Mutagenetix > Incidental Mutations

Incidental Mutation 'R0655:Atg16l1'

62457

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

038840-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0655 (G1)

Quality Score

124

Status

Not validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87766829 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 76 (I76N)

Ref Sequence

ENSEMBL: ENSMUSP00000120955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027512
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: I138N

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113186
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: I138N

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113190
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: I138N

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129431

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137638

Predicted Effect

probably damaging
Transcript: ENSMUST00000144047
AA Change: I76N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289
AA Change: I76N

Domain	Start	End	E-Value	Type
Pfam:ATG16	1	145	2.9e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151037

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	G	C	17: 35,957,845	I757M	probably benign	Het
Baz1b	T	A	5: 135,242,430	I1289N	probably benign	Het
Bcl2l15	T	A	3: 103,832,969		probably null	Het
Btbd11	A	G	10: 85,645,526	T931A	probably damaging	Het
Cbl	G	T	9: 44,158,752	T566K	probably damaging	Het
Cbwd1	T	C	19: 24,953,320	M122V	possibly damaging	Het
Cd96	T	C	16: 46,099,119	K180E	probably benign	Het
Cpxm2	G	A	7: 132,054,820	T571I	possibly damaging	Het
Cyp2a12	A	T	7: 27,036,621	Y485F	probably benign	Het
Cyp4f17	T	A	17: 32,524,897	Y350N	possibly damaging	Het
Dstn	T	A	2: 143,938,422	I14N	probably damaging	Het
Eea1	A	G	10: 95,995,598	S184G	probably benign	Het
Eif1a	G	T	18: 46,608,063	G122C	probably damaging	Het
Esf1	T	A	2: 140,148,879	T562S	probably benign	Het
Fem1c	G	A	18: 46,505,160	R592C	probably benign	Het
Fig4	T	C	10: 41,285,677	N30S	probably damaging	Het
Gria2	C	A	3: 80,732,070	E212*	probably null	Het
Gsdmc2	C	T	15: 63,827,773	A269T	probably benign	Het
Herc4	T	C	10: 63,273,571	V195A	probably benign	Het
Hivep1	T	C	13: 42,167,585	S2123P	probably damaging	Het
Hspa4	T	C	11: 53,269,692	E519G	probably benign	Het
Htr2b	A	G	1: 86,110,843	S14P	probably benign	Het
Ifit1	T	C	19: 34,647,647	V61A	probably damaging	Het
Ifitm1	C	A	7: 140,969,536	F77L	probably benign	Het
Matn2	T	C	15: 34,345,200	S118P	probably benign	Het
Mtmr3	C	A	11: 4,488,610	D615Y	probably damaging	Het
Mtss1	C	A	15: 59,081,502	C9F	probably damaging	Het
Muc5b	A	T	7: 141,863,942	I3542F	probably benign	Het
Nwd2	T	C	5: 63,791,585	S167P	possibly damaging	Het
Olfr394	T	C	11: 73,887,805	D189G	possibly damaging	Het
Olfr694	A	T	7: 106,689,425	F102Y	probably damaging	Het
Olfr921	C	T	9: 38,775,554	Q100*	probably null	Het
Oscp1	T	C	4: 126,058,733	L18P	probably damaging	Het
Pax5	A	G	4: 44,537,462	S297P	probably damaging	Het
Phldb3	A	T	7: 24,624,372	D476V	probably benign	Het
Phlpp2	A	T	8: 109,895,587	I154L	probably benign	Het
Prx	T	A	7: 27,517,421	V449E	probably damaging	Het
Psd3	A	G	8: 67,963,689	S519P	probably benign	Het
Rnf138	T	G	18: 21,010,783	V128G	probably benign	Het
Safb	T	A	17: 56,597,803	S209T	probably benign	Het
Sbno1	C	A	5: 124,376,149	V1327L	possibly damaging	Het
Scarb1	A	G	5: 125,300,440	V176A	probably damaging	Het
Scd4	A	G	19: 44,338,968	H161R	possibly damaging	Het
Selenoo	T	A	15: 89,095,655	H335Q	probably damaging	Het
Slfn8	A	G	11: 83,003,821	F664S	probably benign	Het
Spef2	T	C	15: 9,626,131	I1116M	possibly damaging	Het
Taf2	G	A	15: 55,038,294	R835W	probably damaging	Het
Tdrd9	A	G	12: 112,040,465	E921G	probably damaging	Het
Tectb	G	A	19: 55,189,870	G234S	possibly damaging	Het
Tmc1	C	T	19: 20,799,176	M606I	probably damaging	Het
Tmed10	T	A	12: 85,343,517	I88F	probably damaging	Het
Tnfrsf11a	G	A	1: 105,808,155	V31I	unknown	Het
Trp53inp2	G	T	2: 155,386,168	G98*	probably null	Het
Tssc4	A	G	7: 143,070,045	D30G	probably damaging	Het
Uaca	T	C	9: 60,872,029	Y1233H	probably benign	Het
Unc13c	G	A	9: 73,930,953	T872I	probably damaging	Het
Unc80	A	G	1: 66,503,781	H398R	probably damaging	Het
Vmn1r64	G	A	7: 5,884,208	T112I	probably benign	Het
Vmn1r85	A	G	7: 13,084,723	Y165H	probably damaging	Het
Vmn2r72	A	T	7: 85,738,111	C748*	probably null	Het
Wdr17	A	G	8: 54,649,198	W929R	probably damaging	Het
Yeats2	A	T	16: 20,193,824	K591*	probably null	Het
Zbtb9	T	A	17: 26,974,100	S160T	probably damaging	Het
Znfx1	T	A	2: 167,056,907	R32S	probably damaging	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0650:Atg16l1	UTSW	1	87781699	missense	possibly damaging	0.93
R1421:Atg16l1	UTSW	1	87786358	splice site	probably benign
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R4990:Atg16l1	UTSW	1	87789369	missense	probably benign	0.00
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R5897:Atg16l1	UTSW	1	87785997	critical splice donor site	probably null
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	intron	probably null
R7423:Atg16l1	UTSW	1	87786301	missense	probably damaging	1.00
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGCCACTTGGAAATGCCTGGAG -3'
(R):5'- AGCCATCCATCTGGTGACCAGTTC -3'

Sequencing Primer
(F):5'- AAGCTACAGTTACTAGCCGTCTG -3'
(R):5'- CTGGTGACCAGTTCCTGGTTC -3'

Posted On

2013-07-30