Incidental Mutation 'R0655:Scarb1'
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Namescavenger receptor class B, member 1
SynonymsCd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0655 (G1)
Quality Score102
Status Not validated
Chromosomal Location125277087-125341094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125300440 bp
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000107021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000137783]
Predicted Effect probably damaging
Transcript: ENSMUST00000086075
AA Change: V176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: V176A

Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111390
AA Change: V176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: V176A

Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133624
Predicted Effect probably benign
Transcript: ENSMUST00000137783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156532
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125303137 missense probably benign 0.01
R8467:Scarb1 UTSW 5 125298667 missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125294163 missense probably damaging 1.00
R8814:Scarb1 UTSW 5 125294092 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccgcacctgaatgtaatcc -3'
Posted On2013-07-30