Incidental Mutation 'R0654:Asb13'
ID62443
Institutional Source Beutler Lab
Gene Symbol Asb13
Ensembl Gene ENSMUSG00000033781
Gene Nameankyrin repeat and SOCS box-containing 13
Synonyms6430573K02Rik, 2210015B19Rik
MMRRC Submission 038839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0654 (G1)
Quality Score89
Status Not validated
Chromosome13
Chromosomal Location3634032-3653822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3642092 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 24 (H24P)
Ref Sequence ENSEMBL: ENSMUSP00000046476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042288]
Predicted Effect probably damaging
Transcript: ENSMUST00000042288
AA Change: H24P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046476
Gene: ENSMUSG00000033781
AA Change: H24P

DomainStartEndE-ValueType
ANK 18 47 1.25e2 SMART
ANK 51 80 3.91e-3 SMART
ANK 84 113 1.53e-5 SMART
ANK 116 145 3.71e-4 SMART
ANK 149 178 6.65e-6 SMART
ANK 181 210 6.92e-4 SMART
SOCS_box 239 278 2.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141967
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Avpr1b T A 1: 131,599,742 M1K probably null Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rbm28 A T 6: 29,128,578 S48R probably damaging Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc22a1 T A 17: 12,662,792 N310I probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Tmcc1 A T 6: 116,042,990 H281Q probably benign Het
Ttc39b T A 4: 83,241,701 M413L probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Asb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Asb13 APN 13 3643476 missense probably null 1.00
IGL00929:Asb13 APN 13 3649427 missense probably damaging 1.00
IGL01533:Asb13 APN 13 3642164 missense probably benign 0.05
R0694:Asb13 UTSW 13 3649480 missense probably benign 0.16
R0883:Asb13 UTSW 13 3645052 critical splice donor site probably null
R2014:Asb13 UTSW 13 3649512 critical splice donor site probably null
R2290:Asb13 UTSW 13 3649418 missense probably damaging 1.00
R4320:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4322:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4324:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4895:Asb13 UTSW 13 3643589 missense probably damaging 0.99
R5305:Asb13 UTSW 13 3643479 missense probably damaging 1.00
R6417:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6420:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6813:Asb13 UTSW 13 3645029 missense probably damaging 1.00
R7648:Asb13 UTSW 13 3649332 missense probably damaging 1.00
R7735:Asb13 UTSW 13 3634180 splice site probably null
R7771:Asb13 UTSW 13 3649463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGCAGACACCCTTATATGCCC -3'
(R):5'- TCAATGCCGAATGGTCACCCAC -3'

Sequencing Primer
(F):5'- TGCCCTAGCAAGAACTTTGAG -3'
(R):5'- GTCACCCACCTGGGCAC -3'
Posted On2013-07-30