Incidental Mutation 'R0655:Hspa4'
ID62506
Institutional Source Beutler Lab
Gene Symbol Hspa4
Ensembl Gene ENSMUSG00000020361
Gene Nameheat shock protein 4
Synonyms70kDa, Hsp70RY, Hsp110, APG-2
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R0655 (G1)
Quality Score117
Status Not validated
Chromosome11
Chromosomal Location53259814-53300457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53269692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 519 (E519G)
Ref Sequence ENSEMBL: ENSMUSP00000020630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020630]
Predicted Effect probably benign
Transcript: ENSMUST00000020630
AA Change: E519G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020630
Gene: ENSMUSG00000020361
AA Change: E519G

DomainStartEndE-ValueType
Pfam:HSP70 3 608 2.9e-211 PFAM
Pfam:HSP70 590 693 3.8e-10 PFAM
low complexity region 787 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151854
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit age-dependent neurofibrillary tangles and tau deposits, impaired contextual conditioning, and impaired bar grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Hspa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Hspa4 APN 11 53280717 splice site probably null
IGL00701:Hspa4 APN 11 53271033 missense possibly damaging 0.89
IGL00957:Hspa4 APN 11 53280687 missense probably benign 0.00
IGL02324:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02328:Hspa4 APN 11 53300058 critical splice donor site probably null
IGL02336:Hspa4 APN 11 53262373 missense probably benign 0.00
IGL02441:Hspa4 APN 11 53270982 missense probably benign 0.03
IGL03323:Hspa4 APN 11 53265133 missense probably benign 0.05
IGL03356:Hspa4 APN 11 53269800 missense probably damaging 1.00
R0027:Hspa4 UTSW 11 53283585 missense probably benign 0.00
R0398:Hspa4 UTSW 11 53272879 critical splice acceptor site probably null
R0568:Hspa4 UTSW 11 53262876 splice site probably benign
R1876:Hspa4 UTSW 11 53284156 missense probably benign 0.16
R2225:Hspa4 UTSW 11 53286933 missense probably benign 0.28
R3813:Hspa4 UTSW 11 53270979 missense probably benign 0.21
R3937:Hspa4 UTSW 11 53270949 missense probably benign 0.13
R4360:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R4457:Hspa4 UTSW 11 53280568 missense probably damaging 1.00
R4492:Hspa4 UTSW 11 53280469 missense probably damaging 1.00
R4751:Hspa4 UTSW 11 53284199 missense probably benign 0.22
R5032:Hspa4 UTSW 11 53289123 missense possibly damaging 0.89
R5233:Hspa4 UTSW 11 53286975 missense possibly damaging 0.46
R5320:Hspa4 UTSW 11 53262983 missense probably damaging 1.00
R5650:Hspa4 UTSW 11 53265092 missense probably damaging 1.00
R6108:Hspa4 UTSW 11 53261712 missense probably damaging 0.97
R6211:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6232:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6234:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6235:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6243:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6245:Hspa4 UTSW 11 53262939 missense probably benign 0.06
R6468:Hspa4 UTSW 11 53265056 missense probably benign 0.03
R7194:Hspa4 UTSW 11 53265938 missense probably damaging 1.00
R7308:Hspa4 UTSW 11 53267103 missense possibly damaging 0.70
R7654:Hspa4 UTSW 11 53300124 missense probably damaging 0.98
R7731:Hspa4 UTSW 11 53266964 critical splice donor site probably null
R7813:Hspa4 UTSW 11 53272036 missense probably damaging 1.00
R7841:Hspa4 UTSW 11 53267060 missense possibly damaging 0.95
R7849:Hspa4 UTSW 11 53280703 missense possibly damaging 0.88
R7913:Hspa4 UTSW 11 53262307 missense probably benign 0.01
R7980:Hspa4 UTSW 11 53280577 missense probably benign 0.22
R8679:Hspa4 UTSW 11 53269864 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGCCTTTGGGGTGTTCAAAGC -3'
(R):5'- TATCTGGCACAGCACATGCAGC -3'

Sequencing Primer
(F):5'- GCTTTGAATCTGATGTACAGACAGAC -3'
(R):5'- AAGGTCAGTCTCACTGTGC -3'
Posted On2013-07-30