Incidental Mutation 'R0654:Avpr1b'
ID62416
Institutional Source Beutler Lab
Gene Symbol Avpr1b
Ensembl Gene ENSMUSG00000026432
Gene Namearginine vasopressin receptor 1B
SynonymsVPR3, V1bR, V3/V1b, V3/V1b pituitary vasopressin receptor, AVPR3, V1BR
MMRRC Submission 038839-MU
Accession Numbers

Genbank: NM_011924; MGI: 1347010

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0654 (G1)
Quality Score137
Status Not validated
Chromosome1
Chromosomal Location131599239-131612000 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 131599742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000140527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027690] [ENSMUST00000190410]
Predicted Effect probably null
Transcript: ENSMUST00000027690
AA Change: M1K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027690
Gene: ENSMUSG00000026432
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 41 223 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 342 4.4e-7 PFAM
Pfam:7tm_1 51 335 1.6e-50 PFAM
Pfam:7TM_GPCR_Srv 106 352 8.2e-7 PFAM
DUF1856 359 411 1.6e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190410
AA Change: M1K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140527
Gene: ENSMUSG00000026432
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_1 51 121 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele display dysregulation of the hypothalamic-pituitary-adrenal axis activity under stress and resting conditions. Homozygous null mice for other alleles display decreased aggression or an increased propensity for seizures. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(4) Targeted, other(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb13 A C 13: 3,642,092 H24P probably damaging Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rbm28 A T 6: 29,128,578 S48R probably damaging Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc22a1 T A 17: 12,662,792 N310I probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Tmcc1 A T 6: 116,042,990 H281Q probably benign Het
Ttc39b T A 4: 83,241,701 M413L probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Avpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Avpr1b APN 1 131600147 missense probably damaging 1.00
IGL02516:Avpr1b APN 1 131600629 missense probably damaging 0.98
IGL02708:Avpr1b APN 1 131600651 missense probably damaging 1.00
IGL03122:Avpr1b APN 1 131600519 missense probably damaging 1.00
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0058:Avpr1b UTSW 1 131599786 missense probably benign 0.04
R0690:Avpr1b UTSW 1 131600281 missense probably damaging 0.99
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1470:Avpr1b UTSW 1 131600585 missense probably damaging 1.00
R1704:Avpr1b UTSW 1 131609504 missense possibly damaging 0.80
R1732:Avpr1b UTSW 1 131600254 missense probably damaging 1.00
R1754:Avpr1b UTSW 1 131600101 missense probably damaging 1.00
R6103:Avpr1b UTSW 1 131609417 missense probably damaging 1.00
R7246:Avpr1b UTSW 1 131600270 missense probably damaging 1.00
R7283:Avpr1b UTSW 1 131609731 missense probably benign 0.26
R8253:Avpr1b UTSW 1 131609416 missense probably benign 0.41
Z1176:Avpr1b UTSW 1 131609573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCGGTGTCACCTCTCAGAAG -3'
(R):5'- TCAGTAGTACAGCCAGGTTGCCTC -3'

Sequencing Primer
(F):5'- GGTCCCGGTTCTGCTCC -3'
(R):5'- CCAGGTTGCCTCCTGTG -3'
Posted On2013-07-30