Incidental Mutation 'R0654:Rbm28'
ID62429
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
MMRRC Submission 038839-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R0654 (G1)
Quality Score94
Status Not validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29128578 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 48 (S48R)
Ref Sequence ENSEMBL: ENSMUSP00000127856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993] [ENSMUST00000164563]
Predicted Effect probably damaging
Transcript: ENSMUST00000007993
AA Change: S622R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701
AA Change: S622R

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164563
AA Change: S48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127856
Gene: ENSMUSG00000029701
AA Change: S48R

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169214
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb13 A C 13: 3,642,092 H24P probably damaging Het
Avpr1b T A 1: 131,599,742 M1K probably null Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc22a1 T A 17: 12,662,792 N310I probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Tmcc1 A T 6: 116,042,990 H281Q probably benign Het
Ttc39b T A 4: 83,241,701 M413L probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0884:Rbm28 UTSW 6 29155154 missense possibly damaging 0.68
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 unclassified probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4421:Rbm28 UTSW 6 29154837 missense probably damaging 1.00
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5378:Rbm28 UTSW 6 29128559 missense probably damaging 0.99
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7351:Rbm28 UTSW 6 29158880 missense probably benign
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
RF056:Rbm28 UTSW 6 29157053 frame shift probably null
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGAGCACACTACCCCTTTTGTC -3'
(R):5'- TGAACATTGGGCTACTGCTTGCTG -3'

Sequencing Primer
(F):5'- TGTCCTCCCAAATGCAGC -3'
(R):5'- CTGTGTCACTAGACAGCTTGAAAAC -3'
Posted On2013-07-30