Incidental Mutation 'R0654:Slc22a1'
ID62447
Institutional Source Beutler Lab
Gene Symbol Slc22a1
Ensembl Gene ENSMUSG00000023829
Gene Namesolute carrier family 22 (organic cation transporter), member 1
SynonymsLx1, Oct1, Oct1, Orct1, Orct
MMRRC Submission 038839-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0654 (G1)
Quality Score160
Status Not validated
Chromosome17
Chromosomal Location12648874-12675838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12662792 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 310 (N310I)
Ref Sequence ENSEMBL: ENSMUSP00000024596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024596]
Predicted Effect probably damaging
Transcript: ENSMUST00000024596
AA Change: N310I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024596
Gene: ENSMUSG00000023829
AA Change: N310I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 134 482 1.3e-25 PFAM
Pfam:Sugar_tr 143 529 5.3e-33 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. Two transcript variants encoding two different isoforms have been found for this gene, but only the longer variant encodes a functional transporter. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable, healthy, and fertile but exhibit an impaired liver uptake and direct intestinal excretion of substrate organic cations. Mice homozygous for a different knockout allele show alterations in metformin disposition and its glucose-lowering effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb13 A C 13: 3,642,092 H24P probably damaging Het
Avpr1b T A 1: 131,599,742 M1K probably null Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rbm28 A T 6: 29,128,578 S48R probably damaging Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Tmcc1 A T 6: 116,042,990 H281Q probably benign Het
Ttc39b T A 4: 83,241,701 M413L probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Slc22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Slc22a1 APN 17 12650862 splice site probably benign
IGL02313:Slc22a1 APN 17 12675500 nonsense probably null
IGL02578:Slc22a1 APN 17 12667239 missense probably damaging 1.00
R0017:Slc22a1 UTSW 17 12659759 missense probably damaging 1.00
R0136:Slc22a1 UTSW 17 12662596 missense probably benign 0.03
R0306:Slc22a1 UTSW 17 12662598 missense probably benign 0.03
R0408:Slc22a1 UTSW 17 12656941 missense probably damaging 1.00
R0487:Slc22a1 UTSW 17 12662600 nonsense probably null
R0811:Slc22a1 UTSW 17 12666618 splice site probably benign
R0866:Slc22a1 UTSW 17 12657046 missense probably benign 0.00
R1414:Slc22a1 UTSW 17 12662600 missense probably damaging 1.00
R1490:Slc22a1 UTSW 17 12662893 splice site probably null
R4801:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R4802:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R5101:Slc22a1 UTSW 17 12667242 missense probably damaging 1.00
R5147:Slc22a1 UTSW 17 12650951 missense probably damaging 1.00
R6816:Slc22a1 UTSW 17 12652483 missense possibly damaging 0.83
R6875:Slc22a1 UTSW 17 12667305 nonsense probably null
R7263:Slc22a1 UTSW 17 12666700 missense probably damaging 1.00
R7295:Slc22a1 UTSW 17 12657005 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGAGGCATCTTCCTCAAGGCAC -3'
(R):5'- CAAGCATCCAGGGGAATCACAGTC -3'

Sequencing Primer
(F):5'- CTCAAGGCACATCATCTGGGAG -3'
(R):5'- GGGAATCACAGTCCTCCTTG -3'
Posted On2013-07-30