat1 G T 1: 78,505,890 (GRCm39) probably null Het
Mogat2 C A 7: 98,872,836 (GRCm39) G116V probably damaging Het
Morc1 C G 16: 48,386,069 (GRCm39) A564G probably benign Het
Morc2b C A 17: 33,356,376 (GRCm39) W465C probably damaging Het
Morn3 CGG CG 5: 123,184,783 (GRCm39) probably null Het
Mov10l1 G T 15: 88,937,614 (GRCm39) D1138Y probably damaging Het
Mov10l1 G T 15: 88,880,339 (GRCm39) R275I probably benign Het
Mov10l1 G T 15: 88,902,371 (GRCm39) D754Y probably damaging Het
Moxd1 G C 10: 24,160,702 (GRCm39) V452L probably benign Het
Mpdz C A 4: 81,238,727 (GRCm39) L1150F probably damaging Het
Mpl C A 4: 118,300,852 (GRCm39) C559F Het
Mplkip G T 13: 17,870,027 (GRCm39) probably benign Het
Mplkipl1 CGGGG CGGG 19: 61,164,188 (GRCm39) probably null Het
Mpp7 C A 18: 7,355,062 (GRCm39) V455F probably damaging Het
Mpped2 G T 2: 106,575,148 (GRCm39) G78W probably damaging Het
Mpped2 G T 2: 106,691,937 (GRCm39) G214V probably damaging Het
Mprip G C 11: 59,648,463 (GRCm39) Q722H probably damaging Het
Mrc1 C T 2: 14,293,927 (GRCm39) P638L probably damaging Het
Mrc1 A C 2: 14,248,949 (GRCm39) N162H probably damaging Het
Mrgpra3 C A 7: 47,251,049 (GRCm39) G2* probably null Het
Mrgpra6 G T 7: 46,838,910 (GRCm39) S65Y possibly damaging Het
Mrgprb2 C A 7: 48,202,721 (GRCm39) M1I probably null Het
Mrgprh T A 17: 13,096,474 (GRCm39) M238K probably damaging Het
Mroh1 G A 15: 76,307,961 (GRCm39) G421S probably damaging Het
Mroh2b G C 15: 4,934,487 (GRCm39) Q119H probably damaging Het
Mroh3 C A 1: 136,119,874 (GRCm39) E442D probably benign Het
Mroh4 A T 15: 74,499,569 (GRCm39) L104Q probably damaging Het
Mroh4 T A 15: 74,499,851 (GRCm39) H84L possibly damaging Het
Mroh6 G T 15: 75,759,667 (GRCm39) P170H probably damaging Het
Mrpl19 A T 6: 81,941,291 (GRCm39) L90Q probably damaging Het
Mrpl9 G T 3: 94,350,680 (GRCm39) G8V probably benign Het
Mrps27 G C 13: 99,551,351 (GRCm39) E371D possibly damaging Het
Mrps28 C A 3: 8,988,806 (GRCm39) L17F probably damaging Het
Mrps36 C A 13: 100,872,778 (GRCm39) G99W probably damaging Het
Mrps9 A G 1: 42,938,618 (GRCm39) T274A probably benign Het
Mrtfb G T 16: 13,203,470 (GRCm39) G161V probably benign Het
Ms4a13 G T 19: 11,149,948 (GRCm39) P138T probably benign Het
Ms4a4b C A 19: 11,427,302 (GRCm39) T7N possibly damaging Het
Ms4a4c G C 19: 11,398,673 (GRCm39) V164L probably benign Het
Ms4a6b C G 19: 11,497,787 (GRCm39) P29A probably benign Het
Msantd5l G C 11: 51,144,795 (GRCm39) A106G probably benign Het
Msh4 T A 3: 153,607,080 (GRCm39) probably benign Het
Msh4 C G 3: 153,585,005 (GRCm39) E454D probably benign Het
Msr1 G C 8: 40,084,343 (GRCm39) P71A probably damaging Het
Msx1 C T 5: 37,981,359 (GRCm39) D107N possibly damaging Het
Mt1 G C 8: 94,906,757 (GRCm39) C41S probably damaging Het
Mt1 C A 8: 94,905,961 (GRCm39) S8Y unknown Het
Mta3 G A 17: 84,089,397 (GRCm39) V320M probably damaging Het
Mtarc1 G T 1: 184,536,134 (GRCm39) P203Q possibly damaging Het
Mtcl1 C A 17: 66,651,290 (GRCm39) G1392W probably damaging Het
Mtf2 G T 5: 108,213,768 (GRCm39) probably benign Het
Mtf2 G T 5: 108,228,754 (GRCm39) K23N possibly damaging Het
Mthfsl C G 9: 88,571,038 (GRCm39) G127A probably damaging Het
Mtmr4 G T 11: 87,502,706 (GRCm39) R920L probably benign Het
Mtmr7 C A 8: 41,050,422 (GRCm39) E124D probably benign Het
Mtr C T 13: 12,201,935 (GRCm39) V1240M probably benign Het
Mtr C A 13: 12,264,752 (GRCm39) E117* probably null Het
Mtss1 G T 15: 58,817,269 (GRCm39) S507R probably damaging Het
Mtus2 C A 5: 148,140,887 (GRCm39) P918T probably damaging Het
Mtx1 C A 3: 89,121,166 (GRCm39) G156V probably damaging Het
Mtx1 G T 3: 89,121,412 (GRCm39) P74H probably benign Het
Muc16 G T 9: 18,448,867 (GRCm39) H7655N probably benign Het
Muc16 G A 9: 18,569,157 (GRCm39) Q1121* probably null Het
Muc2 A T 7: 141,298,531 (GRCm39) Q61L Het
Muc21 G T 17: 35,931,817 (GRCm39) P790T unknown Het
Muc21 G T 17: 35,931,951 (GRCm39) P745H unknown Het
Muc4 C T 16: 32,587,767 (GRCm39) Q700* probably null Het
Muc4 G T 16: 32,595,236 (GRCm39) K1025N Het
Muc4 A T 16: 32,587,768 (GRCm39) Q700L Het
Muc5ac C A 7: 141,362,961 (GRCm39) P2091T unknown Het
Muc5ac C A 7: 141,371,777 (GRCm39) H3330N probably benign Het
Muc5b C A 7: 141,416,910 (GRCm39) S3285R probably benign Het
Muc6 G C 7: 141,236,701 (GRCm39) H339Q probably benign Het
Muc6 G T 7: 141,217,827 (GRCm39) T2282N possibly damaging Het
Muc6 G T 7: 141,237,656 (GRCm39) A187E probably benign Het
Mug1 C A 6: 121,840,767 (GRCm39) P539H probably damaging Het
Mug1 C A 6: 121,863,527 (GRCm39) S1408R probably damaging Het
Mug1 G C 6: 121,856,258 (GRCm39) probably null Het
Mug2 A G 6: 122,014,080 (GRCm39) T389A probably damaging Het
Mybl1 C G 1: 9,746,265 (GRCm39) G465A probably benign Het
Mybpc1 G T 10: 88,409,299 (GRCm39) Q52K probably benign Het
Mybpc3 C A 2: 90,954,309 (GRCm39) P394Q possibly damaging Het
Mycbp2 C A 14: 103,364,499 (GRCm39) probably null Het
Mycbp2 C A 14: 103,407,309 (GRCm39) Q2780H possibly damaging Het
Mycbp2 C A 14: 103,372,559 (GRCm39) V4096F probably damaging Het
Mycbpap C A 11: 94,400,680 (GRCm39) V340L probably damaging Het
Myct1 G T 10: 5,554,361 (GRCm39) G76V probably damaging Het
Myf5 G T 10: 107,319,955 (GRCm39) P232T possibly damaging Het
Myh1 T A 11: 67,097,144 (GRCm39) L399H probably damaging Het
Myh11 C G 16: 14,027,459 (GRCm39) E1258D Het
Myh13 C A 11: 67,255,417 (GRCm39) R1596S possibly damaging Het
Myh13 T A 11: 67,241,278 (GRCm39) L885Q possibly damaging Het
Myh15 C A 16: 48,901,591 (GRCm39) Q256K probably benign Het
Myh15 A T 16: 48,980,189 (GRCm39) Q1437L probably benign Het
Myh15 C G 16: 48,975,981 (GRCm39) R1350G probably damaging Het
Myh2 A T 11: 67,084,084 (GRCm39) Q1569L probably damaging Het
Myh2 C A 11: 67,066,997 (GRCm39) T178N possibly damaging Het
Myh8 C G 11: 67,199,181 (GRCm39) L1896V possibly damaging Het
Myh8 A T 11: 67,192,250 (GRCm39) Q1401L probably damaging Het
Myl1 G T 1: 66,974,462 (GRCm39) probably benign Het
Mylk G T 16: 34,743,021 (GRCm39) A1178S possibly damaging Het
Mylk2 C A 2: 152,762,250 (GRCm39) T507N probably damaging Het
Mylk3 A T 8: 86,091,808 (GRCm39) Het
Mylk3 G T 8: 86,085,823 (GRCm39) P237Q probably benign Het
Myo10 G T 15: 25,799,640 (GRCm39) probably null Het
Myo10 A T 15: 25,781,487 (GRCm39) E994V probably damaging Het
Myo15a G T 11: 60,379,663 (GRCm39) D288Y Het
Myo15a G A 11: 60,368,349 (GRCm39) G370R probably damaging Het
Myo15a G C 11: 60,386,301 (GRCm39) V640L Het
Myo16 A T 8: 10,524,691 (GRCm39) Q814L unknown Het
Myo18a G T 11: 77,732,821 (GRCm39) R1330L probably damaging Het
Myo18b G T 5: 113,021,407 (GRCm39) Y551* probably null Het
Myo18b C A 5: 113,023,018 (GRCm39) E125* probably null Het
Myo18b G T 5: 112,840,765 (GRCm39) L2343