Incidental Mutation 'R0655:Dstn'
ID62461
Institutional Source Beutler Lab
Gene Symbol Dstn
Ensembl Gene ENSMUSG00000015932
Gene Namedestrin
Synonymssid23p, ADF, corn1, 2610043P17Rik
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0655 (G1)
Quality Score163
Status Not validated
Chromosome2
Chromosomal Location143915320-143943324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143938422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 14 (I14N)
Ref Sequence ENSEMBL: ENSMUSP00000099461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103172]
Predicted Effect probably damaging
Transcript: ENSMUST00000103172
AA Change: I14N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099461
Gene: ENSMUSG00000015932
AA Change: I14N

DomainStartEndE-ValueType
ADF 19 153 2.67e-52 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying mutations at this locus develop irregular thickening of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Dstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Dstn APN 2 143942174 missense probably benign
R0849:Dstn UTSW 2 143938535 missense probably benign 0.42
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1460:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R1541:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R3882:Dstn UTSW 2 143942187 missense probably benign 0.20
R6419:Dstn UTSW 2 143939987 missense possibly damaging 0.75
R7402:Dstn UTSW 2 143938448 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCATGTGTGCTAGTCAGGAGTCAG -3'
(R):5'- GTGCTCACCACAGGAAGAACATCAG -3'

Sequencing Primer
(F):5'- CTAGTCAGGAGTCAGTAATGCTCAC -3'
(R):5'- GCGACAATCTTTTTCAGGAAGC -3'
Posted On2013-07-30