Incidental Mutation 'Z1177:Alb'
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #Z1177 ()
Quality Score225.009
Status Not validated
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90468512 bp
Amino Acid Change Glutamine to Leucine at position 292 (Q292L)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably damaging
Transcript: ENSMUST00000031314
AA Change: Q292L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: Q292L

ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4377 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik C A 18: 38,254,303 H199N probably benign Het
0610010F05Rik C A 11: 23,624,960 D105Y probably benign Het
1110032F04Rik C G 3: 68,869,907 P67R probably damaging Het
1110032F04Rik G T 3: 68,870,272 V189L probably benign Het
1500011B03Rik G T 5: 114,809,287 L60I possibly damaging Het
1500011B03Rik C G 5: 114,813,872 C14S possibly damaging Het
1700007G11Rik C A 5: 98,801,834 S209Y probably damaging Het
1700011L22Rik G A 8: 79,248,296 R53W probably damaging Het
1700015F17Rik C T 5: 5,457,284 probably null Het
1700018B08Rik G T 8: 121,539,982 P36H probably benign Het
1700024G13Rik T A 14: 32,388,365 probably benign Het
1700061G19Rik AT ATT 17: 56,883,463 probably null Het
1700080E11Rik G A 9: 105,144,460 P129L possibly damaging Het
1700093K21Rik T A 11: 23,518,144 probably null Het
2010111I01Rik G T 13: 63,170,990 R537L probably damaging Het
2410089E03Rik G T 15: 8,174,972 G78V probably damaging Het
2410089E03Rik C T 15: 8,209,989 L1225F probably damaging Het
2700049A03Rik G T 12: 71,164,484 G664V probably damaging Het
2810021J22Rik C G 11: 58,880,103 S137C probably damaging Het
3425401B19Rik G T 14: 32,659,808 T1400K possibly damaging Het
3425401B19Rik G T 14: 32,661,398 P870H probably damaging Het
4833420G17Rik C A 13: 119,477,808 T484K not run Het
4921504E06Rik C A 2: 19,480,532 E441D possibly damaging Het
4921507P07Rik G T 6: 50,591,692 R86S probably benign Het
4921524L21Rik G A 18: 6,635,865 G306D probably benign Het
4921530L21Rik C A 14: 95,882,130 P108T probably benign Het
4930402H24Rik C T 2: 130,710,867 R1091K probably benign Het
4930444P10Rik T A 1: 16,082,022 probably benign Het
4930452B06Rik G A 14: 8,517,953 Q289* probably null Het
4930504O13Rik G T 11: 58,446,274 N124K probably benign Het
4930516K23Rik C A 7: 104,059,418 M61I probably damaging Het
4930578C19Rik C A X: 18,420,607 M236I probably benign Het
4931406P16Rik C G 7: 34,284,755 A148P probably damaging Het
4931409K22Rik G T 5: 24,550,795 P243H probably benign Het
4931429L15Rik G A 9: 46,305,838 S213L probably damaging Het
4932411N23Rik C A X: 126,814,533 W316C probably damaging Het
4932415D10Rik G T 10: 82,285,798 H3793N possibly damaging Het
4932415D10Rik C A 10: 82,287,126 R3350M possibly damaging Het
4932415D10Rik G T 10: 82,287,417 A3253E probably damaging Het
4932415D10Rik G A 10: 82,289,686 Q2497* probably null Het
4932438A13Rik G C 3: 36,919,950 M616I probably benign Het
4932438A13Rik G C 3: 36,983,440 M2463I possibly damaging Het
4932438A13Rik A T 3: 37,036,707 S782C Het
4933402J07Rik G C 8: 87,586,117 G177R probably damaging Het
4933402N22Rik G T 5: 11,918,127 R28M probably damaging Het
4933405L10Rik C G 8: 105,709,973 S267C possibly damaging Het
4933405L10Rik A C 8: 105,709,975 S268R possibly damaging Het
4933406M09Rik G A 1: 134,390,158 V223M probably damaging Het
4933436I01Rik G T X: 67,920,992 P87Q probably damaging Het
5031439G07Rik C G 15: 84,950,642 E372Q possibly damaging Het
5430401F13Rik T G 6: 131,552,721 L93V possibly damaging Het
5430419D17Rik G T 7: 131,265,866 V1419F unknown Het
6430628N08Rik G A 4: 115,898,259 R85H unknown Het
6720489N17Rik C A 13: 62,605,310 M67I probably benign Het
6720489N17Rik C T 13: 62,607,126 R64K probably null Het
9130204L05Rik C A 3: 91,088,356 V80L probably benign Het
9130409I23Rik C A 1: 181,055,417 P248H probably damaging Het
9130409I23Rik G A 1: 181,059,771 S307N probably benign Het
9330161L09Rik C G 12: 103,407,507 R35S unknown Het
9430007A20Rik C G 4: 144,528,500 Y163* probably null Het
9430007A20Rik C A 4: 144,528,712 S234* probably null Het
9430015G10Rik A T 4: 156,122,377 M91L probably benign Het
9530003J23Rik C A 10: 117,235,641 W111L probably benign Het
9530053A07Rik C T 7: 28,139,898 P379S probably benign Het
9630041A04Rik C A 9: 101,942,813 P144Q probably damaging Het
A1bg G T 15: 60,918,074 H442N possibly damaging Het
A2ml1 G T 6: 128,545,076 P1261H probably benign Het
A2ml1 G A 6: 128,561,616 Q614* probably null Het
A2ml1 C G 6: 128,575,607 V223L possibly damaging Het
A530016L24Rik G T 12: 112,495,076 G25W probably damaging Het
A530064D06Rik G A 17: 48,166,506 S81F probably damaging Het
Abat G T 16: 8,603,753 probably null Het
Abca1 C A 4: 53,079,584 K881N probably benign Het
Abca1 C A 4: 53,080,799 V837L probably benign Het
Abca1 C A 4: 53,086,133 D457Y possibly damaging Het
Abca12 A T 1: 71,276,082 F1893L possibly damaging Het
Abca12 C A 1: 71,282,811 D1707Y probably damaging Het
Abca12 G T 1: 71,292,531 L1287I probably damaging Het
Abca13 AGTGCCTTG AG 11: 9,314,545 probably null Het
Abca14 G T 7: 120,317,987 R1458S probably damaging Het
Abca3 CGGG CGGGG 17: 24,408,236 probably null Het
Abca4 C A 3: 122,147,786 H1634Q possibly damaging Het
Abca4 G T 3: 122,173,914 M2204I probably benign Het
Abca5 C G 11: 110,279,328 V1314L probably benign Het
Abcb11 C A 2: 69,306,529 G196V probably damaging Het
Abcb11 C A 2: 69,329,269 probably null Het
Abcb1a G T 5: 8,746,544 Q1171H probably damaging Het
Abcb1b G T 5: 8,837,596 M827I probably benign Het
Abcb4 C T 5: 8,939,906 Q820* probably null Het
Abcb6 C T 1: 75,176,125 G414D probably damaging Het
Abcc1 A C 16: 14,411,493 Q363P probably damaging Het
Abcc10 C A 17: 46,307,062 R1095L probably damaging Het
Abcc12 C A 8: 86,527,384 A924S possibly damaging Het
Abcc2 T A 19: 43,803,734 V318E probably benign Het
Abcc2 G T 19: 43,803,736 V319L probably benign Het
Abcc2 G A 19: 43,823,100 W1001* probably null Het
Abcc3 C A 11: 94,357,008 G1220W probably damaging Het
Abcc8 A T 7: 46,122,885 H823Q probably benign Het
Abcc8 C T 7: 46,154,509 A414T probably benign Het
Abcc9 T A 6: 142,594,758 Q1485L probably damaging Het
Abcc9 C A 6: 142,625,982 G1140V probably benign Het
Abcc9 T A 6: 142,645,938 Q788L probably null Het
Abce1 C A 8: 79,687,469 V538F probably benign Het
Abcg1 C G 17: 31,106,166 A322G probably benign Het
Abcg5 C A 17: 84,676,271 E113D probably benign Het
Abcg8 A T 17: 84,692,006 R178W possibly damaging Het
Abcg8 G T 17: 84,695,030 E336* probably null Het
Abcg8 C A 17: 84,696,118 P460T probably damaging Het
Abhd12 T A 2: 150,904,414 K45M probably benign Het
Abhd16a G C 17: 35,099,001 probably null Het
Abhd16a G T 17: 35,102,475 G516V probably damaging Het
Abi2 G C 1: 60,437,165 R132P probably damaging Het
Abl2 A T 1: 156,641,106 R647W probably damaging Het
Abl2 CA C 1: 156,641,553 probably null Het
Ablim2 C G 5: 35,824,043 H232D probably damaging Het
Ablim2 GATCGGTCCTA GA 5: 35,841,293 probably benign Het
Abtb2 G C 2: 103,711,196 G815R probably damaging Het
Acad12 C T 5: 121,599,194 probably null Het
Acads C A 5: 115,111,129 A351S probably benign Het
Acan C T 7: 79,094,170 P650S probably damaging Het
Acan G A 7: 79,100,137 G1552E probably damaging Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Acap1 T A 11: 69,882,443 T671S probably benign Het
Acap3 G T 4: 155,905,518 G748C probably damaging Het
Acat3 G T 17: 12,934,883 Q104K probably damaging Het
Accs C G 2: 93,848,153 A19P probably benign Het
Ace C A 11: 105,988,134 L1172M probably damaging Het
Acin1 C T 14: 54,642,750 R1332Q unknown Het
Aco2 T A 15: 81,895,310 M105K probably damaging Het
Aco2 G T 15: 81,895,312 A106S probably damaging Het
Acot5 G T 12: 84,069,894 R143L probably benign Het
Acox1 C A 11: 116,175,063 Q503H probably benign Het
Acox1 G T 11: 116,175,065 Q503K probably benign Het
Acox1 C A 11: 116,183,545 E117* probably null Het
Acox2 G A 14: 8,256,852 P4S probably benign Het
Acpp G T 9: 104,314,418 P223H probably damaging Het
Acr G A 15: 89,569,879 E140K possibly damaging Het
Acsbg1 C A 9: 54,614,934 G499C probably damaging Het
Acsbg1 C G 9: 54,621,966 S321T possibly damaging Het
Acsbg2 C A 17: 56,853,898 G249W probably benign Het
Acsf3 G T 8: 122,779,964 probably benign Het
Acsl6 G T 11: 54,320,172 E24* probably null Het
Acsm1 C A 7: 119,662,278 L573I probably benign Het
Acsm2 T A 7: 119,578,093 L277Q probably damaging Het
Acsm4 C A 7: 119,711,371 H494N probably damaging Het
Acss2 G T 2: 155,517,957 probably benign Het
Acss3 G C 10: 107,004,777 F374L probably damaging Het
Acta1 C A 8: 123,893,471 probably null Het
Actc1 C A 2: 114,047,513 E363* probably null Het
Actg1 G T 11: 120,348,109 L52I probably benign Het
Actl9 G T 17: 33,433,113 G49V probably damaging Het
Actn2 G T 13: 12,288,562 L451M probably damaging Het
Actn4 T G 7: 28,919,049 N62T probably damaging Het
Actr5 G A 2: 158,636,705 V492I probably benign Het
Actr8 G T 14: 29,986,401 W212L probably damaging Het
Actr8 G T 14: 29,987,242 V268L probably damaging Het
Actrt3 A T 3: 30,598,003 L314Q possibly damaging Het
Adam2 C T 14: 66,056,521 A286T probably damaging Het
Adam26b G T 8: 43,520,698 S422R probably benign Het
Adam26b G A 8: 43,521,422 T181I probably benign Het
Adam28 C A 14: 68,626,784 W523C probably damaging Het
Adam29 A G 8: 55,871,496 I641T probably damaging Het
Adam30 A T 3: 98,160,979 T43S probably damaging Het
Adam33 T A 2: 131,058,662 H86L possibly damaging Het
Adam39 C A 8: 40,825,295 T241K probably benign Het
Adamdec1 G T 14: 68,580,643 T34K probably benign Het
Adamts10 G C 17: 33,545,429 E676Q possibly damaging Het
Adamts10 G T 17: 33,545,594 R696L probably damaging Het
Adamts12 G A 15: 11,317,324 C1370Y probably damaging Het
Adamts12 G T 15: 11,336,383 C1518F not run Het
Adamts14 C A 10: 61,198,843 G1086C possibly damaging Het
Adamts15 G T 9: 30,902,491 R793S probably damaging Het
Adamts19 G T 18: 58,838,075 G244C probably damaging Het
Adamts19 G T 18: 58,890,374 R280S possibly damaging Het
Adamts3 G T 5: 89,707,864 C382* probably null Het
Adamts3 C T 5: 89,775,351 V199I not run Het
Adamts5 C A 16: 85,870,074 G510V probably damaging Het
Adamts9 C A 6: 92,854,346 G1342V probably damaging Het
Adarb2 C T 13: 8,570,200 P241S probably benign Het
Adck2 C T 6: 39,574,088 probably benign Het
Adcy1 G T 11: 7,100,642 E287* probably null Het
Adcy1 A T 11: 7,144,802 Q576L probably damaging Het
Adcy10 C A 1: 165,510,276 T153N possibly damaging Het
Adcy5 G A 16: 35,291,544 V924M not run Het
Adcy8 G T 15: 64,699,177 P1236T probably benign Het
Adgrb1 G T 15: 74,541,676 G570C probably damaging Het
Adgrb1 G T 15: 74,547,683 W791L probably damaging Het
Adgrb2 G T 4: 130,011,826 D822Y probably damaging Het
Adgrb2 G C 4: 130,019,119 G1313R probably damaging Het
Adgre1 G T 17: 57,419,374 C415F probably damaging Het
Adgre4 A T 17: 55,814,152 probably null Het
Adgrf1 G C 17: 43,310,147 G425A probably benign Het
Adgrf5 C T 17: 43,445,053 P634L probably benign Het
Adgrg1 T A 8: 95,007,630 C377S probably damaging Het
Adgrv1 C G 13: 81,419,256 W5266S possibly damaging Het
Adipor2 C A 6: 119,357,322 G309V possibly damaging Het
Adora1 C A 1: 134,203,009 R308L probably benign Het
Adora1 G C 1: 134,234,124 H78D possibly damaging Het
Adora1 G A 1: 134,234,228 A43V possibly damaging Het
Adora2b G A 11: 62,249,426 V109I probably benign Het
Adora3 G T 3: 105,907,785 A284S probably damaging Het
Adprhl1 G C 8: 13,245,476 H212Q possibly damaging Het
Adrm1 A T 2: 180,174,915 S198C unknown Het
Adrm1 G T 2: 180,175,372 G279V possibly damaging Het
Aebp2 G T 6: 140,624,094 A134S unknown Het
Aen G C 7: 78,902,766 R158P possibly damaging Het
AF529169 G T 9: 89,603,162 P61T probably damaging Het
Afap1l1 C A 18: 61,752,508 probably null Het
Aff1 G T 5: 103,783,753 R79L possibly damaging Het
Afm C A 5: 90,521,946 T44K probably benign Het
Afm C A 5: 90,531,506 N286K probably benign Het
Afm C A 5: 90,531,616 P323Q probably damaging Het
Afm C A 5: 90,551,383 T562K possibly damaging Het
Agbl1 C A 7: 76,720,206 S936R unknown Het
Agbl3 T G 6: 34,799,408 F283C probably damaging Het
Agl T A 3: 116,781,036 I40F Het
Agmat C A 4: 141,746,979 P57Q possibly damaging Het
Ago1 C A 4: 126,453,656 W433C probably damaging Het
Agrn C A 4: 156,171,544 E1447* probably null Het
Agrn C G 4: 156,179,576 V184L possibly damaging Het
Ahctf1 C G 1: 179,793,730 A157P probably damaging Het
Ahcyl1 C T 3: 107,673,435 probably null Het
Ahi1 G T 10: 21,041,007 probably benign Het
Ahnak G T 19: 9,017,468 G5372V probably damaging Het
Ahnak2 C A 12: 112,781,199 G1676V Het
Ahrr T G 13: 74,224,776 H185P probably benign Het
Ahsg C A 16: 22,899,047 P337Q probably damaging Het
AI182371 A C 2: 35,095,759 probably null Het
AI314180 C A 4: 58,861,614 D322Y probably damaging Het
AI413582 G T 17: 27,564,645 P10T probably benign Het
AI593442 G T 9: 52,677,912 P122T possibly damaging Het
AI597479 G T 1: 43,111,119 A130S probably benign Het
Aifm3 G T 16: 17,500,934 G206C probably benign Het
Aifm3 G T 16: 17,503,720 R479L probably benign Het
Ajap1 C A 4: 153,432,435 G150C probably benign Het
Ajap1 C A 4: 153,432,436 Q149H probably damaging Het
Akap13 G C 7: 75,615,005 G532A probably benign Het
Akap2 G A 4: 57,856,348 G559E probably damaging Het
Akap9 A T 5: 4,046,189 N2355Y probably damaging Het
Akp3 G T 1: 87,126,445 probably null Het
Akr1c12 G C 13: 4,272,954 L219V probably damaging Het
Akr1c20 G T 13: 4,523,244 S24Y probably benign Het
Aldh16a1 C A 7: 45,145,903 G444V probably null Het
Aldh1a2 T A 9: 71,283,522 V349E probably benign Het
Aldh1b1 G C 4: 45,802,692 D77H probably damaging Het
Aldh1l1 C A 6: 90,564,449 A275E probably benign Het
Aldh1l2 G T 10: 83,493,480 A822D probably damaging Het
Aldh1l2 G A 10: 83,534,005 R4W probably benign Het
Aldh5a1 C G 13: 24,911,638 G499R probably damaging Het
Aldh7a1 T A 18: 56,526,991 T528S probably benign Het
Alg1 G C 16: 5,239,967 G268R probably benign Het
Alg8 G T 7: 97,371,662 A9S probably benign Het
Alg9 G C 9: 50,788,173 G166A probably damaging Het
Alk G T 17: 72,603,063 S216Y probably damaging Het
Alox12 C A 11: 70,251,479 G308C possibly damaging Het
Alox8 G A 11: 69,185,221 R635W probably damaging Het
Alpk1 C A 3: 127,685,307 W30C Het
Als2cl G A 9: 110,888,528 G279S probably benign Het
Als2cl C A 9: 110,895,817 Y786* probably null Het
Alx3 C A 3: 107,604,834 P263T probably damaging Het
Alx4 G T 2: 93,642,656 probably benign Het
Ambra1 G T 2: 91,768,999 A155S possibly damaging Het
Ambra1 G T 2: 91,875,786 W865C probably damaging Het
Ambra1 C A 2: 91,900,608 N1030K possibly damaging Het
Amer3 C A 1: 34,587,196 S172* probably null Het
Amh G C 10: 80,807,586 E535Q possibly damaging Het
Amot C A X: 145,480,458 R110S Het
Ampd3 A T 7: 110,788,780 Q131L probably damaging Het
Amph G C 13: 19,139,334 D589H possibly damaging Het
Amy1 A T 3: 113,558,353 W397R probably damaging Het
Amy2a1 C A 3: 113,530,532 A120S not run Het
Anapc15 G T 7: 101,901,039 E153D unknown Het
Angptl6 C A 9: 20,878,411 G62C probably damaging Het
Ank2 T C 3: 126,944,357 Q2626R unknown Het
Ankk1 C A 9: 49,415,944 G645V probably damaging Het
Ankk1 G T 9: 49,416,487 A464E probably damaging Het
Ankra2 G T 13: 98,272,277 V263L possibly damaging Het
Ankrd11 C A 8: 122,900,142 Q100H probably damaging Het
Ankrd17 C A 5: 90,283,505 A807S possibly damaging Het
Ankrd17 C T 5: 90,289,325 A554T possibly damaging Het
Ankrd2 A G 19: 42,040,159 I85V Het
Ankrd2 G T 19: 42,044,999 A327S Het
Ankrd22 CT CTT 19: 34,123,491 probably null Het
Ankrd26 C A 6: 118,523,532 A993S possibly damaging Het
Ankrd26 C T 6: 118,523,595 E972K probably damaging Het
Ankrd27 G T 7: 35,603,878 V228L possibly damaging Het
Ankrd33b C A 15: 31,305,133 probably null Het
Ankrd35 G T 3: 96,683,770 Q457H probably damaging Het
Ankrd36 G T 11: 5,571,117 W88C probably damaging Het
Ankrd36 G A 11: 5,629,345 S203N probably benign Het
Ankrd36 C A 11: 5,643,738 P448T probably damaging Het
Ankrd45 G T 1: 161,160,738 G189W probably damaging Het
Ankrd45 G T 1: 161,160,752 K193N possibly damaging Het
Ankrd50 C G 3: 38,455,792 A809P probably damaging Het
Ankrd53 C G 6: 83,765,783 L253V possibly damaging Het
Ankrd7 G A 6: 18,866,564 A28T possibly damaging Het
Ano2 G T 6: 126,013,207 A764S probably damaging Het
Ano2 G A 6: 126,015,647 G861E probably damaging Het
Ano7 C A 1: 93,401,527 A681E probably damaging Het
Antxrl TC T 14: 34,067,930 probably null Het
Anxa11 G T 14: 25,870,176 G55C unknown Het
Aox2 C A 1: 58,354,397 P1239T possibly damaging Het
Ap1s1 C A 5: 137,045,233 probably benign Het
Ap2b1 G T 11: 83,365,753 G713V probably damaging Het
Ap3m2 C T 8: 22,791,321 S312N probably benign Het
Ap5b1 G T 19: 5,570,928 G792V probably damaging Het
Apba2 G T 7: 64,750,235 V725L probably benign Het
Apbb1ip G T 2: 22,875,103 A599S unknown Het
Apc G T 18: 34,314,463 V1471L probably benign Het
Apc2 C A 10: 80,312,036 R975S probably damaging Het
Apcdd1 G T 18: 62,922,691 G10* probably null Het
Aplp1 C A 7: 30,438,189 R482L probably benign Het
Aplp1 T A 7: 30,438,279 probably null Het
Apoa5 G A 9: 46,269,119 A8T possibly damaging Het
Apob C A 12: 7,988,765 L406I probably benign Het
Apob GCC GC 12: 8,015,249 probably null Het
Apobec4 G T 1: 152,756,726 W168C probably damaging Het
Apod C T 16: 31,297,520 V131M probably damaging Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
Aqp4 C G 18: 15,399,881 G52R possibly damaging Het
Arcn1 C G 9: 44,757,253 G229R probably damaging Het
Arf6 G T 12: 69,372,407 probably benign Het
Arfgap2 C T 2: 91,275,104 S468L probably benign Het
Arfgap3 C A 15: 83,332,688 E159* probably null Het
Arfgef3 A C 10: 18,607,776 I1400S probably damaging Het
Arfgef3 C A 10: 18,627,628 V1010L probably damaging Het
Arhgap20 C A 9: 51,824,924 L179I probably damaging Het
Arhgap30 A C 1: 171,407,908 K617Q probably benign Het
Arhgap32 G T 9: 32,260,680 Q1585H probably damaging Het
Arhgap33 C G 7: 30,522,817 R1230P probably damaging Het
Arhgef10l C A 4: 140,516,772 R852L probably benign Het
Arhgef16 G T 4: 154,281,453 S501Y probably damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Arhgef28 C A 13: 97,899,756 G1665V probably benign Het
Arhgef33 G T 17: 80,384,230 G50V unknown Het
Arhgef38 C A 3: 133,206,961 E106* probably null Het
Arhgef4 C G 1: 34,722,921 S419R unknown Het
Arhgef4 A G 1: 34,723,366 S568G unknown Het
Arhgef4 C G 1: 34,724,259 S865R probably benign Het
Arhgef6 C A X: 57,304,624 probably benign Het
Arid1a C A 4: 133,680,916 W1708C unknown Het
Arid1b G T 17: 4,996,328 A464S possibly damaging Het
Arid2 A C 15: 96,390,986 Q1672P probably damaging Het
Arid3a A C 10: 79,949,430 Q344P probably damaging Het
Arid3c C A 4: 41,730,177 R6M possibly damaging Het
Arid4a G A 12: 71,075,637 E931K possibly damaging Het
Arid5b C T 10: 68,097,228 R948Q probably damaging Het
Arl11 CA CAA 14: 61,310,868 probably null Het
Armc1 G T 3: 19,149,574 L63I probably benign Het
Armc3 C A 2: 19,285,991 T427K probably benign Het
Armc5 G T 7: 128,240,625 G372C probably damaging Het
Armc5 C A 7: 128,240,830 T440N probably damaging Het
Armc5 G T 7: 128,244,663 R876L probably damaging Het
Armc8 C T 9: 99,497,386 A496T probably damaging Het
Armc9 G C 1: 86,176,825 E265D probably damaging Het
Armc9 G C 1: 86,196,355 R417P probably benign Het
Armcx4 C A X: 134,693,042 A1233D not run Het
Armcx6 C A X: 134,749,992 G30V probably damaging Het
Arnt2 G A 7: 84,263,207 T575I possibly damaging Het
Arsj G T 3: 126,438,909 G435C probably damaging Het
Art3 C G 5: 92,412,206 L75V unknown Het
Art4 G T 6: 136,849,583 P299T probably damaging Het
Arvcf T A 16: 18,389,299 L41Q probably damaging Het
Asb14 T C 14: 26,912,299 V487A probably benign Het
Asb3 C G 11: 31,058,965 P250A possibly damaging Het
Ascc3 A T 10: 50,718,421 H1204L probably benign Het
Asic2 G C 11: 80,894,011 I367M possibly damaging Het
Asic2 G T 11: 81,152,090 R126S probably benign Het
Asic2 G A 11: 81,152,240 R76C possibly damaging Het
Asic4 A T 1: 75,469,220 Q231L probably benign Het
Aspdh G T 7: 44,465,530 R20L probably damaging Het
Aspg G A 12: 112,121,021 V304M probably damaging Het
Asprv1 C A 6: 86,628,344 S57R probably damaging Het
Asxl2 A C 12: 3,474,589 S206R probably damaging Het
Asxl3 G T 18: 22,516,339 V462L probably benign Het
Asxl3 C G 18: 22,523,591 R1553G probably damaging Het
Atf7ip2 A T 16: 10,241,640 Q348L possibly damaging Het
Atg2b C A 12: 105,635,764 R1651L probably damaging Het
Atg9b C T 5: 24,391,787 G44R probably benign Het
Atl3 G T 19: 7,530,553 A357S probably benign Het
Atn1 C A 6: 124,745,035 G952C unknown Het
Atoh8 C A 6: 72,235,126 K13N probably damaging Het
Atp10b G C 11: 43,153,349 G134A probably benign Het
Atp11b G T 3: 35,806,854 M363I probably benign Het
Atp12a C A 14: 56,373,215 T272K probably damaging Het
Atp13a5 C A 16: 29,280,969 W761C probably damaging Het
Atp1a2 G T 1: 172,287,336 T294K probably damaging Het
Atp1a3 C A 7: 24,980,119 V904L probably benign Het
Atp1b3 C A 9: 96,333,560 L267F probably damaging Het
Atp2a3 C G 11: 72,980,327 S582R possibly damaging Het
Atp2b1 G T 10: 99,018,848 R1101L probably damaging Het
Atp2c2 C A 8: 119,734,385 T239N probably benign Het
Atp4a G T 7: 30,717,840 Q549H possibly damaging Het
Atp4b C A 8: 13,389,794 A143S probably benign Het
Atp4b GGTTCCAACAGTAGT GGT 8: 13,396,684 probably benign Het
Atp5s G A 12: 69,740,962 probably benign Het
Atp7b C A 8: 21,994,877 R1388L probably benign Het
Atp8a2 C A 14: 60,006,330 R642L possibly damaging Het
Atp8b3 A T 10: 80,531,077 V229E probably benign Het
Atp8b4 T A 2: 126,322,824 T1191S probably benign Het
Atp8b4 A T 2: 126,433,943 L123Q probably damaging Het
Atp8b5 T A 4: 43,370,669 L982I probably benign Het
Atr A T 9: 95,888,100 R1194S probably benign Het
Atrn G T 2: 130,946,042 G255C probably damaging Het
Atxn7l3b T A 10: 112,928,454 Q90L possibly damaging Het
Atxn7l3b C G 10: 112,928,479 G82R probably damaging Het
AU040320 G C 4: 126,842,633 Q836H probably benign Het
Aup1 A G 6: 83,057,524 E437G unknown Het
Axin2 G T 11: 108,923,474 G63W probably damaging Het
Axl C A 7: 25,761,526 G686V probably damaging Het
B020004C17Rik C T 14: 57,015,260 Q2* probably null Het
B230359F08Rik G A 14: 53,795,507 probably benign Het
B3galt1 G T 2: 68,117,990 W16C probably damaging Het
B3galt4 C A 17: 33,951,136 A43S unknown Het
B3galt5 C A 16: 96,315,379 R71S probably damaging Het
B3galt5 G C 16: 96,316,032 Q288H probably benign Het
B3gntl1 C T 11: 121,639,814 D144N probably benign Het
B4galt2 C A 4: 117,881,069 M113I probably benign Het
Babam1 G T 8: 71,399,563 V132F probably benign Het
Bag6 A C 17: 35,142,924 Q510P unknown Het
Bahcc1 G A 11: 120,272,921 V682M possibly damaging Het
Baz2b C G 2: 59,977,520 A132P probably benign Het
Bbox1 C A 2: 110,270,188 K221N probably benign Het
Bbs5 G A 2: 69,665,071 V288M probably benign Het
Bbs7 C T 3: 36,602,920 G253E probably damaging Het
BC016579 C A 16: 45,648,896 V70F possibly damaging Het
BC027072 C A 17: 71,750,403 G760W probably damaging Het
BC049762 G C 11: 51,253,968 A106G probably benign Het
BC051019 G T 7: 109,720,640 P72Q probably benign Het
BC055324 T A 1: 163,964,517 R611W probably damaging Het
Bcam C A 7: 19,760,107 A420S probably null Het
Bcar3 G C 3: 122,505,018 R144P probably damaging Het
Bcl11b C A 12: 107,989,740 G50V probably damaging Het
Bcl2a1a G T 9: 88,957,466 G139V probably damaging Het
Bcl2a1c A C 9: 114,330,468 T105P probably benign Het
Bcl2l11 C G 2: 128,128,995 N121K probably damaging Het
Bcl2l11 G T 2: 128,147,193 R164M probably damaging Het
Bdh1 C T 16: 31,455,175 A186V possibly damaging Het
Bdh1 A G 16: 31,455,177 K187E possibly damaging Het
Bdp1 T A 13: 100,061,396 K827M probably damaging Het
Best1 G C 19: 9,993,239 S79C probably damaging Het
Bfar G T 16: 13,688,810 V175L probably benign Het
Bid C T 6: 120,900,258 E41K probably damaging Het
Birc6 G T 17: 74,647,280 A3376S probably benign Het
Bmp2k G T 5: 97,053,156 A312S probably damaging Het
Bmpr2 G A 1: 59,847,167 R321Q not run Het
Bnc1 C A 7: 81,968,470 R949L probably damaging Het
Bpifa3 C G 2: 154,136,292 T138R possibly damaging Het
Bpifb3 C T 2: 153,925,789 P261S probably benign Het
Bpnt1 G A 1: 185,352,269 G188R probably damaging Het
Brd2 C A 17: 34,116,907 probably null Het
Brd2 C A 17: 34,116,908 probably benign Het
Brinp2 C A 1: 158,246,782 V590L possibly damaging Het
Brpf3 G T 17: 28,821,478 D958Y probably benign Het
Brsk1 G C 7: 4,704,222 C258S probably damaging Het
Bsn C T 9: 108,105,499 R913H Het
Bsn G C 9: 108,139,195 L206V probably damaging Het
Bst1 C A 5: 43,819,032 P36T probably damaging Het
Btbd10 C G 7: 113,332,689 V169L probably benign Het
Btbd18 G T 2: 84,661,568 G31V probably damaging Het
Btbd7 C T 12: 102,811,120 E483K probably damaging Het
Btla C A 16: 45,239,272 P113Q possibly damaging Het
Btnl2 G T 17: 34,363,519 R353L probably benign Het
Btnl4 C A 17: 34,470,060 probably null Het
Bud13 G C 9: 46,291,740 R487P probably damaging Het
C1qb C A 4: 136,882,281 W9C probably benign Het
C1qtnf1 G C 11: 118,443,754 W20S probably benign Het
C1qtnf12 G T 4: 155,965,649 R202L probably damaging Het
C1qtnf4 G T 2: 90,889,505 G41C probably damaging Het
C1s2 G T 6: 124,625,734 A506D possibly damaging Het
C2cd4b C G 9: 67,759,799 P26A probably damaging Het
C2cd5 C A 6: 143,029,206 E820D probably null Het
C3 G A 17: 57,217,144 A964V probably benign Het
C3 G T 17: 57,226,171 S144Y probably damaging Het
C7 C T 15: 5,015,375 D394N probably benign Het
C9 C A 15: 6,491,519 P482T probably damaging Het
Cabin1 C T 10: 75,648,123 A2043T probably benign Het
Cables1 G T 18: 11,941,317 G525V probably damaging Het
Cabp4 G T 19: 4,136,222 L227M probably damaging Het
Cacna1a C A 8: 84,579,491 D1289E probably damaging Het
Cacna1b T G 2: 24,638,677 M1609L probably damaging Het
Cacna1b G T 2: 24,661,790 P1115H probably damaging Het
Cacna1b G T 2: 24,678,988 H975N probably damaging Het
Cacna1c G T 6: 118,757,661 probably benign Het
Cacna1e G T 1: 154,442,292 A1448E probably damaging Het
Cacna1g C A 11: 94,459,596 Q474H probably benign Het
Cacna1g C A 11: 94,473,590 A10S probably benign Het
Cacna1h C A 17: 25,375,892 E2097D probably damaging Het
Cacna1h T A 17: 25,391,378 E718V probably damaging Het
Cacna1h C A 17: 25,393,584 W380L probably benign Het
Cacna1i G T 15: 80,381,179 R1544L possibly damaging Het
Cacna1i G T 15: 80,389,383 G1757C possibly damaging Het
Cacna1s G C 1: 136,117,686 A1691P probably benign Het
Cacna2d3 A C 14: 29,347,163 D232E possibly damaging Het
Cad G T 5: 31,068,421 G1017V probably damaging Het
Cad G T 5: 31,075,128 D1846Y probably benign Het
Cadps C G 14: 12,465,880 R1010P probably damaging Het
Cadps2 A T 6: 23,385,478 L782I possibly damaging Het
Cadps2 C G 6: 23,626,695 S198T probably damaging Het
Cadps2 G T 6: 23,838,818 P107H probably damaging Het
Calcb G T 7: 114,722,162 probably null Het
Calm4 G C 13: 3,838,199 V102L possibly damaging Het
Calml3 C A 13: 3,804,011 D18Y probably damaging Het
Caln1 C A 5: 130,839,314 C230* probably null Het
Calr4 G T 4: 109,235,733 W3C probably benign Het
Calu G T 6: 29,372,515 V230L probably damaging Het
Camta1 A T 4: 151,077,925 L454Q probably damaging Het
Camta2 C A 11: 70,675,221 G746* probably null Het
Capg G A 6: 72,556,230 C166Y probably damaging Het
Capn12 T A 7: 28,887,828 W380R probably damaging Het
Capn15 T A 17: 25,973,220 H16L probably benign Het
Capn8 G T 1: 182,613,346 E448D probably benign Het
Caprin1 C G 2: 103,775,934 E320D probably null Het
Car12 C A 9: 66,751,954 P39Q probably benign Het
Car3 G T 3: 14,871,636 R253M Het
Car4 C G 11: 84,963,419 P64R possibly damaging Het
Car5a C T 8: 121,916,373 M297I probably benign Het
Car8 G C 4: 8,221,594 R126G probably damaging Het
Card10 G T 15: 78,795,328 P307T probably benign Het
Card11 T A 5: 140,898,241 I428F probably benign Het
Card14 C A 11: 119,341,061 H818Q probably damaging Het
Card9 G C 2: 26,357,551 R241G probably damaging Het
Carf A C 1: 60,136,262 probably null Het
Casd1 G T 6: 4,631,531 W549L possibly damaging Het
Caskin1 T A 17: 24,496,687 C142S probably damaging Het
Caskin2 C T 11: 115,806,781 A110T possibly damaging Het
Cass4 C T 2: 172,427,575 Q526* probably null Het
Cast C A 13: 74,725,463 K402N probably damaging Het
Casz1 C A 4: 148,933,306 P351T probably damaging Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catsper1 A T 19: 5,343,883 Q641L probably damaging Het
Catsperb G C 12: 101,446,048 W131C probably damaging Het
Catspere2 G T 1: 178,156,802 probably benign Het
Catsperg2 A T 7: 29,697,782 W1099R possibly damaging Het
Cbarp G C 10: 80,131,872 R512G probably damaging Het
Cbarp G T 10: 80,133,060 P367T probably damaging Het
Cbfa2t3 G A 8: 122,630,757 P605S probably benign Het
Cblc T G 7: 19,785,278 D419A probably benign Het
Cbr2 G C 11: 120,730,279 A164G possibly damaging Het
Cbs C G 17: 31,625,882 probably null Het
Cbx4 C T 11: 119,085,766 W35* probably null Het
Cbx7 G T 15: 79,933,884 L6M unknown Het
Cc2d2a C T 5: 43,703,204 P541S probably benign Het
Ccdc121 G A 1: 181,510,739 T216M probably damaging Het
Ccdc129 G T 6: 55,968,234 G647C probably damaging Het
Ccdc14 G C 16: 34,723,670 K847N probably damaging Het
Ccdc141 G T 2: 77,015,149 S1191R probably benign Het
Ccdc157 G A 11: 4,146,547 Q503* probably null Het
Ccdc162 G T 10: 41,683,195 A136D probably benign Het
Ccdc170 A C 10: 4,509,884 T5P probably benign Het
Ccdc177 G T 12: 80,757,736 A588E unknown Het
Ccdc178 G T 18: 22,109,731 R276S possibly damaging Het
Ccdc185 G T 1: 182,748,514 N203K possibly damaging Het
Ccdc191 G C 16: 43,939,122 E429Q possibly damaging Het
Ccdc25 A T 14: 65,865,128 probably null Het
Ccdc27 C A 4: 154,036,471 M289I unknown Het
Ccdc33 G T 9: 58,118,585 Q54K possibly damaging Het
Ccdc38 C A 10: 93,562,876 S172Y probably damaging Het
Ccdc40 C G 11: 119,238,107 R390G probably damaging Het
Ccdc40 C T 11: 119,254,398 S973L probably benign Het
Ccdc60 C A 5: 116,288,709 probably benign Het
Ccdc68 G T 18: 69,947,050 probably null Het
Ccdc71l G C 12: 32,379,615 R211P possibly damaging Het
Ccdc73 C A 2: 104,992,239 C16* probably null Het
Ccdc7a C A 8: 128,807,924 R1357L possibly damaging Het
Ccdc81 T A 7: 89,881,657 Q359L probably damaging Het
Ccdc85a C A 11: 28,583,491 A18S probably benign Het
Ccdc88c G T 12: 100,945,155 H807N probably benign Het
Ccdc90b G A 7: 92,568,557 M102I possibly damaging Het
Cchcr1 G T 17: 35,528,663 Q532H probably damaging Het
Ccin G T 4: 43,984,902 K436N probably benign Het
Ccl17 G T 8: 94,811,189 R35L possibly damaging Het
Ccna2 C A 3: 36,571,701 Q41H probably benign Het
Ccnt2 G T 1: 127,803,058 K557N probably damaging Het
Ccny T G 18: 9,353,494 Q93P probably benign Het
Ccr4 C G 9: 114,492,839 G53R probably damaging Het
Ccr8 C G 9: 120,094,499 L227V probably benign Het
Cct7 G T 6: 85,466,669 D340Y possibly damaging Het
Cd101 A C 3: 101,011,916 D627E probably benign Het
Cd101 G T 3: 101,017,140 Q328K probably benign Het
Cd109 G T 9: 78,691,313 Q944H probably damaging Het
Cd163 G A 6: 124,317,385 V501I probably benign Het
Cd177 C A 7: 24,760,256 G11W probably damaging Het
Cd180 C A 13: 102,706,032 H529N possibly damaging Het
Cd2 G C 3: 101,276,106 R296G probably damaging Het
Cd200 C A 16: 45,394,688 R200L possibly damaging Het
Cd209e T A 8: 3,851,181 S158C probably null Het
Cd244 T A 1: 171,574,350 C215S probably damaging Het
Cd248 G C 19: 5,069,165 G347A probably damaging Het
Cd6 G C 19: 10,791,445 R503G probably damaging Het
Cd8a G T 6: 71,374,593 R179L possibly damaging Het
Cdc42bpg A T 19: 6,309,746 E119V probably damaging Het
Cdc42bpg C A 19: 6,314,522 N593K possibly damaging Het
Cdc42bpg G A 19: 6,314,523 G594S probably damaging Het
Cdc42ep2 C A 19: 5,918,108 D190Y probably damaging Het
Cdc42ep2 G A 19: 5,918,645 R11C probably damaging Het
Cdc42ep3 C A 17: 79,334,878 M204I probably benign Het
Cdc42ep3 C A 17: 79,334,898 D198Y probably damaging Het
Cdca2 C A 14: 67,680,244 K568N probably damaging Het
Cdh1 G A 8: 106,656,839 V237M probably damaging Het
Cdh16 T G 8: 104,623,440 probably null Het
Cdh22 C A 2: 165,146,680 G252C probably damaging Het
Cdh23 C A 10: 60,323,555 R2149L possibly damaging Het
Cdh23 T A 10: 60,434,614 probably null Het
Cdh4 C A 2: 179,780,326 A81E probably benign Het
Cdh9 C T 15: 16,850,364 P528S probably benign Het
Cdhr2 C A 13: 54,715,671 P122T probably damaging Het
Cdhr2 G T 13: 54,718,564 C361F probably damaging Het
Cdhr2 A T 13: 54,726,408 R764S probably benign Het
Cdipt A T 7: 126,976,944 I24F probably benign Het
Cdk14 C A 5: 4,888,894 G461W possibly damaging Het
Cdk5rap3 C G 11: 96,912,216 probably null Het
Cdk8 G A 5: 146,299,795 R340K probably damaging Het
Cdk8 A T 5: 146,299,796 R340S probably damaging Het
Cdk8 G T 5: 146,301,637 S379I probably benign Het
Cdkl4 G T 17: 80,550,858 L111I probably damaging Het
Cdkl5 C A X: 160,824,045 V736F probably benign Het
Cdkn1c C A 7: 143,460,316 G131V probably damaging Het
Cdnf G A 2: 3,521,083 S104N possibly damaging Het
Cdon G T 9: 35,491,900 C1102F probably damaging Het
Cdyl G C 13: 35,816,070 R111S probably benign Het
Ceacam12 G C 7: 18,067,515 V140L probably damaging Het
Ceacam19 G T 7: 19,882,844 A175D probably damaging Het
Ceacam19 G T 7: 19,886,449 P86T probably damaging Het
Ceacam20 G A 7: 19,970,164 probably null Het
Cebpe C A 14: 54,710,580 E269* probably null Het
Cecr2 C A 6: 120,720,962 T74K probably damaging Het
Cela3b G T 4: 137,428,484 H37Q probably damaging Het
Celf1 G T 2: 91,004,705 C177F possibly damaging Het
Celsr1 A C 15: 85,978,851 C1327G probably damaging Het
Celsr2 C T 3: 108,412,220 R1092Q probably damaging Het
Celsr2 C T 3: 108,413,571 V642I probably benign Het
Celsr3 C A 9: 108,826,477 A53E probably benign Het
Cemip C A 7: 83,947,296 G1087C probably damaging Het
Cenpe G C 3: 135,216,385 V68L possibly damaging Het
Cenpj C G 14: 56,552,879 R571P possibly damaging Het
Cep128 C A 12: 91,289,603 M364I probably benign Het
Cep128 C A 12: 91,364,371 A75S probably damaging Het
Cep131 C A 11: 120,065,715 G936W probably damaging Het
Cep135 A T 5: 76,591,826 Q23L probably damaging Het
Cep152 C A 2: 125,614,324 V256F probably benign Het
Cep152 C T 2: 125,619,704 V151M probably damaging Het
Cep162 C A 9: 87,199,980 probably null Het
Cep250 A T 2: 155,976,467 Q854L probably benign Het
Cep290 G A 10: 100,497,944 R286Q probably benign Het
Cep290 G T 10: 100,538,997 K1368N possibly damaging Het
Cep295 C A 9: 15,330,817 D46Y Het
Cep89 G T 7: 35,397,081 probably benign Het
Ces1b T A 8: 93,076,154 T103S probably benign Het
Ces1h T A 8: 93,366,840 probably null Het
Ces2b AGG AG 8: 104,832,595 probably null Het
Ces2f G T 8: 104,948,235 G90W probably damaging Het
Ces2g C A 8: 104,963,961 L125M probably damaging Het
Ces3b G T 8: 105,085,083 R77L probably damaging Het
Cfap157 A C 2: 32,778,207 L407R probably damaging Het
Cfap221 C G 1: 119,984,743 R138P probably damaging Het
Cfap44 G T 16: 44,432,044 V839L probably benign Het
Cfap46 T A 7: 139,601,267 Q2606L unknown Het
Cfap46 G T 7: 139,630,626 P1768Q unknown Het
Cfap53 A T 18: 74,305,552 K267* probably null Het
Cfap54 G T 10: 92,979,026 P1315H probably damaging Het
Cfap57 C T 4: 118,598,956 probably null Het
Cfap61 G A 2: 146,012,162 V365M possibly damaging Het
Cfap61 G C 2: 146,153,800 C1095S probably damaging Het
Cfap69 C T 5: 5,586,384 C747Y possibly damaging Het
Cfap74 G T 4: 155,454,913 probably benign Het
Cfh G T 1: 140,144,059 P297H probably damaging Het
Chd1 G T 17: 15,747,801 G866C probably damaging Het
Chd2 C G 7: 73,468,586 A1095P possibly damaging Het
Cherp T G 8: 72,462,916 K687Q Het
Cherp C A 8: 72,475,135 probably benign Het
Chil5 G T 3: 106,028,818 H53N probably damaging Het
Chl1 C A 6: 103,693,096 Y482* probably null Het
Chl1 A T 6: 103,697,949 probably benign Het
Chmp1a C G 8: 123,206,331 V128L probably benign Het
Chmp3 C A 6: 71,543,804 probably benign Het
Chodl C A 16: 78,941,463 S106R possibly damaging Het
Chpf2 CGGG CGGGG 5: 24,591,519 probably null Het
Chrm2 G C 6: 36,524,607 R466S probably damaging Het
Chrna10 C A 7: 102,113,264 V240L probably benign Het
Chrna10 C A 7: 102,114,987 L63F possibly damaging Het
Chrna2 T A 14: 66,151,027 L497Q probably null Het
Chrna4 C A 2: 181,024,813 V611F probably damaging Het
Chrna4 G C 2: 181,028,285 H559Q possibly damaging Het
Chrna5 G A 9: 55,004,956 A347T possibly damaging Het
Chrna6 C G 8: 27,413,689 R5P probably benign Het
Chrna7 C T 7: 63,107,551 probably null Het
Chrna9 T A 5: 65,971,220 L257Q probably damaging Het
Chrnb1 G T 11: 69,794,189 A105D possibly damaging Het
Chrng C G 1: 87,205,995 S14R unknown Het
Chrng C A 1: 87,206,298 N87K probably benign Het
Chrng C A 1: 87,208,263 Q245K probably benign Het
Chrng C T 1: 87,208,303 T201I probably damaging Het
Chst2 C A 9: 95,404,841 R484L probably damaging Het
Chst3 C A 10: 60,186,260 G255V probably benign Het
Ciart G C 3: 95,879,023 P247A probably damaging Het
Cidec G C 6: 113,434,496 L8V probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cilp2 C A 8: 69,882,808 E513D probably damaging Het
Cilp2 A C 8: 69,884,542 C206G probably damaging Het
Cilp2 G T 8: 69,884,546 C204* probably null Het
Cirbp G T 10: 80,170,235 A82S probably damaging Het
Ckap5 T G 2: 91,585,798 L1023R probably damaging Het
Ckmt1 C A 2: 121,359,575 P81H probably damaging Het
Clasp2 G T 9: 113,770,221 G135C probably damaging Het
Clasp2 T A 9: 113,908,795 L1079Q probably damaging Het
Clca2 C A 3: 145,086,451 G350C probably damaging Het
Clcn4 C A 7: 7,293,040 E268* probably null Het
Clcn4 C A 7: 7,294,756 A165S probably damaging Het
Clcn6 C A 4: 148,023,370 G193* probably null Het
Clcn7 G T 17: 25,153,015 probably null Het
Clcnkb G T 4: 141,407,951 T492K probably damaging Het
Cldn1 G T 16: 26,360,864 P151H probably damaging Het
Cldn16 G T 16: 26,481,250 R146L probably damaging Het
Cldn9 G C 17: 23,683,201 P150R probably damaging Het
Cldnd1 G T 16: 58,729,681 G76W probably damaging Het
Clec1a G A 6: 129,429,907 P215L probably benign Het
Clec4a1 G T 6: 122,933,892 R235S possibly damaging Het
Clec4d G T 6: 123,268,074 W104C probably damaging Het
Clec4f C A 6: 83,645,221 R546I possibly damaging Het
Clgn T A 8: 83,397,681 M84K probably benign Het
Clic6 C T 16: 92,499,139 S229F probably benign Het
Clip1 C A 5: 123,617,350 A956S probably damaging Het
Clip2 C G 5: 134,516,835 R334P probably damaging Het
Clip2 C A 5: 134,522,999 G90C probably damaging Het
Clip4 G T 17: 71,799,097 probably null Het
Clmn C A 12: 104,781,376 K637N probably benign Het
Clp1 C A 2: 84,725,963 D58Y probably benign Het
Clptm1 C T 7: 19,637,468 probably null Het
Clpx C A 9: 65,299,997 S59* probably null Het
Clspn G A 4: 126,566,177 R399Q probably benign Het
Clstn2 C A 9: 97,461,356 M679I probably benign Het
Clstn3 C A 6: 124,449,781 G564V probably damaging Het
Clu A T 14: 65,975,921 Q252L probably damaging Het
Cluh G C 11: 74,667,754 K1217N possibly damaging Het
Cmah C A 13: 24,435,684 Y277* probably null Het
Cmbl G T 15: 31,581,965 R36L probably benign Het
Cmtr2 CGGG CGG 8: 110,221,499 probably null Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
Cnga1 C A 5: 72,605,530 probably null Het
Cngb1 A T 8: 95,252,136 L1022Q probably damaging Het
Cnksr1 T C 4: 134,232,150 D391G probably damaging Het
Cnnm3 G A 1: 36,513,033 A375T possibly damaging Het
Cnot11 G T 1: 39,535,848 G4C probably damaging Het
Cnot3 G T 7: 3,651,495 R57L probably damaging Het
Cnpy1 C A 5: 28,207,209 V109L possibly damaging Het
Cntn1 C A 15: 92,309,970 P814H probably damaging Het
Cntn3 C A 6: 102,337,331 V141L probably benign Het
Cntn4 G T 6: 106,550,425 G423C probably damaging Het
Cntn4 C A 6: 106,662,618 H570N probably damaging Het
Cntn5 C A 9: 9,673,962 E712* probably null Het
Cntn5 C A 9: 10,090,236 G198C probably damaging Het
Cntn6 C A 6: 104,832,584 P527T probably damaging Het
Cntnap2 C T 6: 46,015,299 P387S possibly damaging Het
Cntnap3 G C 13: 64,781,892 P498A probably damaging Het
Cntnap5a A T 1: 116,412,168 Q719L probably benign Het
Cntnap5b C T 1: 100,050,706 A149V probably damaging Het
Cntrob C A 11: 69,311,449 R439L possibly damaging Het
Cog4 A T 8: 110,879,015 T570S probably benign Het
Cog5 G T 12: 31,801,985 G280C probably damaging Het
Cog6 T C 3: 53,013,864 D107G probably damaging Het
Col11a1 G T 3: 114,138,921 G902C unknown Het
Col11a1 G C 3: 114,165,235 probably null Het
Col11a2 G T 17: 34,051,666 R537M probably benign Het
Col12a1 C A 9: 79,599,986 G263V possibly damaging Het
Col12a1 C CA 9: 79,639,696 probably null Het
Col13a1 C A 10: 61,905,262 G150C probably damaging Het
Col14a1 A C 15: 55,372,570 probably null Het
Col15a1 G T 4: 47,245,807 R186L probably benign Het
Col17a1 G A 19: 47,650,304 P1141L possibly damaging Het
Col18a1 T A 10: 77,112,838 Q280L unknown Het
Col1a1 G A 11: 94,943,804 M569I probably benign Het
Col22a1 G T 15: 71,915,120 P752T unknown Het
Col24a1 G T 3: 145,342,499 G619V probably damaging Het
Col25a1 G T 3: 130,522,461 G297V probably damaging Het
Col27a1 G T 4: 63,281,289 G928W probably damaging Het
Col28a1 G T 6: 8,062,283 P669Q possibly damaging Het
Col28a1 C A 6: 8,127,352 G366C probably damaging Het
Col28a1 T A 6: 8,175,630 S73C unknown Het
Col2a1 C A 15: 97,983,973 K781N probably damaging Het
Col2a1 G T 15: 97,998,345 P162H unknown Het
Col3a1 C T 1: 45,311,800 P18L unknown Het
Col4a1 C T 8: 11,235,218 G388S unknown Het
Col4a1 C G 8: 11,239,024 G311R unknown Het
Col4a3 G T 1: 82,690,039 G1010C unknown Het
Col5a2 C G 1: 45,402,113 G664A probably damaging Het
Col5a2 C A 1: 45,403,473 G604V probably damaging Het
Col5a3 C A 9: 20,775,334 A1332S unknown Het
Col6a2 C A 10: 76,596,350 A990S possibly damaging Het
Col6a3 A T 1: 90,811,728 D866E possibly damaging Het
Col6a5 C A 9: 105,930,785 E1021D unknown Het
Col6a6 C A 9: 105,728,255 G1644C probably damaging Het
Col6a6 C A 9: 105,788,895 G21C probably null Het
Col7a1 G T 9: 108,974,923 G2198W unknown Het
Col7a1 C G 9: 108,976,051 D2322E unknown Het
Col7a1 C A 9: 108,984,077 H2897N unknown Het
Col8a1 C A 16: 57,628,238 G303V unknown Het
Col8a1 C A 16: 57,632,450 L63F probably damaging Het
Col8a2 C A 4: 126,311,543 P449T unknown Het
Colgalt1 G T 8: 71,623,208 G500C probably damaging Het
Commd4 C A 9: 57,157,131 R4L probably damaging Het
Comp G T 8: 70,377,221 R365L probably benign Het
Copa AG A 1: 172,106,123 probably null Het
Copg2 C T 6: 30,809,585 R708Q probably benign Het
Coq7 C A 7: 118,510,149 K225N unknown Het
Corin C A 5: 72,454,493 R141S probably benign Het
Coro6 C A 11: 77,469,109 A372D probably damaging Het
Cox10 C A 11: 63,976,470 L233F possibly damaging Het
Cox4i1 G T 8: 120,668,280 probably benign Het
Cpa4 G T 6: 30,574,403 V64L possibly damaging Het
Cpa6 T A 1: 10,329,559 probably null Het
Cpn1 C A 19: 43,973,976 G178V probably damaging Het
Cpne5 C G 17: 29,159,182 R541P probably damaging Het
Cpsf7 G T 19: 10,535,518 S322I probably null Het
Cpt1a A T 19: 3,366,370 Q307L probably damaging Het
Cpt1a G T 19: 3,370,727 R395L probably damaging Het
Cpxm2 C G 7: 132,055,001 A511P probably benign Het
Cpz G T 5: 35,511,761 S342* probably null Het
Cracr2a G T 6: 127,607,244 A89S probably benign Het
Cracr2a A T 6: 127,669,063 D706V probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Crb1 T A 1: 139,248,901 Q448L possibly damaging Het
Crb1 A T 1: 139,337,028 probably null Het
Crb2 G A 2: 37,787,365 G290R probably damaging Het
Crb2 G C 2: 37,790,824 R588P possibly damaging Het
Crebl2 G A 6: 134,830,433 D2N probably damaging Het
Crispld1 TCC TC 1: 17,764,092 probably null Het
Crmp1 G T 5: 37,278,124 V308L probably benign Het
Crnn T G 3: 93,149,296 V463G probably damaging Het
Crocc2 A T 1: 93,213,595 R1157W probably damaging Het
Crocc2 A T 1: 93,226,692 Q1603L probably benign Het
Crybb2 C A 5: 113,058,435 G178V probably damaging Het
Crybb2 C A 5: 113,058,436 G178W probably damaging Het
Crybg3 C A 16: 59,555,393 E119* probably null Het
Crybg3 C T 16: 59,556,478 S1471N probably benign Het
Csf1 C A 3: 107,749,080 A212S possibly damaging Het
Csf2ra C T 19: 61,225,153 D373N probably benign Het
Csmd1 G T 8: 15,984,708 P2488T probably damaging Het
Csmd1 C A 8: 16,200,019 D982Y probably damaging Het
Csmd2 C T 4: 128,530,797 L2872F Het
Csmd3 C G 15: 47,675,734 G1536R Het
Csmd3 A T 15: 47,733,417 S1097R Het
Csnk1g1 A T 9: 66,012,750 T335S probably benign Het
Cspp1 GAA GA 1: 10,095,878 probably null Het
Cstf2 G C X: 134,062,488 probably null Het
Ctag2 C A X: 65,047,929 P82H probably damaging Het
Ctcfl A C 2: 173,102,036 M507R probably benign Het
Ctdsp2 G T 10: 126,996,072 R183L probably damaging Het
Ctla2a C A 13: 60,936,000 E39D probably damaging Het
Ctnna2 G C 6: 76,973,781 A569G possibly damaging Het
Ctnna2 G T 6: 76,980,740 L509I probably damaging Het
Ctnna2 G C 6: 77,641,417 N187K probably benign Het
Ctnna2 G A 6: 77,758,554 S60F probably benign Het
Ctnnd1 C A 2: 84,615,172 G507V probably damaging Het
Ctrb1 A T 8: 111,686,674 S235R probably damaging Het
Cts3 A T 13: 61,568,747 L25* probably null Het
Cts7 T A 13: 61,355,632 T173S probably benign Het
Ctse G A 1: 131,672,444 probably null Het
Ctsq C T 13: 61,037,096 G259R probably damaging Het
Cul7 AGGGG AGGG 17: 46,652,805 probably null Het
Cul7 A T 17: 46,658,738 Q977L probably damaging Het
Cul7 G T 17: 46,659,569 R1071L probably damaging Het
Cul9 C A 17: 46,537,797 R671L probably benign Het
Cux2 C T 5: 121,873,680 R564H probably damaging Het
Cux2 G T 5: 121,877,129 P234T probably benign Het
Cwf19l2 G T 9: 3,428,782 G256V probably damaging Het
Cwh43 C G 5: 73,430,470 N477K probably damaging Het
Cxxc4 G T 3: 134,240,050 A131S unknown Het
Cyfip1 G T 7: 55,898,320 G586V possibly damaging Het
Cyfip2 G A 11: 46,222,615 S968F not run Het
Cylc1 C G X: 111,122,279 P110A probably benign Het
Cyp17a1 G A 19: 46,672,659 P62L possibly damaging Het
Cyp1a1 G A 9: 57,700,514 A142T probably damaging Het
Cyp20a1 G T 1: 60,353,010 R75M probably damaging Het
Cyp26b1 C G 6: 84,577,119 W172S probably damaging Het
Cyp27a1 C T 1: 74,737,335 R477W probably damaging Het
Cyp2ab1 C A 16: 20,313,881 W222C possibly damaging Het
Cyp2b9 A T 7: 26,201,163 N409Y probably benign Het
Cyp2c54 G A 19: 40,073,757 L19F probably benign Het
Cyp2c66 T A 19: 39,186,626 I490N probably damaging Het
Cyp2c67 C T 19: 39,643,679 A82T possibly damaging Het
Cyp2d11 G T 15: 82,392,499 P80T probably damaging Het
Cyp2f2 C A 7: 27,121,907 Q82K possibly damaging Het
Cyp2j5 C A 4: 96,659,480 probably null Het
Cyp2r1 T A 7: 114,553,339 R128* probably null Het
Cyp2t4 T A 7: 27,158,240 L426Q probably damaging Het
Cyp3a57 C A 5: 145,365,633 P80T probably damaging Het
Cyp4a14 C T 4: 115,491,453 D305N possibly damaging Het
Cyp4a32 G T 4: 115,611,345 E341D probably benign Het
Cyp4f18 G T 8: 71,998,283 R180S probably benign Het
Cyp4f40 G T 17: 32,671,159 D268Y probably benign Het
Cyp4f40 G C 17: 32,676,449 R515P probably damaging Het
Cyp4x1 G T 4: 115,110,103 D425E probably damaging Het
Cyp4x1 C T 4: 115,127,525 A79T probably damaging Het
Cyp8b1 A T 9: 121,915,531 L245Q probably benign Het
Cyp8b1 G A 9: 121,916,146 P40L probably damaging Het
Cypt14 G A X: 39,863,558 P9L probably damaging Het
Cypt15 C A X: 39,346,330 A15E probably damaging Het
Cyr61 C A 3: 145,648,655 S167I probably benign Het
Cyth4 G T 15: 78,619,919 R363L probably damaging Het
D130043K22Rik C A 13: 24,856,709 P38H probably damaging Het
D130043K22Rik G C 13: 24,856,834 V80L probably benign Het
D130043K22Rik C A 13: 24,872,248 T521N possibly damaging Het
D130043K22Rik G T 13: 24,880,847 G749C probably damaging Het
D430041D05Rik C T 2: 104,241,191 A571T possibly damaging Het
D8Ertd738e C A 8: 84,249,646 A20S probably benign Het
D930020B18Rik C A 10: 121,689,912 A573D probably damaging Het
Daam2 C G 17: 49,464,620 A833P probably damaging Het
Daam2 G A 17: 49,489,016 R268W probably damaging Het
Dab1 G T 4: 104,727,740 G359V probably benign Het
Dact1 G C 12: 71,310,051 R23P possibly damaging Het
Daglb G C 5: 143,473,118 S140T probably null Het
Dand5 C T 8: 84,816,337 R170K probably benign Het
Dand5 C A 8: 84,816,523 R108M probably damaging Het
Dapk3 GC GCC 10: 81,191,769 probably null Het
Daw1 G T 1: 83,210,214 R318S unknown Het
Dbt G C 3: 116,546,091 R376P probably damaging Het
Dcaf12l1 G T X: 44,788,824 H366N probably damaging Het
Dcaf7 G T 11: 106,053,795 C268F probably benign Het
Dchs1 T A 7: 105,757,693 S2202C probably damaging Het
Dchs1 G C 7: 105,758,551 Q2025E probably benign Het
Dchs2 T A 3: 83,271,140 S1167T possibly damaging Het
Dclk1 G T 3: 55,256,013 E175D probably benign Het
Dcstamp G T 15: 39,759,596 G438W probably benign Het
Ddb1 G C 19: 10,608,396 R158P probably damaging Het
Ddc G T 11: 11,880,552 P31T probably damaging Het
Ddhd1 C A 14: 45,657,594 A140S possibly damaging Het
Ddhd2 C A 8: 25,754,374 A75S probably benign Het
Ddhd2 G T 8: 25,754,385 T71N unknown Het
Ddr2 C A 1: 169,990,622 D439Y possibly damaging Het
Ddx1 C A 12: 13,229,259 G460W probably damaging Het
Ddx10 C A 9: 53,204,511 A508S probably damaging Het
Ddx17 T A 15: 79,530,172 Q600L probably benign Het
Ddx21 C A 10: 62,587,538 probably null Het
Ddx27 G C 2: 167,033,841 E697D probably benign Het
Ddx56 C G 11: 6,267,445 M65I probably benign Het
Ddx60 G C 8: 62,000,588 R1247P possibly damaging Het
Defa17 G T 8: 21,656,594 G79W probably damaging Het
Defb11 A T 8: 21,906,346 C12S probably null Het
Defb37 G T 8: 18,986,383 N40K unknown Het
Degs2 G T 12: 108,692,597 P41H probably benign Het
Dek C A 13: 47,105,626 E35* probably null Het
Dennd1a C A 2: 37,800,257 G944W probably damaging Het
Dennd1c G T 17: 57,074,330 Q131K probably benign Het
Dennd2a C A 6: 39,523,474 Q52H probably benign Het
Dennd5a C G 7: 109,934,024 G180R probably benign Het
Deptor G T 15: 55,133,459 probably benign Het
Deup1 C A 9: 15,600,903 Q181H probably null Het
Deup1 G A 9: 15,607,832 S126F probably benign Het
Dgcr14 C G 16: 17,909,922 G131A probably benign Het
Dgka C G 10: 128,720,468 M716I probably benign Het
Dgka C T 10: 128,731,165 R275Q possibly damaging Het
Dgkd G A 1: 87,916,886 S258N probably damaging Het
Dgkg G T 16: 22,558,084 H508Q probably benign Het
Dgki G T 6: 36,975,225 L740M probably damaging Het
Dgkz C T 2: 91,942,334 V370I probably damaging Het
Dhtkd1 C G 2: 5,942,628 R15P unknown Het
Dhx29 G A 13: 112,955,517 R896Q probably null Het
Dhx37 C T 5: 125,424,980 R484Q possibly damaging Het
Dhx37 C A 5: 125,425,472 S449I probably benign Het
Dhx38 C T 8: 109,556,085 V650I probably benign Het
Dhx8 C A 11: 101,757,660 T928K probably damaging Het
Dhx9 C T 1: 153,456,575 G1216R unknown Het
Diaph3 C A 14: 87,002,814 G278V probably damaging Het
Diexf C A 1: 193,114,675 V583L probably damaging Het
Dio2 C A 12: 90,729,912 E101* probably null Het
Dip2a C A 10: 76,266,322 S1446I possibly damaging Het
Dip2a C A 10: 76,296,400 V545L probably damaging Het
Diras1 C A 10: 81,022,282 R45L possibly damaging Het
Disp2 G T 2: 118,789,702 R305L probably damaging Het
Disp2 C A 2: 118,790,827 P680H probably damaging Het
Disp3 G T 4: 148,249,746 P1030Q probably damaging Het
Disp3 G C 4: 148,249,847 S996R probably benign Het
Disp3 G C 4: 148,250,714 P958A probably damaging Het
Disp3 C A 4: 148,270,567 E331* probably null Het
Dlec1 C A 9: 119,134,473 L952I probably benign Het
Dlec1 T A 9: 119,147,409 S1677R probably damaging Het
Dlgap1 G T 17: 70,662,743 V515L probably benign Het
Dlgap2 G T 8: 14,727,659 W301C probably damaging Het
Dlgap3 C G 4: 127,194,984 D124E probably damaging Het
Dlgap3 G T 4: 127,235,498 K895N probably damaging Het
Dlgap5 T A 14: 47,388,063 R794* probably null Het
Dll3 G T 7: 28,301,383 S82R probably damaging Het
Dlst C T 12: 85,110,893 probably benign Het
Dlx1 G T 2: 71,530,015 E8* probably null Het
Dlx3 C G 11: 95,120,392 A24G probably benign Het
Dmbt1 A T 7: 131,082,485 probably null Het
Dmd C A X: 83,627,271 T220N probably damaging Het
Dmgdh G T 13: 93,677,183 A79S probably damaging Het
Dmgdh G T 13: 93,709,288 W483C probably damaging Het
Dmp1 C A 5: 104,211,652 H65N probably benign Het
Dmrta1 G T 4: 89,688,408 V34L probably damaging Het
Dmrta1 G A 4: 89,688,454 G49D probably benign Het
Dmrta1 G A 4: 89,688,498 A64T probably benign Het
Dmxl2 GC G 9: 54,382,034 probably null Het
Dna2 G C 10: 62,962,424 M635I probably benign Het
Dnaaf5 G C 5: 139,177,975 W662C probably damaging Het
Dnaaf5 G A 5: 139,185,542 D820N probably benign Het
Dnaaf5 G T 5: 139,185,585 R834L probably damaging Het
Dnah10 G C 5: 124,741,955 R435P probably damaging Het
Dnah10 C T 5: 124,747,619 A613V possibly damaging Het
Dnah10 G T 5: 124,817,988 probably null Het
Dnah12 G T 14: 26,875,215 W3510C probably damaging Het
Dnah14 G A 1: 181,690,320 G2073E probably benign Het
Dnah14 T C 1: 181,763,334 L3264P probably damaging Het
Dnah14 G T 1: 181,766,304 R3404L probably damaging Het
Dnah17 G T 11: 118,078,563 P2257T possibly damaging Het
Dnah17 C A 11: 118,086,960 G1849C probably damaging Het
Dnah17 C A 11: 118,127,142 E176* probably null Het
Dnah2 G T 11: 69,463,453 R2290S possibly damaging Het
Dnah2 C T 11: 69,544,557 probably null Het
Dnah3 G C 7: 119,967,901 S2367R probably damaging Het
Dnah3 C A 7: 120,007,862 R1840L probably benign Het
Dnah5 T G 15: 28,270,354 L934R probably benign Het
Dnah5 G T 15: 28,270,403 E950D probably benign Het
Dnah5 C T 15: 28,295,311 P1397S probably damaging Het
Dnah5 T A 15: 28,387,763 S3123T possibly damaging Het
Dnah6 C A 6: 73,021,237 L4067F probably benign Het
Dnah6 G T 6: 73,032,526 Q3813K probably damaging Het
Dnah6 G T 6: 73,041,138 P3566H probably damaging Het
Dnah6 C A 6: 73,155,272 R1149L possibly damaging Het
Dnah7a C G 1: 53,411,656 V3872L probably benign Het
Dnah7a C A 1: 53,559,102 A1425S probably benign Het
Dnah7a A C 1: 53,643,457 W285G possibly damaging Het
Dnah7c C A 1: 46,654,103 L1961I possibly damaging Het
Dnah8 C A 17: 30,694,033 T1067N probably benign Het
Dnah8 A T 17: 30,713,095 Q1479L probably null Het
Dnah9 C A 11: 66,126,650 D379Y probably damaging Het
Dnaic1 C T 4: 41,569,809 probably benign Het
Dnaja2 C A 8: 85,540,071 W342C probably benign Het
Dnajb11 G A 16: 22,865,496 G90S probably damaging Het
Dnajb11 G A 16: 22,866,961 R122H probably benign Het
Dnajc10 G C 2: 80,319,233 R93P probably damaging Het
Dnajc12 A T 10: 63,397,260 Q60L probably damaging Het
Dnajc6 G T 4: 101,639,428 V931L possibly damaging Het
Dner C T 1: 84,405,989 C558Y probably damaging Het
Dner C G 1: 84,445,430 S484T probably damaging Het
Dner C A 1: 84,445,433 R483L probably damaging Het
Dnhd1 C A 7: 105,682,841 R102S possibly damaging Het
Dntt A T 19: 41,055,815 D473V probably damaging Het
Doc2g C A 19: 4,004,105 P112T probably damaging Het
Dock1 G T 7: 134,782,400 E667* probably null Het
Dock10 C G 1: 80,559,200 M989I probably benign Het
Dock2 T G 11: 34,312,553 H934P possibly damaging Het
Dock4 G C 12: 40,817,641 Q1405H possibly damaging Het
Dock5 C A 14: 67,813,933 A696S possibly damaging Het
Dock8 G T 19: 25,132,123 A890S probably benign Het
Dock8 C T 19: 25,155,972 T1161I probably benign Het
Donson G A 16: 91,688,472 R81W probably benign Het
Dopey2 G T 16: 93,763,895 V874L probably damaging Het
Dpp6 C A 5: 27,712,642 F610L probably damaging Het
Dpp8 CTGTGTGT CTGTGT 9: 65,063,866 probably null Het
Dpp8 G T 9: 65,066,485 G664C probably damaging Het
Dpy19l2 C A 9: 24,646,359 M373I probably benign Het
Dpys A T 15: 39,842,099 M206K probably benign Het
Dpysl2 C A 14: 66,862,490 G99V probably damaging Het
Drc1 A T 5: 30,345,507 N125Y possibly damaging Het
Drc1 C A 5: 30,348,697 S238Y probably benign Het
Drd1 G T 13: 54,052,857 T446N possibly damaging Het
Drd5 C T 5: 38,320,386 R241C possibly damaging Het
Drosha G T 15: 12,842,092 G327V probably benign Het
Drp2 A G X: 134,437,042 E359G probably damaging Het
Dsc3 C T 18: 19,966,315 V715I probably benign Het
Dscam C G 16: 96,608,189 E1845Q probably damaging Het
Dscaml1 C A 9: 45,672,791 T518N probably damaging Het
Dsel C A 1: 111,861,716 R363L probably damaging Het
Dsg1c C A 18: 20,264,949 P69T probably damaging Het
Dsg2 G T 18: 20,602,249 E1095* probably null Het
Dsp G C 13: 38,151,689 G34A probably benign Het
Dsp CAAA CAAAA 13: 38,192,854 probably null Het
Dst G T 1: 34,181,232 G2039V probably benign Het
Dst A C 1: 34,194,518 K3436Q probably damaging Het
Dtx1 C A 5: 120,681,351 G594V probably damaging Het
Duox2 G T 2: 122,293,452 P417Q probably damaging Het
Dusp1 CT C 17: 26,507,195 probably null Het
Dusp10 G C 1: 184,068,992 E319Q probably damaging Het
Dusp4 G T 8: 34,808,090 S121I probably benign Het
Dvl1 G T 4: 155,847,637 probably benign Het
Dvl3 G T 16: 20,517,088 probably benign Het
Dynap C A 18: 70,241,030 V142L unknown Het
Dync1h1 G A 12: 110,637,554 D2304N probably damaging Het
Dync1h1 G GT 12: 110,641,177 probably null Het
Dync1h1 G T 12: 110,658,517 E3793* probably null Het
Dync1i1 G A 6: 5,767,057 V46I probably benign Het
Dync2h1 C A 9: 7,102,427 G2658C probably damaging Het
Dyrk1a G T 16: 94,691,580 probably null Het
Dysf G A 6: 84,064,523 M171I probably benign Het
Dysf G T 6: 84,087,817 V478L probably benign Het
Dytn G A 1: 63,633,454 R597* probably null Het
Dyx1c1 G T 9: 72,961,964 R152L possibly damaging Het
Dzip1 T A 14: 118,911,376 K297I probably damaging Het
Dzip1l G T 9: 99,665,854 Q720H probably null Het
E130308A19Rik T A 4: 59,720,223 I585K probably benign Het
E2f8 A T 7: 48,875,546 I226K probably benign Het
Eaf2 A T 16: 36,824,662 I66K probably damaging Het
Ear6 C G 14: 51,854,255 C86W probably damaging Het
Ear6 A AT 14: 51,854,403 probably null Het
Ecd C T 14: 20,337,019 G216S possibly damaging Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Ect2l C A 10: 18,172,672 R267L probably null Het
Eddm3b G A 14: 51,116,722 V56I probably damaging Het
Eddm3b C A 14: 51,116,989 L145I probably benign Het
Edil3 G T 13: 88,822,012 V11F probably benign Het
Edn1 C A 13: 42,303,631 P47T possibly damaging Het
Eed C A 7: 89,980,514 R4S probably benign Het
Eed C A 7: 89,980,515 R4M probably benign Het
Eef1d C A 15: 75,902,878 A311S possibly damaging Het
Eef2k G A 7: 120,858,453 G12S probably damaging Het
Efcab14 G T 4: 115,738,702 G15V probably damaging Het
Efcab8 G T 2: 153,798,680 D354Y probably null Het
Efemp1 A T 11: 28,867,909 E129D probably benign Het
Efhb C A 17: 53,437,126 R479L possibly damaging Het
Efhb G C 17: 53,437,183 A460G probably benign Het
Efhd2 C A 4: 141,874,683 R62L probably damaging Het
Efnb1 G T X: 99,147,504 A339S probably damaging Het
Efnb2 C A 8: 8,623,147 probably null Het
Egfem1 C A 3: 29,148,453 P66T probably benign Het
Egfr A T 11: 16,862,954 I145F probably benign Het
Egfr G T 11: 16,869,319 G283V probably damaging Het
Egln2 C T 7: 27,164,990 S170N probably benign Het
Egr1 G C 18: 34,863,230 R355P probably damaging Het
Ehbp1l1 C A 19: 5,718,762 G838W probably damaging Het
Ehbp1l1 C A 19: 5,719,101 A725S probably benign Het
Ehbp1l1 C T 19: 5,719,102 M724I probably benign Het
Ehbp1l1 C G 19: 5,719,434 A614P probably benign Het
Ehd2 T A 7: 15,957,905 probably null Het
Ehd3 G T 17: 73,830,105 G423V probably benign Het
Ehhadh C A 16: 21,762,288 W651C probably damaging Het
Eif2a G T 3: 58,531,120 G21V probably damaging Het
Eif2b2 G C 12: 85,219,564 M1I probably null Het
Eif2b2 G C 12: 85,223,415 G243A probably damaging Het
Eif3b G T 5: 140,430,128 G401C probably damaging Het
Eif3h C A 15: 51,865,438 G7V probably damaging Het
Eif3m C T 2: 105,001,274 D314N probably damaging Het
Eif4g1 G A 16: 20,683,905 D988N probably benign Het
Eif4g1 GT GTT 16: 20,686,366 probably null Het
Elfn1 G T 5: 139,972,308 V356L probably benign Het
Elmod2 T A 8: 83,317,777 S186C possibly damaging Het
Elmod2 C A 8: 83,321,501 D111Y probably damaging Het
Elmod3 T A 6: 72,566,689 H373L probably benign Het
Elmsan1 G C 12: 84,152,991 A985G probably benign Het
Elmsan1 C A 12: 84,162,358 E657* probably null Het
Eln C T 5: 134,718,026 G420E unknown Het
Elovl2 C A 13: 41,189,978 W158L probably damaging Het
Elovl6 G T 3: 129,605,112 R54L probably damaging Het
Emilin3 T A 2: 160,907,801 Q676L probably damaging Het
Eml1 G T 12: 108,423,139 probably benign Het
Eml1 G T 12: 108,534,656 G637W probably damaging Het
Eml3 A T 19: 8,937,561 probably null Het
En1 G T 1: 120,603,453 A141S probably benign Het
En1 G T 1: 120,603,663 A211S unknown Het
En1 G T 1: 120,607,005 R341L unknown Het
Engase G T 11: 118,485,757 R473S possibly damaging Het
Enox1 C T 14: 77,668,747 T522I probably benign Het
Enpep C A 3: 129,276,680 W859C probably damaging Het
Enpp1 C A 10: 24,661,942 V382F probably damaging Het
Entpd7 G T 19: 43,725,497 G432C probably damaging Het
Ep300 ACCC ACCCC 15: 81,630,097 probably null Het
Ep400 C A 5: 110,683,364 K2181N unknown Het
Ep400 C A 5: 110,733,743 R793S unknown Het
Epb41 G T 4: 132,006,083 T172N probably benign Het
Epb41l1 G T 2: 156,508,827 E347D probably benign Het
Epb41l2 G T 10: 25,479,741 C481F probably damaging Het
Epb41l4b A T 4: 57,063,191 F500I probably benign Het
Epb41l5 C A 1: 119,609,211 V317L probably damaging Het
Epb42 T A 2: 121,027,725 I251F probably damaging Het
Epha10 G T 4: 124,881,960 R29L probably damaging Het
Epha2 A G 4: 141,318,998 T503A probably benign Het
Ephb4 G T 5: 137,361,359 R397L probably benign Het
Ephx1 C A 1: 180,999,769 Q106H possibly damaging Het
Ephx2 G T 14: 66,085,325 P500T probably damaging Het
Epn2 C G 11: 61,546,424 K107N probably damaging Het
Epo C G 5: 137,485,732 probably null Het
Eps15l1 T A 8: 72,373,078 probably null Het
Eps15l1 G T 8: 72,381,437 Q414K probably benign Het
Eps8 C A 6: 137,499,581 probably null Het
Eps8l2 G C 7: 141,342,095 A29P probably benign Het
Eps8l3 G T 3: 107,881,666 probably null Het
Epx C G 11: 87,869,261 R509P probably damaging Het
Epx C A 11: 87,869,894 R404M possibly damaging Het
Epx C T 11: 87,872,767 R209H probably benign Het
Eqtn C A 4: 94,907,551 E304D probably benign Het
Erbb4 CTGT CT 1: 68,259,183 probably null Het
Erbb4 C A 1: 68,290,476 G627C probably damaging Het
Erbb4 C A 1: 68,309,643 R525L probably benign Het
Ercc3 G T 18: 32,254,161 D476Y probably damaging Het
Ergic1 G A 17: 26,654,887 V94I Het
Ermap G T 4: 119,185,561 T255K probably benign Het
Erp27 C A 6: 136,911,646 probably null Het
Esco2 C G 14: 65,824,936 probably null Het
Espnl T A 1: 91,323,555 L124H probably damaging Het
Esrrg G C 1: 188,043,555 G93A probably benign Het
Etfbkmt G C 6: 149,144,337 R63P probably damaging Het
Evi5 C A 5: 107,748,379 G733* probably null Het
Evx1 C A 6: 52,316,687 P280H probably benign Het
Exoc3l2 G T 7: 19,480,028 V460L unknown Het
Exoc8 C A 8: 124,897,186 E147D possibly damaging Het
Exog G T 9: 119,445,080 G44W unknown Het
Exog G T 9: 119,448,498 M165I probably damaging Het
Exosc10 G T 4: 148,565,386 W424C probably damaging Het
Exph5 A T 9: 53,374,213 S865C probably benign Het
Exph5 G T 9: 53,377,419 E1933D probably benign Het
Ext2 ACC AC 2: 93,703,275 probably benign Het
Eya1 C A 1: 14,184,429 G422V probably damaging Het
Eya1 G T 1: 14,253,090 T185N possibly damaging Het
Eya2 C A 2: 165,685,593 A61E probably damaging Het
F10 G A 8: 13,037,845 S15N probably benign Het
Fabp1 G T 6: 71,201,736 G66W probably damaging Het
Fam114a2 T G 11: 57,513,258 E126D probably benign Het
Fam117a G T 11: 95,375,025 R169L probably damaging Het
Fam122a T G 19: 24,476,803 Q185P probably damaging Het
Fam124b C G 1: 80,200,088 R398P probably benign Het
Fam131b C T 6: 42,318,920 V181I possibly damaging Het
Fam135b C T 15: 71,622,076 M1I probably null Het
Fam160b2 G T 14: 70,586,204 S575R not run Het
Fam168b C A 1: 34,819,882 E64* probably null Het
Fam171a1 G T 2: 3,224,934 R368L possibly damaging Het
Fam174b G A 7: 73,740,581 A27T unknown Het
Fam184a C A 10: 53,699,086 M142I probably damaging Het
Fam196b C A 11: 34,402,725 P256T probably benign Het
Fam196b G A 11: 34,403,188 C410Y probably damaging Het
Fam208a C T 14: 27,448,250 P379S probably damaging Het
Fam208b C A 13: 3,574,234 R1905S probably damaging Het
Fam221b G T 4: 43,666,039 P191T probably benign Het
Fam234b A T 6: 135,198,008 probably benign Het
Fam26e C A 10: 34,096,329 V37L probably damaging Het
Fam35a C A 14: 34,241,471 A713S probably benign Het
Fam35a T G 14: 34,268,598 Q117P probably damaging Het
Fam3b C T 16: 97,512,487 R8Q probably benign Het
Fam53a C A 5: 33,607,817 A182S probably benign Het
Fam53c G T 18: 34,770,850 E392* probably null Het
Fam71e2 G T 7: 4,757,728 L662I Het
Fam83d A T 2: 158,785,188 S266C probably damaging Het
Fam83h G A 15: 76,002,962 P842L probably benign Het
Fam83h G T 15: 76,006,541 R3S probably damaging Het
Fam90a1b C A X: 94,357,042 A61S possibly damaging Het
Fam91a1 C A 15: 58,432,548 S371Y possibly damaging Het
Fanca C T 8: 123,312,629 R181H probably benign Het
Fancb G T X: 164,982,555 C11F probably damaging Het
Fancd2 A T 6: 113,545,025 M194L probably benign Het
Fap G T 2: 62,502,446 A726E probably damaging Het
Fars2 C A 13: 36,204,731 Q68K probably benign Het
Fasn C A 11: 120,815,471 probably null Het
Fastkd2 G T 1: 63,734,836 probably null Het
Fastkd2 T C 1: 63,734,837 probably null Het
Fat2 G T 11: 55,278,966 S2989* probably null Het
Fat3 C A 9: 15,923,026 C4090F possibly damaging Het
Fat3 C A 9: 15,947,538 C3794F probably damaging Het
Fat3 G T 9: 15,965,991 T3442K possibly damaging Het
Fat3 C A 9: 15,969,835 G3247V probably damaging Het
Fat4 G T 3: 38,888,584 R542L probably damaging Het
Fat4 G T 3: 38,890,347 G1130W probably damaging Het
Fat4 C A 3: 38,981,838 T3213N probably damaging Het
Fbl G A 7: 28,174,832 G81R unknown Het
Fbn1 C A 2: 125,389,231 G472C probably damaging Het
Fbn2 G T 18: 58,010,379 T2868N probably benign Het
Fbn2 G C 18: 58,055,482 T1620S probably benign Het
Fbn2 C A 18: 58,069,190 G1297V probably damaging Het
Fbxl2 C G 9: 113,989,345 G183R probably benign Het
Fbxo15 C A 18: 84,958,308 Y57* probably null Het
Fbxo16 C A 14: 65,299,358 T227N probably damaging Het
Fbxo2 G T 4: 148,165,062 A190S possibly damaging Het
Fbxo21 G T 5: 117,989,171 D263Y probably damaging Het
Fbxo24 G C 5: 137,621,299 R222G probably damaging Het
Fbxo38 C T 18: 62,515,464 E668K probably damaging Het
Fbxo40 C A 16: 36,970,262 G162V possibly damaging Het
Fbxw11 G T 11: 32,738,480 R447L probably null Het
Fbxw14 G T 9: 109,276,246 P284T probably benign Het
Fbxw20 AC A 9: 109,225,887 probably null Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fbxw27 C A 9: 109,772,178 W291C probably damaging Het
Fcrl1 A T 3: 87,389,363 Q284L probably damaging Het
Fer1l4 C G 2: 156,048,429 Q228H probably null Het
Fer1l5 G T 1: 36,409,194 W1046L probably benign Het
Fermt3 C A 19: 7,014,679 R111L probably benign Het
Fes T A 7: 80,378,030 R791W probably damaging Het
Fez1 G T 9: 36,867,759 R244L probably benign Het
Fezf2 G C 14: 12,344,765 L141V probably benign Het
Fgb G T 3: 83,045,056 Q169K probably benign Het
Fgd2 C A 17: 29,378,326 A540E probably benign Het
Fgfr1 G T 8: 25,563,398 A230S probably benign Het
Fgfr1 G T 8: 25,570,768 Q485H possibly damaging Het
Fgfr2 C T 7: 130,198,457 G368E probably damaging Het
Fgfr4 G T 13: 55,161,707 D492Y probably damaging Het
Fgfr4 A C 13: 55,165,929 E517A probably damaging Het
Fhit G C 14: 9,870,128 H51D probably benign Het
Fhod3 C A 18: 25,020,706 P415H probably damaging Het
Fign C G 2: 63,979,385 G514R probably damaging Het
Fign C T 2: 63,979,690 G412E probably damaging Het
Fitm1 G A 14: 55,576,649 A201T probably benign Het
Fjx1 C A 2: 102,450,997 A198S probably benign Het
Fkbp4 T A 6: 128,433,111 N343Y probably damaging Het
Flg2 G T 3: 93,202,420 G585V unknown Het
Flg2 G T 3: 93,202,738 G691V unknown Het
Flnc G C 6: 29,447,545 G1116R probably damaging Het
Flnc G T 6: 29,457,130 G2344C probably damaging Het
Flt3 G T 5: 147,383,401 P51Q probably benign Het
Fmo4 G T 1: 162,803,720 P226H probably benign Het
Fn3k C G 11: 121,440,274 Q197E unknown Het
Fnbp1 C A 2: 31,083,059 R143L probably damaging Het
Folh1 A T 7: 86,744,447 F385L probably damaging Het
Folh1 A T 7: 86,761,822 F237L probably benign Het
Fosl2 G C 5: 32,152,933 R242P probably damaging Het
Foxa1 G T 12: 57,542,417 T339K probably benign Het
Foxc1 G T 13: 31,807,308 G34V probably benign Het
Foxd2 C A 4: 114,907,887 G312V unknown Het
Foxf1 G T 8: 121,084,435 G13W probably damaging Het
Foxh1 G C 15: 76,669,021 N164K probably benign Het
Foxi1 G T 11: 34,207,710 P105H probably damaging Het
Foxi2 G A 7: 135,410,415 A11T probably benign Het
Foxi2 C A 7: 135,411,958 P306T probably benign Het
Foxj1 A T 11: 116,332,267 W237R probably benign Het
Foxn3 T A 12: 99,388,597 M103L probably benign Het
Foxp1 C A 6: 98,978,161 V312F unknown Het
Fras1 G T 5: 96,691,457 G1612C probably damaging Het
Fras1 G T 5: 96,700,251 E1773D possibly damaging Het
Fras1 C A 5: 96,740,811 R2739S probably benign Het
Fras1 C A 5: 96,740,983 A2796D possibly damaging Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frat2 C G 19: 41,847,287 A209P probably damaging Het
Frem1 C T 4: 82,940,315 probably null Het
Frem1 C A 4: 83,000,269 V479L probably benign Het
Frem1 C T 4: 83,016,464 D87N probably damaging Het
Frem2 T A 3: 53,535,166 Q2650L probably null Het
Frem2 C A 3: 53,655,607 S493I probably benign Het
Frem3 G T 8: 80,616,129 G1684C possibly damaging Het
Frk T C 10: 34,584,005 Y199H probably benign Het
Frmpd1 C A 4: 45,275,272 S475Y probably damaging Het
Frmpd2 G T 14: 33,530,451 A657S possibly damaging Het
Frmpd2 G T 14: 33,530,504 Q674H probably damaging Het
Frmpd2 A T 14: 33,530,505 K675* probably null Het
Frmpd2 A C 14: 33,543,026 M921L probably benign Het
Frmpd3 C A X: 140,362,232 D27E possibly damaging Het
Frrs1 G A 3: 116,881,818 A132T probably damaging Het
Frs2 C A 10: 117,074,379 W359C probably damaging Het
Fry C G 5: 150,310,437 R30G possibly damaging Het
Fryl T C 5: 73,041,595 probably null Het
Fscb G A 12: 64,472,628 A688V unknown Het
Fsd1 A C 17: 55,996,083 I351L probably benign Het
Fsd2 C T 7: 81,559,752 R114Q probably damaging Het
Fsip2 G C 2: 82,946,960 K110N probably damaging Het
Fsip2 G T 2: 82,984,524 D3534Y probably damaging Het
Fsip2 C A 2: 82,987,203 L4427I possibly damaging Het
Fstl3 G T 10: 79,780,108 E143* probably null Het
Fut1 C A 7: 45,619,229 S202R probably benign Het
Fyco1 C A 9: 123,828,323 E929D probably benign Het
Fyttd1 G T 16: 32,877,784 probably benign Het
Fzd4 CTT CT 7: 89,407,250 probably null Het
Fzd6 G T 15: 39,007,561 G59W possibly damaging Het
Fzd6 G A 15: 39,031,341 V301M probably damaging Het
Gabarapl1 G T 6: 129,541,221 R42L unknown Het
Gabbr1 G C 17: 37,048,424 R97P possibly damaging Het
Gabra2 C T 5: 71,007,992 G212S probably benign Het
Gad1 C A 2: 70,579,130 N188K probably damaging Het
Gad2 T G 2: 22,635,014 V270G probably benign Het
Gak AG A 5: 108,585,352 probably null Het
Galns C T 8: 122,598,523 E297K probably benign Het
Galns C A 8: 122,605,206 D57Y probably damaging Het
Galnt10 G C 11: 57,737,000 E142Q probably benign Het
Galnt15 G T 14: 32,052,365 W486L probably damaging Het
Galnt16 G A 12: 80,572,347 A76T probably benign Het
Galnt16 G T 12: 80,601,810 W552L probably damaging Het
Galnt18 G T 7: 111,485,151 P536T probably damaging Het
Galnt2 G A 8: 124,343,318 E525K probably benign Het
Galr1 C A 18: 82,405,772 A127S probably benign Het
Ganc G T 2: 120,433,794 W409C probably damaging Het
Gapvd1 T A 2: 34,699,864 K980I possibly damaging Het
Gata4 G T 14: 63,200,382 T441N probably damaging Het
Gata4 A C 14: 63,241,265 probably benign Het
Gatb G T 3: 85,636,973 R416M probably damaging Het
Gbf1 G T 19: 46,259,142 K226N probably damaging Het
Gbgt1 C A 2: 28,505,188 C279* probably null Het
Gbp2b C A 3: 142,604,316 P289Q possibly damaging Het
Gbp4 T A 5: 105,119,449 R535* probably null Het
Gbp4 C A 5: 105,125,135 G215C probably null Het
Gchfr A T 2: 119,169,745 K36* probably null Het
Gck G T 11: 5,910,958 Q38K possibly damaging Het
Gclc G T 9: 77,786,739 S325I probably benign Het
Gcn1l1 A T 5: 115,614,149 H2108L probably damaging Het
Gcnt4 G A 13: 96,946,453 G86S probably damaging Het
Gcnt7 G T 2: 172,454,886 T6N possibly damaging Het
Gdf2 G T 14: 33,945,317 R332M probably damaging Het
Gdf5 C T 2: 155,942,072 G320D possibly damaging Het
Gdpd2 T A X: 100,733,982 C214S probably damaging Het
Gfer TCCC TCC 17: 24,695,887 probably null Het
Gfm2 C A 13: 97,162,992 T407K possibly damaging Het
Gfm2 G T 13: 97,162,993 probably null Het
Gfra2 A T 14: 70,978,492 Q464L not run Het
Gfral G C 9: 76,205,389 L87V probably benign Het
Gfy CGGG CGG 7: 45,176,464 probably null Het
Ggcx G C 6: 72,426,519 G350R probably benign Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gimap5 G T 6: 48,752,885 V130L possibly damaging Het
Gimap7 AG A 6: 48,724,321 probably null Het
Gimd1 G T 3: 132,635,070 V116L probably benign Het
Gipr G T 7: 19,157,565 Q396K probably benign Het
Gja8 G C 3: 96,920,236 L37V probably damaging Het
Gjb4 T A 4: 127,352,127 Q7L possibly damaging Het
Gjc2 A T 11: 59,177,617 L13Q probably damaging Het
Gjc3 C A 5: 137,957,561 G154V probably damaging Het
Glb1 G C 9: 114,420,422 E106D probably damaging Het
Glb1l3 A T 9: 26,818,245 L642Q probably damaging Het
Gldc C A 19: 30,110,778 G827C probably damaging Het
Gldc C A 19: 30,110,779 M826I probably damaging Het
Gldc A T 19: 30,145,748 V249D possibly damaging Het
Gldn C G 9: 54,286,660 A46G probably benign Het
Gli1 T A 10: 127,334,257 K343M probably damaging Het
Gli1 G C 10: 127,335,998 R296G probably damaging Het
Gli1 G T 10: 127,336,691 P194Q probably benign Het
Glipr1l1 C A 10: 112,078,390 H219N probably benign Het
Glra4 C A X: 136,757,817 R417L possibly damaging Het
Glrp1 C T 1: 88,509,802 G29R not run Het
Glud1 C T 14: 34,310,869 probably benign Het
Glyr1 C A 16: 5,031,973 D179Y probably null Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10378 G T 14: 42,657,124 M76I Het
Gm10382 C A 5: 125,389,424 P35T unknown Het
Gm10696 G T 3: 94,176,102 P134Q probably benign Het
Gm11397 C A 13: 33,404,510 F359L possibly damaging Het
Gm11492 C G 11: 87,567,922 T374R probably benign Het
Gm11559 CTGTGTGT CTGTGT 11: 99,864,763 probably null Het
Gm11639 C A 11: 104,739,338 S965* probably null Het
Gm11639 C A 11: 104,820,518 T1860K probably benign Het
Gm11639 C A 11: 104,924,019 A3243D unknown Het
Gm11808 G C 4: 3,973,193 P123R probably benign Het
Gm12185 C T 11: 48,916,302 V21M probably benign Het
Gm12394 G C 4: 42,793,428 P235A probably damaging Het
Gm12394 C T 4: 42,793,520 R204H probably damaging Het
Gm12666 C A 4: 92,191,236 S116I possibly damaging Het
Gm12666 A T 4: 92,191,703 F16Y probably damaging Het
Gm12695 C A 4: 96,749,223 K352N probably damaging Het
Gm12794 A T 4: 101,941,125 K98* probably null Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gm13023 C A 4: 143,794,981 A389D probably damaging Het
Gm13083 C T 4: 143,616,160 T279I probably benign Het
Gm13084 C A 4: 143,812,018 V128F probably benign Het
Gm13101 C A 4: 143,965,591 G280V probably benign Het
Gm13101 T A 4: 143,965,775 T219S probably benign Het
Gm13102 G C 4: 144,109,302 M513I unknown Het
Gm13119 A G 4: 144,362,973 H287R possibly damaging Het
Gm13128 C A 4: 144,331,193 D123E probably benign Het
Gm13178 G C 4: 144,703,646 L258V possibly damaging Het
Gm13889 C G 2: 93,956,825 E101D unknown Het
Gm13941 T A 2: 111,094,778 D160V unknown Het
Gm14124 C G 2: 150,268,317 A309G possibly damaging Het
Gm14124 G T 2: 150,268,324 K311N possibly damaging Het
Gm14569 G T X: 36,433,871 P395Q probably benign Het
Gm15557 G T 2: 155,942,468 A226S probably benign Het
Gm15737 G T 6: 92,879,891 W100C unknown Het
Gm16486 C G 8: 70,717,103 R1281G possibly damaging Het
Gm17019 A C 5: 15,032,931 L3W probably damaging Het
Gm17067 A C 7: 42,708,298 V260G probably benign Het
Gm17455 G T 10: 60,403,015 A20S probably benign Het
Gm18596 C T 10: 77,742,621 M6I unknown Het
Gm19410 A T 8: 35,808,965 Q1592L possibly damaging Het
Gm20379 C G 13: 92,306,159 P60R unknown Het
Gm21083 T G 5: 15,577,458 V41G probably benign Het
Gm21149 G T 5: 15,472,148 A236D probably damaging Het
Gm21149 G C 5: 15,476,412 R18G not run Het
Gm21188 C T 13: 120,034,952 C127Y possibly damaging Het
Gm21190 G A 5: 15,524,894 P242L probably benign Het
Gm21190 A C 5: 15,524,974 D215E not run Het
Gm21190 G T 5: 15,525,807 Q184K probably benign Het
Gm21680 A T 5: 25,972,495 S32T probably benign Het
Gm21731 C A 13: 120,241,172 P168Q unknown Het
Gm281 G T 14: 13,823,754 T807N Het
Gm281 G T 14: 13,845,421 P497Q Het
Gm28710 C A 5: 16,835,979 H591Q possibly damaging Het
Gm28710 G T 5: 16,856,724 D823Y probably damaging Het
Gm28729 C A 9: 96,497,007 probably null Het
Gm29776 C G 14: 54,696,508 D205H probably damaging Het
Gm30302 G T 13: 49,787,175 P353H probably benign Het
Gm32742 T A 9: 51,149,306 H899L probably benign Het
Gm32742 C T 9: 51,158,276 probably null Het
Gm3327 G T 14: 44,124,800 G52V Het
Gm3404 C A 5: 146,526,216 Y69* probably null Het
Gm35339 G A 15: 76,354,930 R69H Het
Gm35339 G T 15: 76,363,130 E1530D Het
Gm38394 C A 1: 133,659,116 G161V probably damaging Het
Gm40460 A T 7: 142,240,772 C103S unknown Het
Gm40460 C T 7: 142,240,906 S58N unknown Het
Gm4131 T A 14: 62,481,022 H45L possibly damaging Het
Gm42669 C A 5: 107,578,590 Q558K unknown Het
Gm43302 T A 5: 105,276,796 Q326L probably damaging Het
Gm44511 T A 6: 128,820,338 probably null Het
Gm4559 C A 7: 142,274,034 Q110H unknown Het
Gm45837 G A 7: 101,451,465 A51T probably benign Het
Gm45861 G C 8: 27,535,369 E772Q unknown Het
Gm45861 G T 8: 27,569,951 G1147C unknown Het
Gm4756 C A 12: 72,628,738 G39V probably damaging Het
Gm4847 G C 1: 166,634,773 L383V probably damaging Het
Gm4869 G C 5: 140,446,422 Q39H probably damaging Het
Gm4869 A T 5: 140,460,860 probably null Het
Gm4869 G C 5: 140,478,985 R619P probably damaging Het
Gm4884 G T 7: 41,032,737 probably benign Het
Gm4894 C T 9: 49,278,779 A118V unknown Het
Gm49358 G T 10: 86,811,582 G88V Het
Gm49368 G T 7: 128,113,067 G825V probably damaging Het
Gm4951 C G 18: 60,246,296 T301S probably benign Het
Gm5114 G T 7: 39,409,326 Q290K probably benign Het
Gm5145 G T 17: 20,571,052 G231C probably damaging Het
Gm5148 G A 3: 37,715,005 A22V probably benign Het
Gm5157 C T 7: 21,185,316 E101K probably benign Het
Gm5294 G T 5: 138,821,495 S176I probably damaging Het
Gm5346 C A 8: 43,626,546 V214L probably damaging Het
Gm5460 C G 14: 34,045,834 C191W probably benign Het
Gm5678 C A 16: 93,629,932 S140R probably damaging Het
Gm5737 G T 7: 120,814,534 D97Y probably damaging Het
Gm5797 G A 14: 7,329,383 Q202* probably null Het
Gm5868 G T 5: 72,586,346 H10N probably benign Het
Gm5936 G A X: 74,842,553 A520T possibly damaging Het
Gm6358 T A 16: 89,141,087 C71* probably null Het
Gm6583 G C 5: 112,354,918 H307D probably damaging Het
Gm6588 C A 5: 112,450,006 L140M probably damaging Het
Gm6588 TACACA TACA 5: 112,450,961 probably null Het
Gm6592 C A X: 8,846,184 S120R probably benign Het
Gm6614 A T 6: 141,994,202 S192T probably damaging Het
Gm6970 G A 19: 47,171,131 P2S probably benign Het
Gm7102 CGGGG CGGG 19: 61,175,750 probably null Het
Gm7168 G C 17: 13,949,082 G237A probably damaging Het
Gm7168 G A 17: 13,949,670 C433Y probably damaging Het
Gm7168 A T 17: 13,949,757 K462M probably benign Het
Gm7361 C G 5: 26,261,188 H183D probably benign Het
Gm765 G C 6: 98,238,240 H141D probably benign Het
Gm8297 G T 14: 4,986,822 R150L probably benign Het
Gm8332 G C 12: 88,249,802 A100G possibly damaging Het
Gm8765 C A 13: 50,702,144 P606H probably damaging Het
Gm8909 C A 17: 36,165,712 G262V probably damaging Het
Gm8947 C A 1: 151,192,584 S56Y possibly damaging Het
Gm9195 C A 14: 72,443,002 L2207F possibly damaging Het
Gm9195 AGGGGG AGGGGGGG 14: 72,453,434 probably null Het
Gm9573 G T 17: 35,620,925 P790T unknown Het
Gm9573 G T 17: 35,621,059 P745H unknown Het
Gm973 C T 1: 59,541,330 A124V probably damaging Het
Gm9758 C T 5: 14,910,585 A212T Het
Gm9758 T A 5: 14,911,458 Q169L possibly damaging Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9958 G T 5: 90,367,998 R52M unknown Het
Gna13 G T 11: 109,396,202 V284F probably damaging Het
Gnai1 C A 5: 18,308,552 probably null Het
Gnas G T 2: 174,284,887 A72S unknown Het
Gnat2 T A 3: 108,100,044 F259L Het
Gnat3 C A 5: 18,015,313 C224* probably null Het
Gnaz G T 10: 75,014,960 K272N Het
Gnpat G A 8: 124,863,296 S20N probably benign Het
Gnptab G T 10: 88,440,270 A1140S probably damaging Het
Golga5 A T 12: 102,472,005 probably benign Het
Gon4l C T 3: 88,859,036 P461S probably damaging Het
Gopc C T 10: 52,350,663 G277S probably damaging Het
Gp1ba C G 11: 70,639,407 probably benign Het
Gpatch2 G T 1: 187,225,691 W81L probably damaging Het
Gpc1 G T 1: 92,857,486 K382N probably damaging Het
Gpha2 C G 19: 6,227,023 H51Q probably damaging Het
Gpi1 C A 7: 34,205,645 probably null Het
Gpkow C T X: 7,697,292 R23C probably damaging Het
Gpr1 G T 1: 63,183,639 H146N probably benign Het
Gpr108 C A 17: 57,237,316 G365C probably damaging Het
Gpr139 C A 7: 119,144,513 R283L possibly damaging Het
Gpr141 C A 13: 19,752,444 A54S possibly damaging Het
Gpr149 CA C 3: 62,603,959 probably null Het
Gpr150 G T 13: 76,056,150 Y225* probably null Het
Gpr156 G T 16: 38,004,863 A481S probably benign Het
Gpr158 A T 2: 21,827,272 D1061V possibly damaging Het
Gpr17 C A 18: 31,947,664 M115I possibly damaging Het
Gpr174 T A X: 107,293,193 C204S possibly damaging Het
Gpr179 G T 11: 97,351,239 L260I probably damaging Het
Gpr180 G T 14: 118,148,201 G142W probably damaging Het
Gpr35 G T 1: 92,983,016 W150L probably benign Het
Gpr62 A T 9: 106,465,489 V80E possibly damaging Het
Gpr87 C A 3: 59,180,070 V6L probably benign Het
Gprc6a C A 10: 51,615,209 V815L probably damaging Het
Gprin2 G A 14: 34,195,123 P230L probably damaging Het
Greb1 C A 12: 16,702,491 G950V probably damaging Het
Grem1 C G 2: 113,749,649 R169T possibly damaging Het
Grhl2 G T 15: 37,333,287 G429W unknown Het
Grhl3 G C 4: 135,552,686 I352M possibly damaging Het
Grid2 T A 6: 64,345,856 Y613* probably null Het
Grid2 G T 6: 64,345,857 G614W probably damaging Het
Grik1 C T 16: 87,946,684 G537S Het
Grik3 C A 4: 125,650,506 A340E possibly damaging Het
Grik5 T A 7: 25,015,825 T674S probably damaging Het
Grin2a C A 16: 9,663,577 K453N possibly damaging Het
Grin2d C A 7: 45,833,177 G1192V unknown Het
Grip1 G T 10: 119,986,444 M437I probably benign Het
Grm2 C A 9: 106,645,065 V580F possibly damaging Het
Grm4 C A 17: 27,450,194 E367* probably null Het
Grm4 G T 17: 27,450,221 R358S probably benign Het
Grm6 G C 11: 50,851,262 V41L probably benign Het
Grm6 C T 11: 50,851,500 A120V probably benign Het
Grm6 A T 11: 50,859,867 Y619F probably damaging Het
Grpel2 C T 18: 61,719,772 G53E possibly damaging Het
Grrp1 G T 4: 134,251,570 T199K probably benign Het
Gsap G T 5: 21,251,032 R409I probably damaging Het
Gse1 A C 8: 120,229,852 T361P unknown Het
Gsg1l C A 7: 126,082,242 probably benign Het
Gsk3a C A 7: 25,237,528 G45C unknown Het
Gsta1 G T 9: 78,232,242 M1I probably null Het
Gstp2 C T 19: 4,041,583 probably null Het
Gstp3 C G 19: 4,058,154 V90L probably benign Het
Gtf3c1 C T 7: 125,667,122 S1014N probably benign Het
Gtf3c4 T A 2: 28,835,073 S216C probably damaging Het
Gtpbp3 A T 8: 71,489,069 probably null Het
Gtse1 G T 15: 85,875,737 A710S probably damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy1a2 C T 9: 3,797,245 T565I probably damaging Het
Gucy1b1 G T 3: 82,061,112 A29E probably damaging Het
Gucy1b2 C A 14: 62,453,453 G42C unknown Het
Gucy2c C A 6: 136,719,687 R704L probably damaging Het
Gucy2c G T 6: 136,767,196 T135K probably benign Het
Gucy2g C T 19: 55,210,377 R778H probably benign Het
Gusb C T 5: 130,002,736 M27I probably benign Het
Gykl1 G T 18: 52,695,132 V471L possibly damaging Het
Gypa C A 8: 80,500,998 H92N unknown Het
Gzmm TGG T 10: 79,695,006 probably null Het
H1fnt G T 15: 98,257,247 P7H probably damaging Het
H2afy2 T G 10: 61,739,350 S356R probably damaging Het
H2-M10.3 G T 17: 36,366,579 A269D probably damaging Het
H2-M10.3 C A 17: 36,367,544 G130W probably damaging Het
H2-Q2 C G 17: 35,342,342 R4G unknown Het
H2-Q5 G T 17: 35,394,504 R71L Het
H2-Q7 G T 17: 35,439,162 probably benign Het
H2-Q7 G T 17: 35,442,500 V282L probably damaging Het
H3f3b C G 11: 116,023,907 G35R probably benign Het
Habp2 G GT 19: 56,319,553 probably null Het
Habp4 T G 13: 64,174,068 V173G probably benign Het
Habp4 G C 13: 64,174,070 D174H probably damaging Het
Hal G T 10: 93,489,335 E69* probably null Het
Hand2 G A 8: 57,322,013 S36N probably benign Het
Hao2 C A 3: 98,881,942 Q143H probably benign Het
Hao2 G T 3: 98,882,041 S110R probably damaging Het
Hars2 A T 18: 36,789,575 E387V probably damaging Het
Hars2 G T 18: 36,790,598 V481L possibly damaging Het
Has2 C A 15: 56,681,583 V208L probably benign Het
Has3 C G 8: 106,874,018 H37Q probably benign Het
Haus4 C A 14: 54,549,960 L44F probably damaging Het
Havcr1 C T 11: 46,775,498 L263F probably benign Het
Hbb-bt G C 7: 103,813,589 I55M possibly damaging Het
Hc T A 2: 35,013,610 S1011C probably damaging Het
Hcar2 G T 5: 123,865,206 P78Q probably damaging Het
Hcrtr1 C A 4: 130,133,873 E263* probably null Het
Hdac11 G T 6: 91,167,834 R148L possibly damaging Het
Hdac3 C A 18: 37,945,751 E102D probably benign Het
Hdac4 C A 1: 91,956,047 D870Y probably damaging Het
Hdac4 A T 1: 91,987,611 N303K probably damaging Het
Hdac6 C A X: 7,937,985 E450* probably null Het
Hdgfl2 G T 17: 56,099,343 G576V unknown Het
Heatr4 C G 12: 83,980,478 A2P probably benign Het
Heatr6 G T 11: 83,766,081 A390S probably benign Het
Heatr6 G T 11: 83,781,382 R1072L probably damaging Het
Hectd3 G T 4: 116,998,760 D419Y probably damaging Het
Hectd4 T A 5: 121,358,320 M3925K probably benign Het
Hecw2 T A 1: 53,923,943 Q803L possibly damaging Het
Heg1 G T 16: 33,720,687 G405C probably damaging Het
Helb T G 10: 120,092,690 probably null Het
Helz2 C A 2: 181,235,961 G1015C probably damaging Het
Hemgn G A 4: 46,400,693 L56F possibly damaging Het
Hepacam2 G T 6: 3,483,352 T219N probably benign Het
Hephl1 A C 9: 15,090,054 D258E probably damaging Het
Herc1 G A 9: 66,458,425 S354N probably null Het
Herc1 G A 9: 66,471,911 S3493N probably damaging Het
Herc2 G T 7: 56,121,589 R1033L possibly damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herpud2 C G 9: 25,130,622 V85L not run Het
Hes5 G T 4: 154,961,442 G91C probably damaging Het
Hfe C A 13: 23,706,037 W251L probably damaging Het
Hfe2 G A 3: 96,527,197 R84Q possibly damaging Het
Hfe2 G T 3: 96,528,087 M220I probably benign Het
Hfm1 C G 5: 106,871,820 D1116H probably benign Het
Hgd T G 16: 37,589,719 L39R probably damaging Het
Hgs A T 11: 120,478,565 Q360L probably benign Het
Hhat C A 1: 192,661,492 probably null Het
Hhip GCCCC GCCCCC 8: 80,057,251 probably null Het
Hhla1 G A 15: 65,941,775 T236I probably damaging Het
Hibadh C A 6: 52,619,995 D155Y probably damaging Het
Hid1 G T 11: 115,352,725 S499Y probably damaging Het
Hip1 C A 5: 135,428,606 R722I probably benign Het
Hira G T 16: 18,912,149 K199N probably damaging Het
Hist1h1c G T 13: 23,739,219 G124V unknown Het
Hist1h2ag C A 13: 22,042,804 E42* probably null Het
Hist1h2ah C G 13: 22,035,350 G68A probably damaging Het
Hist1h3a C T 13: 23,762,022 C111Y probably damaging Het
Hist1h3a C A 13: 23,762,250 G35V possibly damaging Het
Hist1h3f G T 13: 23,544,556 K24N probably damaging Het
Hist1h3i C T 13: 21,783,103 V90I probably benign Het
Hist2h3c2 G T 3: 96,238,548 R132S probably damaging Het
Hivep1 G T 13: 42,159,981 R1899M possibly damaging Het
Hivep2 G A 10: 14,131,786 G1376E probably damaging Het
Hivep2 G T 10: 14,143,307 V1941F probably damaging Het
Hivep3 G T 4: 120,095,946 R486S possibly damaging Het
Hivep3 G T 4: 120,131,778 E1809* probably null Het
Hk3 C A 13: 55,010,708 G615C probably damaging Het
Hk3 A G 13: 55,010,710 L614P probably damaging Het
Hmces G T 6: 87,936,130 W289L possibly damaging Het
Hmcn2 G T 2: 31,344,506 G311V probably damaging Het
Hmcn2 C A 2: 31,426,824 S3805Y probably damaging Het
Hmox2 G T 16: 4,757,128 probably benign Het
Hmx2 GC G 7: 131,555,534 probably null Het
Hmx3 G T 7: 131,543,120 R53L probably benign Het
Hnrnpa2b1 C A 6: 51,464,529 S247I unknown Het
Hnrnpc C A 14: 52,077,429 R180M possibly damaging Het
Hnrnpll C A 17: 80,048,610 R316L probably benign Het
Hnrnpm C A 17: 33,646,745 G637V probably damaging Het
Hnrnpm C A 17: 33,658,401 M368I probably benign Het
Hoxa11 C A 6: 52,245,110 E204* probably null Het
Hoxa4 G A 6: 52,191,636 P18L unknown Het
Hoxb2 C A 11: 96,351,989 A60D probably damaging Het
Hoxd11 G T 2: 74,682,415 G8V probably damaging Het
Hoxd9 C A 2: 74,698,525 P157Q probably benign Het
Hp1bp3 C T 4: 138,221,673 L16F not run Het
Hpf1 A G 8: 60,895,635 H128R probably damaging Het
Hps1 C A 19: 42,755,696 V693L probably benign Het
Hps1 C A 19: 42,759,831 G552C probably damaging Het
Hps1 T G 19: 42,766,218 probably null Het
Hps3 C A 3: 20,008,901 G833C probably damaging Het
Hps4 G T 5: 112,370,377 G412V probably damaging Het
Hrc C T 7: 45,336,970 P515L probably benign Het
Hrg G T 16: 22,953,712 W90C probably damaging Het
Hsd17b1 G T 11: 101,079,745 D209Y probably damaging Het
Hsd17b4 G A 18: 50,181,980 V605M probably benign Het
Hsf5 G T 11: 87,638,133 G565* probably null Het
Hsp90aa1 G A 12: 110,693,466 P396L probably damaging Het
Hspa1l C T 17: 34,978,016 R344C probably benign Het
Hspa8 A C 9: 40,802,802 K159Q probably damaging Het
Hspa8 G A 9: 40,802,805 D160N probably damaging Het
Hspa9 C A 18: 34,943,145 Q371H possibly damaging Het
Hspd1 T G 1: 55,080,266 T351P probably damaging Het
Hspg2 G T 4: 137,550,467 G2959V probably damaging Het
Hspg2 C A 4: 137,564,518 L3975I probably damaging Het
Hspg2 G T 4: 137,568,373 Q4239H possibly damaging Het
Htatsf1 A G X: 57,065,713 E378G probably damaging Het
Htr1a T G 13: 105,444,876 L208R probably damaging Het
Htr4 C G 18: 62,437,608 Q245E probably benign Het
Htr5b C T 1: 121,527,739 D151N probably damaging Het
Htra2 C T 6: 83,053,756 D190N probably damaging Het
Htt G T 5: 34,852,231 A1519S probably null Het
Hunk G T 16: 90,481,321 K415N possibly damaging Het
Hus1b C A 13: 30,946,992 R228L probably benign Het
Hydin C A 8: 110,380,610 P473Q probably damaging Het
Hydin C A 8: 110,450,232 H973Q possibly damaging Het
Hydin CG C 8: 110,587,142 probably null Het
Hydin T A 8: 110,609,989 C5133S probably benign Het
Hykk G T 9: 54,946,429 W345L possibly damaging Het
Iars2 T A 1: 185,315,895 R547* probably null Het
Icam5 G T 9: 21,035,548 L457F possibly damaging Het
Idh3a G T 9: 54,596,149 R164L probably damaging Het
Idi1 G T 13: 8,888,019 R167L probably damaging Het
Idua G C 5: 108,679,584 G128R probably null Het
Idua AGG AG 5: 108,680,623 probably null Het
Ifi207 C A 1: 173,729,579 G531V probably damaging Het
Ifi27l2b C A 12: 103,455,860 V82F probably damaging Het
Ifi44 G T 3: 151,749,438 T50N probably damaging Het
Ifi47 G T 11: 49,096,275 E290* probably null Het
Ifna13 C A 4: 88,644,378 R3M probably benign Het
Igf2bp3 G T 6: 49,214,428 P15H possibly damaging Het
Igf2r G T 17: 12,697,399 L1691M probably damaging Het
Igfn1 C A 1: 135,955,809 G2653V probably damaging Het
Igfn1 C A 1: 135,969,567 W1087L probably benign Het
Igfn1 C T 1: 135,982,426 C140Y possibly damaging Het
Ighg2c C A 12: 113,287,680 L238F Het
Ighmbp2 C A 19: 3,265,635 R595L probably damaging Het
Ighmbp2 C A 19: 3,267,242 Q543H probably null Het
Ighmbp2 C A 19: 3,271,665 E365* probably null Het
Ighv1-23 A C 12: 114,764,685 L39R probably damaging Het
Ighv1-4 G T 12: 114,487,404 A28D possibly damaging Het
Ighv1-58 C T 12: 115,312,324 E65K possibly damaging Het
Ighv16-1 T C 12: 114,069,125 E19G possibly damaging Het
Ighv1-64 G A 12: 115,507,666 T77I probably benign Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv1-72 C T 12: 115,758,201 G45D probably damaging Het
Ighv1-9 C A 12: 114,583,699 S74I probably benign Het
Ighv2-3 G C 12: 113,611,591 C9W possibly damaging Het
Ighv7-3 C G 12: 114,153,288 V85L probably benign Het
Igkv1-117 C A 6: 68,121,594 C42* probably null Het
Igkv13-84 AGG AG 6: 68,939,860 probably null Het
Igkv3-2 G T 6: 70,699,015 E103* probably null Het
Igkv3-2 A T 6: 70,699,046 Q113L probably benign Het
Igkv3-5 C A 6: 70,663,670 A45D probably damaging Het
Igkv4-79 C T 6: 69,043,059 G91R probably damaging Het
Igkv8-19 T A 6: 70,340,921 E107V probably damaging Het
Igkv8-19 C T 6: 70,340,922 E107K possibly damaging Het
Iglv3 G A 16: 19,241,452 T42I probably damaging Het
Igsf10 C A 3: 59,329,605 E1052* probably null Het
Igsf5 C A 16: 96,378,333 Q209K probably benign Het
Igsf9 C A 1: 172,494,872 P545T probably damaging Het
Igsf9b C A 9: 27,334,292 P1185H probably damaging Het
Ikzf4 C A 10: 128,642,640 R92L possibly damaging Het
Il10 G C 1: 131,021,395 A98P probably damaging Het
Il17rd A C 14: 27,100,261 H648P probably damaging Het
Il17re G T 6: 113,464,792 R216L possibly damaging Het
Il1b C A 2: 129,369,745 E18D probably benign Het
Il1rapl1 C A X: 86,748,464 D417Y probably damaging Het
Il20 C T 1: 130,911,387 probably benign Het
Il22ra1 C A 4: 135,737,406 P141H probably damaging Het
Il25 G T 14: 54,935,207 G120C probably damaging Het
Il27ra TCCC TCC 8: 84,040,975 probably null Het
Il31 C A 5: 123,480,579 W111L probably benign Het
Il31 G T 5: 123,480,705 S69* probably null Het
Il5ra C A 6: 106,741,134 G120* probably null Het
Il7r C T 15: 9,508,057 G393D probably benign Het
Il7r G T 15: 9,510,229 T246N probably benign Het
Ildr2 G T 1: 166,309,049 G486C probably damaging Het
Ilvbl A T 10: 78,581,124 N374Y probably damaging Het
Impa1 C A 3: 10,316,074 Q249H probably benign Het
Impa2 G T 18: 67,309,052 R114S probably benign Het
Impact G T 18: 12,988,366 R246L probably damaging Het
Ina G T 19: 47,014,911 A53S Het
Inafm1 C G 7: 16,273,217 G25A unknown Het
Incenp C A 19: 9,899,364 probably benign Het
Inpp5a T G 7: 139,525,775 L214R probably damaging Het
Inpp5j G T 11: 3,502,191 P353Q probably damaging Het
Insm2 C T 12: 55,600,356 P295L probably benign Het
Insrr C G 3: 87,800,827 S192W possibly damaging Het
Ints1 C A 5: 139,771,638 V375L possibly damaging Het
Ints3 C T 3: 90,406,356 G322S probably damaging Het
Ints5 G T 19: 8,894,935 R86L probably benign Het
Ints5 G T 19: 8,894,973 G99C probably damaging Het
Ints7 G T 1: 191,610,458 S522I probably benign Het
Intu A T 3: 40,697,516 H801L possibly damaging Het
Ipo8 T G 6: 148,796,712 K604Q probably damaging Het
Iqcf1 AC A 9: 106,502,114 probably null Het
Iqcg G A 16: 33,029,020 Q299* probably null Het
Iqgap3 G T 3: 88,088,971 probably null Het
Irf4 T G 13: 30,750,661 L28V probably damaging Het
Irf4 G C 13: 30,750,663 L28F probably damaging Het
Irgc1 C A 7: 24,432,955 V146L probably benign Het
Irs1 C G 1: 82,288,996 A500P possibly damaging Het
Irs1 C A 1: 82,290,394 A34S probably benign Het
Irx2 C T 13: 72,629,089 Q10* probably null Het
Ism2 A T 12: 87,280,035 W377R probably damaging Het
Isx GCCCC GCCC 8: 74,891,859 probably null Het
Itch A T 2: 155,209,059 R555S probably damaging Het
Itga1 C T 13: 114,985,071 probably null Het
Itga2 C G 13: 114,853,701 probably null Het
Itga2b C A 11: 102,467,076 G200V probably damaging Het
Itga3 C T 11: 95,056,774 G668E probably damaging Het
Itga7 G T 10: 128,943,214 W369C probably damaging Het
Itga8 C A 2: 12,300,933 S82I possibly damaging Het
Itgad C T 7: 128,189,501 P467S probably damaging Het
Itgax G T 7: 128,148,062 W982C probably benign Het
Itgb2l G T 16: 96,437,356 P81H probably damaging Het
Itgb4 T A 11: 115,986,811 L552Q probably damaging Het
Itgb4 C G 11: 115,998,058 R1076G probably benign Het
Itih1 C G 14: 30,929,572 D892H possibly damaging Het
Itm2a C A X: 107,399,128 D137Y probably damaging Het
Itpka C A 2: 119,749,421 H214N probably benign Het
Itpka C T 2: 119,750,775 R430W probably damaging Het
Itpkc TC T 7: 27,227,781 probably null Het
Itpr3 G C 17: 27,114,929 R2020P probably damaging Het
Itpr3 G A 17: 27,119,987 D2581N probably damaging Het
Jade2 C T 11: 51,816,990 D799N probably damaging Het
Jade2 C A 11: 51,848,994 G20C probably null Het
Jag1 C A 2: 137,085,019 S940I probably benign Het
Jakmip1 C T 5: 37,091,583 R196C probably damaging Het
Jakmip1 AG A 5: 37,175,307 probably null Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jmjd1c A G 10: 67,246,125 I2161M probably damaging Het
Jmjd4 G T 11: 59,450,274 E10D probably benign Het
Jph2 T A 2: 163,376,377 probably null Het
Jph4 C A 14: 55,114,926 G117C probably damaging Het
Kalrn C A 16: 34,035,506 G1920V probably damaging Het
Kank2 T A 9: 21,795,249 T158S probably damaging Het
Kat6a G T 8: 22,940,166 G1846W unknown Het
Kazn G T 4: 142,154,504 H142N Het
Kbtbd11 G C 8: 15,027,694 E98Q probably benign Het
Kbtbd12 C A 6: 88,618,668 C60F probably damaging Het
Kcna5 G T 6: 126,533,990 R392S probably damaging Het
Kcna7 G C 7: 45,409,183 R298P probably damaging Het
Kcnab1 C A 3: 65,266,510 L81I probably damaging Het
Kcnab1 C A 3: 65,357,133 H268N probably benign Het
Kcnb2 G T 1: 15,710,958 G685C possibly damaging Het
Kcnc1 C G 7: 46,397,852 R59G probably damaging Het
Kcnc2 G T 10: 112,272,306 G201W probably damaging Het
Kcnc3 G T 7: 44,596,106 G607W probably damaging Het
Kcnd2 G T 6: 21,216,416 D40Y probably damaging Het
Kcnd3 ACC A 3: 105,459,570 probably null Het
Kcnh5 G T 12: 75,007,797 L458I possibly damaging Het
Kcnh5 G C 12: 75,114,522 P204R probably damaging Het
Kcnh8 G C 17: 52,803,471 V237L probably damaging Het
Kcnh8 C G 17: 52,978,093 C1030W possibly damaging Het
Kcnip3 C A 2: 127,510,881 A73S probably benign Het
Kcnj1 C T 9: 32,397,359 L360F probably damaging Het
Kcnj10 C A 1: 172,369,135 S72Y possibly damaging Het
Kcnj10 C A 1: 172,369,221 P101T probably benign Het
Kcnj14 G T 7: 45,819,909 C57* probably null Het
Kcnj16 G T 11: 111,024,553 D14Y possibly damaging Het
Kcnj16 G A 11: 111,025,770 M419I probably benign Het
Kcnj4 C G 15: 79,485,169 W203C probably damaging Het
Kcnj5 G T 9: 32,317,698 P381H possibly damaging Het
Kcnj9 G T 1: 172,323,183 Q288K possibly damaging Het
Kcnk1 A C 8: 126,029,653 T305P probably benign Het
Kcnk12 G A 17: 87,746,043 P397L probably benign Het
Kcnk13 A T 12: 100,061,529 N288Y possibly damaging Het
Kcnk18 C CA 19: 59,225,479 probably null Het
Kcnk3 G T 5: 30,588,274 probably benign Het
Kcnk3 G C 5: 30,622,493 A296P probably benign Het
Kcnk3 G T 5: 30,622,704 G366V possibly damaging Het
Kcnk5 G C 14: 20,145,050 P124R probably damaging Het
Kcnk5 C A 14: 20,181,374 E27* probably null Het
Kcnn3 G A 3: 89,520,923 G152E probably damaging Het
Kcnn3 G T 3: 89,661,136 A574S possibly damaging Het
Kcnq1 G T 7: 143,108,464 probably benign Het
Kcnq3 G C 15: 65,995,452 R781G possibly damaging Het
Kcnt1 G T 2: 25,901,228 E528* probably null Het
Kcnt1 C T 2: 25,909,265 R949* probably null Het
Kcnt2 C A 1: 140,609,648 P1115H possibly damaging Het
Kcnu1 G T 8: 25,849,764 G37W probably damaging Het
Kcnv1 C A 15: 45,114,435 G69V probably damaging Het
Kcnv2 C A 19: 27,323,241 A164E probably benign Het
Kcp C A 6: 29,485,525 V1157L probably benign Het
Kctd12 C G 14: 102,981,918 G175R not run Het
Kctd19 G T 8: 105,388,517 H471N probably damaging Het
Kdelr1 G T 7: 45,872,948 probably benign Het
Kdm2b C A 5: 122,880,797 R860L probably damaging Het
Kdm4a C T 4: 118,147,169 D691N probably benign Het
Kdm5b AGG AG 1: 134,595,798 probably null Het
Kdm6b T A 11: 69,403,866 Q1162L unknown Het
Kdr C A 5: 75,968,475 K170N probably benign Het
Kel T A 6: 41,689,559 Q446L probably benign Het
Khdrbs2 C G 1: 32,243,967 I53M probably benign Het
Khdrbs3 G T 15: 68,928,831 R29L probably benign Het
Kif11 G T 19: 37,413,287 G904V possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif14 G T 1: 136,478,365 A556S probably benign Het
Kif15 G T 9: 122,951,051 probably benign Het
Kif16b C G 2: 142,711,824 R1018P probably damaging Het
Kif17 G T 4: 138,287,930 E463D probably benign Het
Kif18a G T 2: 109,294,957 D240Y probably damaging Het
Kif19a C A 11: 114,781,315 Q243K probably benign Het
Kif19a C G 11: 114,784,904 R401G probably benign Het
Kif1c G T 11: 70,702,893 G32C probably damaging Het
Kif20b G T 19: 34,950,466 E1043* probably null Het
Kif21b C G 1: 136,148,312 R280G probably damaging Het
Kif23 C G 9: 61,924,163 Q708H possibly damaging Het
Kif26a G T 12: 112,177,611 R1433L probably damaging Het
Kif26b C G 1: 178,821,548 A411G probably benign Het
Kif26b G T 1: 178,821,550 E412* probably null Het
Kif26b C A 1: 178,915,405 S1022* probably null Het
Kif28 C T 1: 179,728,219 R333Q not run Het
Kif3c G T 12: 3,367,245 G422V probably damaging Het
Kif5a G T 10: 127,229,823 D1013E probably benign Het
Kif5a T A 10: 127,236,967 K685* probably null Het
Kif6 G A 17: 49,715,100 A343T probably damaging Het
Kifap3 G T 1: 163,862,062 W538C probably damaging Het
Kifc2 G T 15: 76,661,288 E78D possibly damaging Het
Kirrel C A 3: 87,083,875 E629* probably null Het
Kirrel2 C A 7: 30,452,746 G479V probably benign Het
Kiz C A 2: 146,935,827 H468Q possibly damaging Het
Klb G T 5: 65,348,741 W110C probably damaging Het
Klc4 C T 17: 46,635,409 probably null Het
Klf6 G T 13: 5,864,882 E107* probably null Het
Klhdc3 C A 17: 46,676,751 R292L probably damaging Het
Klhdc7a G T 4: 139,965,662 T658N probably benign Het
Klhdc7a G C 4: 139,967,000 T212R probably benign Het
Klhl11 T A 11: 100,463,966 Q343L probably benign Het
Klhl14 G C 18: 21,652,104 Q89E probably benign Het
Klhl15 A T X: 94,252,872 R151W probably damaging Het
Klhl25 G C 7: 75,866,122 D259H possibly damaging Het
Klhl29 C A 12: 5,081,152 *876L probably null Het
Klhl3 C A 13: 58,009,409 V588L probably benign Het
Klhl38 T A 15: 58,314,936 Y546F possibly damaging Het
Klhl4 C A X: 114,551,602 S560R probably damaging Het
Klhl40 G T 9: 121,780,693 A515S probably benign Het
Klhl6 C A 16: 19,982,961 E15* probably null Het
Klhl8 C A 5: 103,886,039 R37S probably benign Het
Klk11 C A 7: 43,778,335 L183M possibly damaging Het
Klkb1 G A 8: 45,275,472 H417Y probably damaging Het
Klra3 C A 6: 130,330,121 probably null Het
Klrb1c G T 6: 128,788,447 P60Q probably damaging Het
Klrb1f G C 6: 129,052,503 G44R possibly damaging Het
Klrc2 A T 6: 129,660,417 L47Q probably benign Het
Klrg2 G A 6: 38,636,916 R51C probably damaging Het
Kmo C A 1: 175,649,186 L162I probably damaging Het
Kmt2a G T 9: 44,819,121 P3300T unknown Het
Kmt2b C A 7: 30,575,024 G2085V probably benign Het
Kmt2b G A 7: 30,584,163 P924L probably damaging Het
Kmt2b C A 7: 30,586,416 R350S unknown Het
Kmt2c C G 5: 25,295,397 probably null Het
Kmt2c C A 5: 25,300,003 A3436S probably benign Het
Kmt2c C A 5: 25,366,197 probably null Het
Kmt2e G T 5: 23,481,208 probably null Het
Kmt5c G T 7: 4,746,700 V406L probably damaging Het
Kndc1 G T 7: 139,921,912 S955I possibly damaging Het
Kng1 T G 16: 23,073,389 M234R probably benign Het
Kras C A 6: 145,246,772 G12C probably damaging Het
Krba1 G T 6: 48,413,256 W686C probably damaging Het
Krba1 G T 6: 48,415,894 R914L probably damaging Het
Krt1 C A 15: 101,846,016 G600C unknown Het
Krt1 T A 15: 101,850,535 S65C unknown Het
Krt10 G T 11: 99,386,232 H460N unknown Het
Krt12 C A 11: 99,422,104 G38V unknown Het
Krt17 A G 11: 100,259,196 Y217H probably damaging Het
Krt17 C T 11: 100,259,711 D167N possibly damaging Het
Krt2 C A 15: 101,811,550 G562* probably null Het
Krt32 G T 11: 100,084,069 R351S possibly damaging Het
Krt35 G T 11: 100,096,057 R44S probably benign Het
Krt42 C A 11: 100,267,068 R190L probably damaging Het
Krt6b C G 15: 101,678,332 E283Q probably damaging Het
Krt7 G T 15: 101,423,467 K388N probably damaging Het
Krt72 A T 15: 101,778,308 L401Q probably damaging Het
Krt73 C A 15: 101,793,811 R539I probably damaging Het
Krt75 G T 15: 101,571,054 D280E probably benign Het
Krt78 C T 15: 101,947,660 G572E probably benign Het
Krt8 T A 15: 101,999,435 E235V probably damaging Het
Krt84 TG T 15: 101,525,982 probably null Het
Krt86 G C 15: 101,476,897 R316P probably damaging Het
Krtap1-5 G C 11: 99,580,857 P37A unknown Het
Krtap28-10 C A 1: 83,042,159 G87C unknown Het
Krtap5-1 C G 7: 142,296,960 G37A unknown Het
Krtap5-2 C A 7: 142,175,781 G54V unknown Het
Krtap5-3 G T 7: 142,202,053 C209F unknown Het
Ksr2 G C 5: 117,708,200 E711Q probably damaging Het
Ksr2 C A 5: 117,747,408 Q766K probably damaging Het
Ktn1 G T 14: 47,692,438 probably null Het
L3mbtl3 C A 10: 26,280,402 E636* probably null Het
L3mbtl3 C A 10: 26,302,663 G551C unknown Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lama3 A T 18: 12,429,879 probably null Het
Lama4 G T 10: 39,005,424 G70* probably null Het
Lama4 G T 10: 39,005,425 G70V probably damaging Het
Lama5 G C 2: 180,183,630 D2450E probably benign Het
Lama5 C A 2: 180,189,419 V1816L probably damaging Het
Lama5 C A 2: 180,190,714 A1681S possibly damaging Het
Lama5 C T 2: 180,198,810 G599R probably damaging Het
Lao1 C A 4: 118,968,371 P463T probably damaging Het
Larp1 G T 11: 58,049,787 E580* probably null Het
Lars2 G T 9: 123,454,782 R705M probably damaging Het
Lbp C T 2: 158,320,306 P263S probably benign Het
Lce1b A T 3: 92,656,035 C64S unknown Het
Lce1f C T 3: 92,719,198 G51S unknown Het
Lcn12 C A 2: 25,492,241 G151C probably benign Het
Ldb3 G A 14: 34,544,103 R512W probably damaging Het
Ldlr G A 9: 21,739,830 A515T probably benign Het
Ldlrad2 G T 4: 137,574,533 R13S probably benign Het
Lef1 C A 3: 131,193,181 P257T probably damaging Het
Lefty2 C A 1: 180,894,778 P227Q possibly damaging Het
Lep T A 6: 29,071,096 Y140N probably damaging Het
Lep A C 6: 29,071,097 Y140S probably damaging Het
Lepr G T 4: 101,735,595 D136Y probably damaging Het
Lgals12 T A 19: 7,598,080 Q297L probably benign Het
Lgals4 G C 7: 28,841,497 R282P probably damaging Het
Lgr5 C G 10: 115,456,669 A511P probably benign Het
Lhcgr C A 17: 88,753,905 Q239H probably benign Het
Lhcgr C A 17: 88,764,981 probably null Het
Lhfpl1 T G X: 145,291,165 D215A probably benign Het
Lhx9 G T 1: 138,831,498 P355T probably damaging Het
Lilr4b G T 10: 51,481,349 G94C probably damaging Het
Lilra6 G T 7: 3,912,581 T385K possibly damaging Het
Limch1 G T 5: 67,028,799 W647C probably damaging Het
Limd1 G C 9: 123,480,021 A262P probably damaging Het
Lims1 T A 10: 58,409,656 I169K probably benign Het
Lin28b C A 10: 45,420,606 G99C probably damaging Het
Lin9 G C 1: 180,650,802 W58S probably benign Het
Lingo1 C T 9: 56,620,942 R127H possibly damaging Het
Lingo2 C A 4: 35,709,656 R108L probably benign Het
Lingo4 C A 3: 94,402,994 P413H probably damaging Het
Lipg T A 18: 74,941,340 probably null Het
Lipi G T 16: 75,550,287 R415S probably benign Het
Lmcd1 C A 6: 112,310,674 T107N possibly damaging Het
Lmcd1 G C 6: 112,310,676 G108R probably benign Het
Lmna G C 3: 88,486,236 L302V probably benign Het
Lmo3 C A 6: 138,416,496 C42F probably damaging Het
Lmo3 C A 6: 138,416,500 A41S probably benign Het
Lmo7 G T 14: 101,896,518 Q666H possibly damaging Het
Lmo7 G A 14: 101,898,557 D689N probably damaging Het
Lnpk C T 2: 74,573,562 M1I probably null Het
Lnx1 G T 5: 74,627,441 L73I possibly damaging Het
Loxl3 G T 6: 83,038,578 G222* probably null Het
Loxl3 A T 6: 83,048,160 T290S probably benign Het
Lpar5 T G 6: 125,082,018 L234R probably damaging Het
Lpin1 C A 12: 16,579,947 D75Y Het
Lpp G T 16: 24,661,712 D77Y probably damaging Het
Lrat G T 3: 82,903,490 P75T probably damaging Het
Lrba G C 3: 86,540,049 G2067R probably null Het
Lrfn2 CAA CAAA 17: 49,070,012 probably null Het
Lrfn2 G C 17: 49,070,095 G68A probably benign Het
Lrfn2 C A 17: 49,096,715 S622Y probably damaging Het
Lrfn3 C A 7: 30,360,659 G47V possibly damaging Het
Lrfn5 G T 12: 61,839,817 L130F probably damaging Het
Lrmp C A 6: 145,148,074 Q121K probably benign Het
Lrp10 A T 14: 54,467,561 Q107L possibly damaging Het
Lrp1b C G 2: 40,637,749 G4367R Het
Lrp1b C T 2: 41,188,848 G1864E Het
Lrp2 C T 2: 69,451,280 D3916N probably damaging Het
Lrp2 G T 2: 69,472,453 D2977E probably benign Het
Lrp2 C A 2: 69,496,468 R1753I probably damaging Het
Lrp2 C A 2: 69,501,641 R1590L probably damaging Het
Lrp2 G C 2: 69,509,289 L1093V probably benign Het
Lrp3 C A 7: 35,203,012 E568* probably null Het
Lrp5 C T 19: 3,628,345 W503* probably null Het
Lrp6 C A 6: 134,462,541 C1243F probably damaging Het
Lrp8 G C 4: 107,843,332 G156R probably benign Het
Lrrc18 T A 14: 33,008,888 L128Q probably damaging Het
Lrrc37a A T 11: 103,499,967 L1544Q possibly damaging Het
Lrrc37a A T 11: 103,500,520 S1360T probably benign Het
Lrrc37a G T 11: 103,500,598 P1334T probably benign Het
Lrrc37a G T 11: 103,503,027 P524H probably benign Het
Lrrc3c T G 11: 98,599,314 C166G probably damaging Het
Lrrc45 G T 11: 120,718,653 R414L probably benign Het
Lrrc45 A C 11: 120,718,665 E418A possibly damaging Het
Lrrc49 C T 9: 60,598,093 D632N possibly damaging Het
Lrrc4b G T 7: 44,444,979 G24W unknown Het
Lrrc4b G T 7: 44,444,980 G24V unknown Het
Lrrc4b C A 7: 44,461,911 N402K probably damaging Het
Lrrc4b G T 7: 44,462,617 G638* probably null Het
Lrrc4c G T 2: 97,630,483 E485* probably null Het
Lrrc6 T A 15: 66,469,899 K116M probably damaging Het
Lrrc71 G T 3: 87,742,821 H291N probably benign Het
Lrrc72 T A 12: 36,247,693 probably null Het
Lrrc74b C A 16: 17,558,168 probably null Het
Lrrc74b C T 16: 17,558,172 A205T probably damaging Het
Lrrc8a G T 2: 30,256,313 D380Y probably damaging Het
Lrrfip1 G T 1: 91,122,494 G516C possibly damaging Het
Lrriq4 C G 3: 30,649,996 Q58E probably benign Het
Lrrn2 G T 1: 132,937,898 E234* probably null Het
Lrrn2 T A 1: 132,938,978 W594R probably benign Het
Lrrtm4 C G 6: 80,022,717 R371G probably benign Het
Lrwd1 T A 5: 136,131,541 Q313L possibly damaging Het
Lsg1 C A 16: 30,573,289 Q221H probably damaging Het
Ltbp2 C T 12: 84,829,316 V506M possibly damaging Het
Ltbp3 A G 19: 5,747,730 T466A probably damaging Het
Ltf G T 9: 111,021,005 V68L probably benign Het
Ltf C G 9: 111,024,393 P237R probably damaging Het
Ltn1 C T 16: 87,402,037 C1158Y probably benign Het
Luc7l G T 17: 26,281,661 W337C unknown Het
Luc7l3 GC G 11: 94,321,775 probably null Het
Ly6g6f C T 17: 35,083,032 V149M possibly damaging Het
Ly75 C A 2: 60,350,004 E610* probably null Het
Ly75 C A 2: 60,352,133 R566L possibly damaging Het
Lypd5 A C 7: 24,352,613 N118H probably damaging Het
Lypd6 TC T 2: 50,190,807 probably null Het
Lypd6b C A 2: 49,942,596 P58T probably damaging Het
Lyst G T 13: 13,680,134 R2363L possibly damaging Het
Macf1 C A 4: 123,471,475 E3164D probably benign Het
Mad1l1 C A 5: 140,105,582 G510V probably benign Het
Mad2l1bp C T 17: 46,147,941 R221H probably damaging Het
Madd C G 2: 91,142,831 Q1526H probably damaging Het
Mafb T A 2: 160,366,505 T58S possibly damaging Het
Magel2 G T 7: 62,379,607 R753L unknown Het
Magi2 G T 5: 20,702,412 G1342V probably benign Het
Magix G C X: 7,675,850 R226G probably benign Het
Malt1 G T 18: 65,431,373 G68C probably damaging Het
Malt1 G T 18: 65,448,284 G261V probably damaging Het
Maml2 G T 9: 13,706,590 G411* probably null Het
Man2a1 A C 17: 64,659,020 K318Q probably damaging Het
Man2a1 G C 17: 64,735,054 S989T probably benign Het
Man2b2 C G 5: 36,813,797 D742H probably damaging Het
Mansc4 G A 6: 147,086,961 R2W unknown Het
Map10 G T 8: 125,670,070 K67N probably damaging Het
Map1a G T 2: 121,305,279 C2192F probably damaging Het
Map1s G T 8: 70,914,517 D689Y probably damaging Het
Map2 G A 1: 66,380,680 A57T probably benign Het
Map2 G T 1: 66,438,361 V1756L probably damaging Het
Map3k1 C A 13: 111,755,946 G925V probably benign Het
Map3k19 G T 1: 127,822,034 S1193R probably benign Het
Map3k20 C T 2: 72,298,315 R32* probably null Het
Map3k4 C A 17: 12,271,697 Q282H probably damaging Het
Map3k9 G C 12: 81,722,279 S998R probably damaging Het
Map3k9 C A 12: 81,780,846 C10F unknown Het
Map4 G C 9: 110,068,523 probably null Het
Map4k1 G C 7: 29,000,008 R614P probably damaging Het
Map7d1 C A 4: 126,234,377 R617L unknown Het
Mapk15 C A 15: 75,998,461 S441* probably null Het
Mapk7 C A 11: 61,491,362 Q241H probably damaging Het
Marc1 G T 1: 184,803,937 P203Q possibly damaging Het
March4 C A 1: 72,428,957 Q305H probably damaging Het
March8 G T 6: 116,338,272 probably benign Het
Mast1 C A 8: 84,920,446 R650L probably benign Het
Mast3 T A 8: 70,789,038 probably null Het
Maz C A 7: 127,025,896 A151S unknown Het
Mbd1 G T 18: 74,276,939 K501N probably null Het
Mbl2 C A 19: 30,233,997 S6Y probably damaging Het
Mblac2 C G 13: 81,750,167 R221G probably benign Het
Mboat1 C T 13: 30,226,378 H273Y probably benign Het
Mbp C A 18: 82,513,010 P27T unknown Het
Mbp A T 18: 82,561,845 H80L probably benign Het
Mbtd1 G C 11: 93,912,459 probably null Het
Mc2r T A 18: 68,407,712 H170L possibly damaging Het
Mc3r C A 2: 172,249,816 S319R probably benign Het
Mcam G T 9: 44,134,590 probably benign Het
Mcc C A 18: 44,491,246 A411S probably benign Het
Mcf2l G T 8: 13,009,654 E720* probably null Het
Mcm4 C A 16: 15,629,454 D549Y probably damaging Het
Mcm4 A C 16: 15,632,216 D317E possibly damaging Het
Mcm5 G T 8: 75,121,672 M516I possibly damaging Het
Mcoln2 A T 3: 146,175,704 Q233L probably damaging Het
Mcpt8 C G 14: 56,082,336 C219S probably benign Het
Mcu C A 10: 59,456,771 V29L probably benign Het
Mcub C A 3: 129,916,942 A227S unknown Het
Mcub C T 3: 129,916,943 R280Q probably damaging Het
Mdm1 G T 10: 118,158,496 R470M possibly damaging Het
Mecr A T 4: 131,854,583 probably null Het
Med10 A G 13: 69,809,970 K14E probably benign Het
Med12l G T 3: 59,247,875 G1159W probably damaging Het
Med15 T A 16: 17,653,232 H698L possibly damaging Het
Mef2c C A 13: 83,625,266 T87K probably benign Het
Mef2d G A 3: 88,158,128 R118Q possibly damaging Het
Megf11 T G 9: 64,680,326 C469G probably damaging Het
Megf6 C A 4: 154,237,826 P37T probably benign Het
Megf6 G C 4: 154,250,849 G255A probably damaging Het
Megf6 G T 4: 154,267,681 K1214N possibly damaging Het
Megf6 G T 4: 154,267,682 D1215Y probably damaging Het
Megf6 C A 4: 154,267,747 C1236* probably null Het
Megf6 C A 4: 154,269,741 C1367* probably null Het
Megf8 G T 7: 25,346,162 G1403C probably damaging Het
Megf8 G T 7: 25,347,369 G1559V probably damaging Het
Meioc TCC TC 11: 102,666,364 probably null Het
Meltf G T 16: 31,880,234 C54F probably damaging Het
Mep1a T A 17: 43,486,297 Q293L probably damaging Het
Mep1a C G 17: 43,486,306 G290A probably damaging Het
Mest C A 6: 30,723,575 probably benign Het
Mettl21e G T 1: 44,206,550 L179M probably damaging Het
Mettl8 C G 2: 70,973,338 D202H probably damaging Het
Mettl9 G T 7: 121,057,330 V228F probably damaging Het
Mex3d C G 10: 80,381,350 A678P unknown Het
Mfge8 G T 7: 79,145,737 F27L probably benign Het
Mfhas1 G T 8: 35,590,385 Q671H possibly damaging Het
Mfn1 G T 3: 32,564,291 E550* probably null Het
Mfrp G C 9: 44,102,519 G109R probably damaging Het
Mfsd2b G A 12: 4,865,794 S406L probably damaging Het
Mfsd5 G A 15: 102,281,255 C354Y possibly damaging Het
Mfsd6 C G 1: 52,658,501 Q742H probably benign Het
Mfsd6l G T 11: 68,556,982 V220F possibly damaging Het
Mfsd6l A T 11: 68,557,714 S464C probably damaging Het
Mfsd8 C A 3: 40,846,861 probably benign Het
Mgam G T 6: 40,740,071 L229F probably damaging Het
Mgat4a G T 1: 37,490,372 P142H probably damaging Het
Mgat4c C A 10: 102,388,450 P175H probably damaging Het
Mgat4c G T 10: 102,388,602 D226Y probably damaging Het
Mgat5 G C 1: 127,482,692 K730N probably damaging Het
Mgme1 G T 2: 144,276,476 V223F probably damaging Het
Mgrn1 A T 16: 4,922,724 Q309L probably benign Het
Mgst2 C G 3: 51,661,270 L8V probably damaging Het
Mib1 G T 18: 10,763,309 R453I probably damaging Het
Mib2 C G 4: 155,655,521 probably null Het
Mical1 G T 10: 41,481,705 R436L probably null Het
Mical3 C G 6: 120,959,728 R1279P possibly damaging Het
Micall2 C T 5: 139,710,302 E844K unknown Het
Micu1 G T 10: 59,728,041 Q28H probably benign Het
Micu3 G T 8: 40,308,224 W58C probably damaging Het
Midn G A 10: 80,150,240 E55K probably damaging Het
Mier2 C A 10: 79,540,461 G210V unknown Het
Mindy4 G A 6: 55,224,341 R337H probably benign Het
Miox G T 15: 89,335,644 D112Y probably damaging Het
Mitf A T 6: 98,006,121 probably null Het
Mkl2 G T 16: 13,385,606 G161V probably benign Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mks1 GCCC GCC 11: 87,860,723 probably null Het
Mkx G T 18: 6,937,195 P283Q probably benign Het
Mlf2 G T 6: 124,934,306 G95W probably damaging Het
Mllt10 G C 2: 18,171,076 probably null Het
Mllt6 G T 11: 97,676,425 G676C possibly damaging Het
Mmd G T 11: 90,259,888 W57L probably damaging Het
Mmel1 G T 4: 154,894,074 probably null Het
Mmgt2 A C 11: 62,665,074 T83P probably damaging Het
Mmp13 C T 9: 7,277,953 P282L probably damaging Het
Mmp13 C A 9: 7,280,200 P377T possibly damaging Het
Mmp17 G A 5: 129,595,661 D226N possibly damaging Het
Mmp1a G T 9: 7,464,230 A12S probably benign Het
Mmp1a C T 9: 7,467,033 T237M possibly damaging Het
Mmp1b C A 9: 7,369,322 probably null Het
Mmp20 G T 9: 7,644,062 Q250H probably benign Het
Mmp21 G T 7: 133,674,933 P447H probably damaging Het
Mmp25 G C 17: 23,644,137 A100G possibly damaging Het
Mmp7 C A 9: 7,695,178 P47H probably benign Het
Mmrn1 G T 6: 60,987,098 S1028I possibly damaging Het
Mms19 C A 19: 41,957,140 probably null Het
Mn1 G T 5: 111,420,068 G635C probably damaging Het
Mndal A T 1: 173,874,404 S111T unknown Het
Mogat1 G T 1: 78,529,253 probably null Het
Mogat2 C A 7: 99,223,629 G116V probably damaging Het
Morc1 C G 16: 48,565,706 A564G probably benign Het
Morc2b C A 17: 33,137,402 W465C probably damaging Het
Morn3 CGG CG 5: 123,046,720 probably null Het
Mov10l1 G T 15: 88,996,136 R275I probably benign Het
Mov10l1 G T 15: 89,018,168 D754Y probably damaging Het
Mov10l1 G T 15: 89,053,411 D1138Y probably damaging Het
Moxd1 G C 10: 24,284,804 V452L probably benign Het
Mpdz C A 4: 81,320,490 L1150F probably damaging Het
Mpl C A 4: 118,443,655 C559F Het
Mplkip G T 13: 17,695,442 probably benign Het
Mpp7 C A 18: 7,355,062 V455F probably damaging Het
Mpped2 G T 2: 106,744,803 G78W probably damaging Het
Mpped2 G T 2: 106,861,592 G214V probably damaging Het
Mprip G C 11: 59,757,637 Q722H probably damaging Het
Mrc1 A C 2: 14,244,138 N162H probably damaging Het
Mrc1 C T 2: 14,289,116 P638L probably damaging Het
Mrgpra3 C A 7: 47,601,301 G2* probably null Het
Mrgpra6 G T 7: 47,189,162 S65Y possibly damaging Het
Mrgprb2 C A 7: 48,552,973 M1I probably null Het
Mrgprh T A 17: 12,877,587 M238K probably damaging Het
Mroh1 G A 15: 76,423,761 G421S probably damaging Het
Mroh2b G C 15: 4,905,005 Q119H probably damaging Het
Mroh3 C A 1: 136,192,136 E442D probably benign Het
Mroh4 A T 15: 74,627,720 L104Q probably damaging Het
Mroh4 T A 15: 74,628,002 H84L possibly damaging Het
Mroh6 G T 15: 75,887,818 P170H probably damaging Het
Mrpl19 A T 6: 81,964,310 L90Q probably damaging Het
Mrpl9 G T 3: 94,443,373 G8V probably benign Het
Mrps27 G C 13: 99,414,843 E371D possibly damaging Het
Mrps28 C A 3: 8,923,746 L17F probably damaging Het
Mrps36 C A 13: 100,736,270 G99W probably damaging Het
Mrps9 A G 1: 42,899,458 T274A probably benign Het
Ms4a13 G T 19: 11,172,584 P138T probably benign Het
Ms4a4b C A 19: 11,449,938 T7N possibly damaging Het
Ms4a4c G C 19: 11,421,309 V164L probably benign Het
Ms4a6b C G 19: 11,520,423 P29A probably benign Het
Msh4 C G 3: 153,879,368 E454D probably benign Het
Msh4 T A 3: 153,901,443 probably benign Het
Msr1 G C 8: 39,631,302 P71A probably damaging Het
Msx1 C T 5: 37,824,015 D107N possibly damaging Het
Mt1 C A 8: 94,179,333 S8Y unknown Het
Mt1 G C 8: 94,180,129 C41S probably damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Mtcl1 C A 17: 66,344,295 G1392W probably damaging Het
Mtf2 G T 5: 108,065,902 probably benign Het
Mtf2 G T 5: 108,080,888 K23N possibly damaging Het
Mthfsl C G 9: 88,688,985 G127A probably damaging Het
Mtmr4 G T 11: 87,611,880 R920L probably benign Het
Mtmr7 C A 8: 40,597,379 E124D probably benign Het
Mtr C T 13: 12,187,049 V1240M probably benign Het
Mtr C A 13: 12,249,866 E117* probably null Het
Mtss1 G T 15: 58,945,420 S507R probably damaging Het
Mtus2 C A 5: 148,204,077 P918T probably damaging Het
Mtx1 C A 3: 89,213,859 G156V probably damaging Het
Mtx1 G T 3: 89,214,105 P74H probably benign Het
Muc16 G T 9: 18,537,571 H7655N probably benign Het
Muc16 G A 9: 18,657,861 Q1121* probably null Het
Muc2 A T 7: 141,744,794 Q61L Het
Muc4 C T 16: 32,767,393 Q700* probably null Het
Muc4 A T 16: 32,767,394 Q700L Het
Muc4 G T 16: 32,774,862 K1025N Het
Muc5ac C A 7: 141,809,224 P2091T unknown Het
Muc5ac C A 7: 141,818,040 H3330N probably benign Het
Muc5b C A 7: 141,863,173 S3285R probably benign Het
Muc6 G T 7: 141,637,914 T2282N possibly damaging Het
Muc6 G C 7: 141,650,436 H339Q probably benign Het
Muc6 G T 7: 141,651,391 A187E probably benign Het
Mug1 C A 6: 121,863,808 P539H probably damaging Het
Mug1 G C 6: 121,879,299 probably null Het
Mug1 C A 6: 121,886,568 S1408R probably damaging Het
Mug2 A G 6: 122,037,121 T389A probably damaging Het
Mybl1 C G 1: 9,676,040 G465A probably benign Het
Mybpc1 G T 10: 88,573,437 Q52K probably benign Het
Mybpc3 C A 2: 91,123,964 P394Q possibly damaging Het
Mycbp2 C A 14: 103,127,063 probably null Het
Mycbp2 C A 14: 103,135,123 V4096F probably damaging Het
Mycbp2 C A 14: 103,169,873 Q2780H possibly damaging Het
Mycbpap C A 11: 94,509,854 V340L probably damaging Het
Myct1 G T 10: 5,604,361 G76V probably damaging Het
Myf5 G T 10: 107,484,094 P232T possibly damaging Het
Myh1 T A 11: 67,206,318 L399H probably damaging Het
Myh11 C G 16: 14,209,595 E1258D Het
Myh13 T A 11: 67,350,452 L885Q possibly damaging Het
Myh13 C A 11: 67,364,591 R1596S possibly damaging Het
Myh15 C A 16: 49,081,228 Q256K probably benign Het
Myh15 C G 16: 49,155,618 R1350G probably damaging Het
Myh15 A T 16: 49,159,826 Q1437L probably benign Het
Myh2 C A 11: 67,176,171 T178N possibly damaging Het
Myh2 A T 11: 67,193,258 Q1569L probably damaging Het
Myh8 A T 11: 67,301,424 Q1401L probably damaging Het
Myh8 C G 11: 67,308,355 L1896V possibly damaging Het
Myl1 G T 1: 66,935,303 probably benign Het
Mylk G T 16: 34,922,651 A1178S possibly damaging Het
Mylk2 C A 2: 152,920,330 T507N probably damaging Het
Mylk3 G T 8: 85,359,194 P237Q probably benign Het
Mylk3 A T 8: 85,365,179 Het
Myo10 A T 15: 25,781,401 E994V probably damaging Het
Myo10 G T 15: 25,799,554 probably null Het
Myo15 G A 11: 60,477,523 G370R probably damaging Het
Myo15 G T 11: 60,488,837 D288Y Het
Myo15 G C 11: 60,495,475 V640L Het
Myo16 A T 8: 10,474,691 Q814L unknown Het
Myo18a G T 11: 77,841,995 R1330L probably damaging Het
Myo18b G T 5: 112,692,899 L2343M probably damaging Het
Myo18b C T 5: 112,762,721 R1935H not run Het
Myo18b G T 5: 112,873,541 Y551* probably null Het
Myo18b C A 5: 112,875,152 E125* probably null Het
Myo1a G T 10: 127,706,875 Q127H probably benign Het
Myo1a C A 10: 127,706,881 N129K possibly damaging Het
Myo1g G T 11: 6,517,935 R167S probably damaging Het
Myo1h G C 5: 114,334,156 A432P Het
Myo3a C A 2: 22,618,140 Q1613K possibly damaging Het
Myo3b G T 2: 70,096,361 D79Y probably damaging Het
Myo3b T A 2: 70,258,027 V878E probably benign Het
Myo5a G T 9: 75,186,036 V14L Het
Myo5b G A 18: 74,617,017 G184S probably benign Het
Myo5c C A 9: 75,246,255 A141E probably damaging Het
Myo7a C A 7: 98,052,226 R2127L probably damaging Het
Myo7a T A 7: 98,085,523 probably null Het
Myo7b A T 18: 31,985,056 L839Q probably damaging Het
Myo9b G C 8: 71,290,709 R138P probably damaging Het
Myrf C A 19: 10,219,544 G291C probably damaging Het
Myrip C T 9: 120,432,778 P486S probably benign Het
Myrip G A 9: 120,441,481 G599E probably damaging Het
Myt1 G T 2: 181,797,162 S201I probably damaging Het
Myt1 G T 2: 181,807,602 W772L probably damaging Het
Myt1l C A 12: 29,811,431 P71T probably damaging Het
Myt1l C A 12: 29,842,468 R632S unknown Het
N4bp1 C A 8: 86,853,159 E672* probably null Het
N4bp2 G C 5: 65,807,637 G1010R probably damaging Het
Naa16 C G 14: 79,344,979 A557P probably damaging Het
Naalad2 C A 9: 18,351,102 D415Y probably damaging Het
Naaladl2 C T 3: 23,804,978 A776T probably damaging Het
Nadk G A 4: 155,587,700 V283M probably damaging Het
Naga C A 15: 82,336,814 D94Y probably damaging Het
Naip2 A C 13: 100,152,629 S1198A possibly damaging Het
Naip2 A T 13: 100,161,909 Y540N probably benign Het
Naip2 G C 13: 100,162,865 A380G probably benign Het
Naip6 C T 13: 100,299,417 R866H probably benign Het
Naip6 T A 13: 100,300,800 E405V probably damaging Het
Naip6 C A 13: 100,316,130 R141L probably damaging Het
Nalcn C A 14: 123,294,445 S1331I probably damaging Het
Nalcn C A 14: 123,594,568 G98V probably damaging Het
Nat1 A T 8: 67,491,713 K250M probably damaging Het
Nat8f6 T A 6: 85,808,726 Q147L possibly damaging Het
Nat8l C A 5: 34,001,094 L283I possibly damaging Het
Nav1 G T 1: 135,469,731 P900H possibly damaging Het
Nav2 C A 7: 49,452,761 P436T possibly damaging Het
Nav2 C A 7: 49,594,223 T2066K probably benign Het
Nbea C T 3: 56,031,550 D706N probably damaging Het
Nbeal2 C A 9: 110,629,854 L2034F probably benign Het
Ncan C A 8: 70,097,472 R1218L probably damaging Het
Ncapg G A 5: 45,672,502 probably null Het
Ncapg2 G C 12: 116,438,605 V686L probably damaging Het
Ncbp3 TCC TC 11: 73,047,968 probably null Het
Ncf2 G A 1: 152,825,942 probably null Het
Nck2 G T 1: 43,554,356 R241L probably benign Het
Nckap5 C A 1: 126,222,659 E110* probably null Het
Nckap5l T G 15: 99,424,201 T1049P probably benign Het
Ncoa1 C G 12: 4,306,514 G287R probably damaging Het
Ncoa3 G C 2: 166,048,508 G105R probably damaging Het
Ncoa6 C A 2: 155,406,142 Q1747H possibly damaging Het
Ncoa6 T C 2: 155,421,218 K432R probably damaging Het
Ncor2 C A 5: 125,036,849 G273V Het
Ncor2 C T 5: 125,047,994 S742N probably damaging Het
Ndfip2 C A 14: 105,258,712 P14T possibly damaging Het
Ndor1 C A 2: 25,247,789 R573L probably benign Het
Ndrg4 G A 8: 95,710,961 V321M possibly damaging Het
Ndst4 A T 3: 125,570,740 probably null Het
Ndufb10 C A 17: 24,722,470 C113F probably damaging Het
Ndufs1 C A 1: 63,163,808 G199V probably damaging Het
Ndufs1 ACC AC 1: 63,169,251 probably null Het
Ndufs6 A G 13: 73,328,436 V4A probably benign Het
Neb C A 2: 52,162,998 K6531N probably damaging Het
Neb C G 2: 52,209,407 Q4810H possibly damaging Het
Neb C A 2: 52,256,670 D2861Y probably damaging Het
Neb C A 2: 52,299,502 R792I probably damaging Het
Nek10 G T 14: 14,853,948 G378V probably benign Het
Nek10 G T 14: 15,001,157 E1086* probably null Het
Nek9 C T 12: 85,334,045 W155* probably null Het
Nemp1 G T 10: 127,693,519 W223C probably damaging Het
Neurl4 G T 11: 69,904,090 R320L possibly damaging Het
Nf1 G T 11: 79,564,925 A559S probably benign Het
Nfasc G T 1: 132,631,838 Q185K probably damaging Het
Nfat5 G C 8: 107,338,842 G96A probably damaging Het
Nfatc3 A T 8: 106,092,066 Q480L probably damaging Het
Nfe2 G C 15: 103,248,557 H336D possibly damaging Het
Nfe2l2 C A 2: 75,676,779 G326C possibly damaging Het
Nfe2l3 G A 6: 51,433,297 A131T possibly damaging Het
Nfkb2 G T 19: 46,311,590 G826W probably damaging Het
Nfkbie G T 17: 45,560,508 R297L probably damaging Het
Nfya C A 17: 48,393,513 G117W unknown Het
Nfyc C A 4: 120,790,466 G6W unknown Het
Ngdn G T 14: 55,021,944 D182Y probably null Het
Ngef C G 1: 87,482,709 V451L possibly damaging Het
Nhsl1 G A 10: 18,526,589 D1188N probably benign Het
Nid2 T A 14: 19,789,808 C822S probably damaging Het
Nifk G T 1: 118,321,900 G3V probably benign Het
Nim1k T A 13: 119,727,702 Q57L probably benign Het
Nin C T 12: 70,044,095 E849K Het
Nin C G 12: 70,054,426 E466Q Het
Ninl C A 2: 150,953,398 G608C probably damaging Het
Nipbl C A 15: 8,336,952 D1218Y probably damaging Het
Nipbl C T 15: 8,338,680 probably null Het
Nipsnap1 G T 11: 4,889,956 G226* probably null Het
Nisch CT C 14: 31,177,438 probably null Het
Nkapl C G 13: 21,468,303 G47R unknown Het
Nkd1 G T 8: 88,592,051 V439L probably benign Het
Nkpd1 C A 7: 19,523,777 L494M probably damaging Het
Nkpd1 A C 7: 19,523,952 D552A probably damaging Het
Nkx1-1 G T 5: 33,431,495 P150T unknown Het
Nkx1-2 C A 7: 132,597,622 G137C probably damaging Het
Nkx1-2 G T 7: 132,599,421 L36I probably benign Het
Nkx2-3 G A 19: 43,614,737 A261T possibly damaging Het
Nle1 C G 11: 82,901,843 V414L possibly damaging Het
Nlrc5 G T 8: 94,506,580 probably null Het
Nlrp10 G A 7: 108,925,851 Q141* probably null Het
Nlrp12 T C 7: 3,222,537 K1034R probably benign Het
Nlrp1a C A 11: 71,123,169 Q418H probably benign Het
Nlrp1b C A 11: 71,181,299 E573* probably null Het
Nlrp1b G T 11: 71,217,224 Q484K probably benign Het
Nlrp4f C A 13: 65,194,661 S390I probably damaging Het
Nlrp9a G T 7: 26,557,456 W166C probably damaging Het
Nlrp9b G A 7: 20,026,646 V661M probably benign Het
Nlrp9c A G 7: 26,382,348 V651A probably benign Het
Nlrp9c C T 7: 26,384,775 D460N probably damaging Het
Nlrp9c G T 7: 26,384,825 T443K possibly damaging Het
Nlrx1 T A 9: 44,256,752 E616V possibly damaging Het
Nmbr G T 10: 14,770,327 S315I probably benign Het
Nmnat3 G T 9: 98,399,542 A66S probably benign Het
Nmt1 A T 11: 103,055,213 T174S probably benign Het
Nnt C A 13: 119,354,741 probably null Het
Nodal G T 10: 61,418,375 A26S probably benign Het
Nol10 A T 12: 17,359,088 probably null Het
Nol4 G T 18: 22,769,840 C371* probably null Het
Nom1 G T 5: 29,449,678 V793L probably benign Het
Nomo1 G T 7: 46,066,273 E714D probably benign Het
Nop53 C A 7: 15,941,745 V222L probably benign Het
Nos1 C A 5: 117,923,278 P890T probably damaging Het
Nos2 G T 11: 78,931,672 E131D probably benign Het
Nos3 C A 5: 24,383,950 P1194T probably benign Het
Notch1 C A 2: 26,460,309 S2273I possibly damaging Het
Notch3 C A 17: 32,166,694 A34S probably benign Het
Notch4 G T 17: 34,575,148 G700W probably damaging Het
Notch4 G A 17: 34,587,908 G1940R probably damaging Het